G Model VIRMET 12404 1–4
ARTICLE IN PRESS Journal of Virological Methods xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
1
Short communication
2
Persistence of viral genomes after autoclaving
3 4 5
Q1
Weon Sang Choi a,∗ , Roberto A. Rodríguez b,1 , Mark D. Sobsey b a b
Department of Biotechnology, College of Science and Technology, Dongguk University-Gyeongju, Gyeongju, Republic of Korea Department of Environmental Sciences and Engineering, Gillings School of Global Public Health, University of North Carolina at Chapel Hill, NC 27599, USA
6
a b s t r a c t
7 8 9 10 11 12 13
Article history: Received 5 June 2013 Received in revised form 26 November 2013 Accepted 11 December 2013 Available online xxx
14 15 16 17 18
19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37
Keywords: Persistence Viral genomes Autoclaving
The ability of autoclaving to degrade viral genomes was investigated by real-time PCR and real-time reverse-transcription (RT)-PCR. Several factors were considered: the nucleic acid composition of the virus (DNA or RNA), hydration state of the sample, and the duration of autoclaving. Viral genomes were damaged more easily under hydrated conditions compared to dry conditions. The genomes of RNA viruses, such as MS2 and norovirus degraded more readily than DNA virus (adenovirus). MS2 genome was the most vulnerable among those tested, with no amplification observed after 18 min of autoclaving. Adenovirus genomes, on the other hand, were detected after autoclaving for 36 min under hydrated or dry conditions. For norovirus, 18 min of autoclaving under hydrated condition or 36 min under dry conditions was enough to destroy noroviral genomes. For noroviral samples, 1.1% of noroviral gene segments were remained after autoclaving for 18 min under dry conditions; however, when a two-step approach was used for the RT-PCR reaction with priming at the poly-A tail about 2552 bp from the qPCR amplification site, the gene segment was not amplified after autoclaving for 18 min. Thus, norovirus amplification observed after 18 min of autoclaving in the dry sample is likely from less than full length genomic segments of norovirus RNA remaining in the sample. © 2014 Published by Elsevier B.V.
The polymerase chain reaction (PCR) is widely used as a tool for detecting viruses in food or environmental samples and several techniques utilizing PCR amplification have been developed for this purpose. The advantages of PCR are its sensitivity, specificity and speed. However, the sensitivity of PCR complicates the interpretation of pathogen detections because of possible false-positive reactions due to persistence of and possible cross-contamination by genetic material of inactivated viruses (review Borst et al., 2004). Contamination can even occur at the manufacturing stage of commercial products (Sullivan et al., 2004; Shaw et al., 2008), despite the general impression that laboratory disposables are safe from DNA contamination. Autoclaving is a routine laboratory practices for eliminating contaminated microorganisms, and reusable equipment is routinely and repeatedly sterilized by autoclaving prior to reuse. A number of published studies have tested the efficacy of autoclaving on the persistence of nucleic acid by PCR (Porter-Jordan and Garrett, 1990; Dwyer and Saksena, 1992; Gefrides et al., 2010). However, almost no information exists on the efficiency of autoclaving for the removal or destruction of viral genomes. The objective
∗ Corresponding author at: Department of Biotechnology, Dongguk UniversityGyeongju, Gyeongju, Gyeongbuk, Republic of Korea. Tel.: +82 54 770 2227; fax: +82 54 770 2386. E-mail address: [email protected] (W.S. Choi). 1 Present address: School of Public Health-El Paso Regional Campus, The University of Texas-Health Science Center at Houston, El Paso, TX 79902, USA.
of the present study was to characterize and quantify the effects of autoclaving on viral genomes. It was anticipated that autoclaving would substantially affect the integrity of viral capsids and genomes which may or may not result in loss of their detection by PCR amplification. Whether there were differences between DNA and RNA virus genome inactivation based on loss of detectability by PCR amplification after autoclaving was determined. Additionally, viral genome degradation leading to loss of PCR detection by autoclaving was also investigated in relation to duration of autoclaving and sample hydration. Male specific coliphage MS2 (ATCC 15597-B1) was grown and assayed by the double agar overlay technique (Adams, 1959). The titer of the MS2 stock was 4.3 × 1010 plaque forming units (pfu)/ml. Adenovirus 2 (ATCC VR-846; Ad2) was grown and assayed on A549 cells in Eagle’s minimum essential medium (MEM) containing 5% fetal bovine serum (Bai et al., 1994). The titer of Ad2 stock was estimated by most probable number (MPN) quantification in inoculated cell cultures, and was 6.25 × 106 MPN infectious units (IU)/ml. The estimated copy number of norovirus genogroup II (GII) stock (extracted from clinical stool samples) was 8.86 × 107 genome copies/ml. MS2 and Ad2 viral stocks (100 l each) were introduced into 25 ml of sterile reagent water in a 125 ml glass bottle. After homogenizing, the bottles were loosely capped and autoclaved (chamber pressure 18–20 psi) for 18 min, or 36 min. For norovirus, 50 l of patient stool diluted in PBS (phosphate buffered saline) (about 4.43 × 106 genome copies) was introduced into a glass test tube containing 1 ml of sterile reagent water. After homogenization,
0166-0934/$ – see front matter © 2014 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.jviromet.2013.12.021
Please cite this article in press as: Choi, W.S., et al., Persistence of viral genomes after autoclaving. J. Virol. Methods (2014), http://dx.doi.org/10.1016/j.jviromet.2013.12.021
38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64
ARTICLE IN PRESS
G Model VIRMET 12404 1–4
W.S. Choi et al. / Journal of Virological Methods xxx (2014) xxx–xxx
2 Table 1 Primers used for PCR in this study. Virus
Primer name
Sequence (5 –3 )
Product size (bp)
Product region
Reference
Male-specific coliphage MS2
MS2KS1 MS2KS2 MS2KS3a
CTCTCTGGCTACCGATCGTC ACACTCCGTTCCCTCAACG ACACGCGGTCCGCTATAACGAGT
235
Replicase
Bae and Schwab (2008)
Adenovirus serotype 2
JTVXF JTVXR JTVXPa
GGACGCCTCGGAGTACCTGAG ACIGTGGGGTTTCTGAACTTGTT CTGGTGCAGTTCGCCCGTGCCA
96
Hexon
Jothikumar et al. (2005a)
Human norovirus GII
JJV2F COG2R RING2-TPa
CAAGAGTCAATGTTTAGGTGGATGAG TCGACGCCATCTTCATTCACA TGGGAGGGCGATCGCAATCT
96
ORF1–ORF2 junction
Jothikumar et al. (2005b)
a
65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115
5 -FAM (6-carboxyflurescein); 3 Black Hole Quencher labeled probe.
the test tube was loosely capped and autoclaved (chamber pressure 18–20 psi) for 18 min. For each test, non-autoclaved viruses were prepared as positive controls and sterile reagent water was used as a negative control against which to measure the efficacy of autoclaving for the degradation of viral genomes resulting in reduced or no PCR amplification. The viral gene copy numbers of the virus positive control samples were calculated and set as 100%, the initial virus concentration. All negative controls without template were negative in fluorescence when subjected to amplification. For autoclaving under dry condition, MS2 and Ad2 viral stock (1 l each) were placed at the bottom of 1.5ml microcentrifuge tubes. Dried virus samples were prepared by leaving tubes uncapped for several hours in a laminar flow chamber. For norovirus, patient stools diluted in PBS (5–20 l) were placed at the bottom of 1.5-ml microcentrifuge tubes, and dried by leaving tubes uncapped overnight in a laminar flow chamber. The inoculated microcentrifuge tubes were autoclaved (chamber pressure 18–20 psi) uncapped for 18 min or 36 min. Autoclaving for 36 min required two successive runs because the time setting of the autoclave was 18 min. Viral samples under dry condition were re-suspended in 100 l water after autoclaving. Viral DNA or RNA was extracted by using the E.Z.N.A.® HP viral DNA/RNA kit (Omega Bio-Tek Inc.). TaqMan PCR and TaqMan RTPCR were performed in a Smart Cycler model V 2.0c (Cepheid, Sunnyvale, CA, USA) using the QuantiTect Probe PCR kit and RTPCR kit (QIAGEN, CA, USA). The TaqMan probe was labeled with the reporter dye 6-carboxyfluorescein (FAM) at its 5 end and a Black Hole Quencher (BHQ) dye at its 3 end. The primers used in this study are summarized in Table 1. For TaqMan PCR of Ad2 DNA, a method reported previously was used (Jothikumar et al., 2005a). Briefly, the amplification reaction mixtures contained 12.5 l of QuantiTect Probe Master Mix (2×), 1 M of each forward (JTVXF) and reverse primer (JTVXR), 0.1 M of TaqMan probe (JTVXP), 2.5 l of Ad2 DNA template and water for a final volume of 25 l. The reaction mixture was subjected to the following conditions: denaturation at 95 ◦ C for 15 min, followed by 45 cycles with 95 ◦ C denaturation for 10 s, 55 ◦ C annealing for 30 s, and 72 ◦ C elongation for 15 s. For norovirus GII TaqMan RT-PCR, a protocol and primer-probe set reported previously was used (Jothikumar et al., 2005b). Briefly, the one-step reverse-transcription PCR mixtures contained 12.5 l of QuantiTect Probe RT-PCR Master Mix (2×), 1 M of each forward (JJGII) and reverse primer (COG2R), 0.1 M of TaqMan probe (Ring2-TP), 0.5 l QuantiTect RT-Mix, 8 units (U) of RNasin (RNAse inhibitor, Promega), 2 l norovirus RNA template and nuclease free water to a final volume of 25 l. The mixtures were subjected to a one-step assay under the following conditions: RT at 50 ◦ C for 30 min and, denaturation at 95 ◦ C for 15 min, followed by 45 cycles with 10 s at 94 ◦ C, 20 s at 55 ◦ C, and 15 s at 72 ◦ C. The primers-probe set for MS2 bacteriophage has been described previously (Bae and Schwab, 2008). The method for MS2 TaqMan RT-PCR was modified, and amplification performed
in a 25 l reaction mixture containing 12.5 l QuantiTect Probe RT-PCR Master Mix, 0.5 M of each forward (MS2KS2) and reverse (MS2KS1) primer, 0.2 M of TaqMan Probe (MS2KS3), 8 U of RNasin, 0.5 l QuantiTect RT-Mix, 2 l MS2 RNA template and nuclease free water to a final volume of 25 l under the following conditions: RT at 50 ◦ C for 30 min and denaturation at 95 ◦ C for 15 min, followed by 45 cycles with 10 s at 94 ◦ C, 30 s at 55 ◦ C, and 15 s at 72 ◦ C. Cycle threshold (Ct) value, representing the number of cycles needed to reach the threshold level of fluorescence, was considered to correlate with the amount of genome target in the sample prior to amplification (Heid et al., 1996), and the viral genome quantity was calculated with equations developed previously (Rodríguez et al., 2012). Standard curves for Ad2 (Jothikumar et al., 2005a) and norovirus (Jothikumar et al., 2005b) were generated using DNA control and RNA transcripts as described previously (Rodríguez et al., 2012). For MS2, standard curves were constructed by plotting the Ct values and plaque numbers. In every real-time PCR run, negative (no template) virus controls were processed as a routine quality control of the assay. For the reverse-transcription of norovirus RNA, 8 l of norovirus RNA was mixed with 1 l of 50 M poly dT(16) and 1 l of dNTP (10 mM), and then the sample was heated at 65 ◦ C for 5 min, and cooled to 4 ◦ C. After cooling the RNA sample, a mixture containing 4 l of 5× RT buffer, 2 l of 0.1 M DTT, 20 U (1 l) of RNasin, 200 U (1 l) of MuLV RT (Invitrogen), and 2.5 l of water was added. The combined mixture was incubated at 37 ◦ C for 50 min, and then 70 ◦ C for 15 min. For TaqMan PCR, the PCR mixture contained 12.5 l of QuantiTect Probe Master Mix (2×), 1 M of each forward (JJGII), and reverse primer (COG2R), 0.1 M of TaqMan probe (Ring2-TP), 2.5 l norovirus cDNA template and water to a final volume of 25 l. The mixtures were subjected to the following conditions: denaturation at 95 ◦ C for 15 min, followed by 45 cycles with 10 s at 94 ◦ C, 20 s at 55 ◦ C, and 15 s at 72 ◦ C. For statistical analysis, the t-test was performed to compare average copy numbers at a confidence level of 95%, or P = 0.05. Average viral gene segment recoveries by (RT-)PCR following autoclaving for MS2, Adenovirus 2, and human norovirus are shown in Table 2. There was no evidence of viable viruses for MS2 and Adenovirus 2 in culture infectivity experiments following autoclaving (data not shown). None of the primer/probe combinations cross-reacted, as shown by the lack of non-specific PCR products observed in gel electrophoresis of control samples subjected to PCR amplification (data not shown). The effect of autoclaving on the MS2 bacteriophage genome RT-PCR amplification was determined and samples containing MS2 particles exhibited no gene segment amplification after 18 min of autoclaving, regardless of their hydration state. These RT-PCR results for autoclaved MS2 suggest that the phage genomes were sufficiently degraded to produce no specific amplicons (Table 2). For determining the effect of autoclaving on the Ad 2 genome, samples were subjected to 18 or 36 min of autoclaving and examined for differences in PCR amplification of dried or hydrated viruses. In general, the copy numbers
Please cite this article in press as: Choi, W.S., et al., Persistence of viral genomes after autoclaving. J. Virol. Methods (2014), http://dx.doi.org/10.1016/j.jviromet.2013.12.021
116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166
ARTICLE IN PRESS
G Model VIRMET 12404 1–4
W.S. Choi et al. / Journal of Virological Methods xxx (2014) xxx–xxx
3
Table 2 The effect of hydration state and autoclave time on the detection of viral genome target segments by RT-PCR following autoclaving. Amplification success is expressed as the percentage (mean ± SDa %) of the initially detectable genome target, detectable in each sample by (RT-)PCR amplification. Autoclave time (min)
MS2 Hydrated
0
100
18
0b
36
Adenovirus 2 Dried 100 0c
Norovirus
Hydrated
Dried
Hydrated
Dried
100
100
100
100
25.2 ± a 10.4d
46.9 ± 7.4e
19.4 ± 8.4e
32.2 ± 7.8c
0c
1.1 ± 0.5g 0f 0c
± numbers are standard deviations. Average of 4 trials. Average of 2 trials. d Average of 7 trials. e Average of 3 trials. f Average of 4 trials. No amplification was observed when using a two-step RT-PCR with poly-dT as primer and real-time PCR for PCR amplification. This method is equivalent to analyzing a longer than 2552 bp segment spanning nucleotides 5003–7555 of the norovirus genome. g Average of 5 trials. a
b c
167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213
of PCR-detected gene segments for Ad2 decreased as the autoclaving treatment time increased. In hydrated samples, 25.2% of the initial amount of Ad2 genomic DNA could be amplified after 18 min of autoclaving, while 19.4% could be amplified after 36 min of autoclaving. However, there was no statistically significant difference in the amount of amplified Ad2 DNA observed between 18 min and 36 min of autoclaving (P = 0.4211; >0.05). In dried samples, 46.9% of the initial viral DNA could be amplified after 18 min of autoclaving, while 32.2% could be amplified after 36 min of autoclaving, and, this difference in amount of PCR-amplified DNA was also not statistically significant (P = 0.1232; >0.05). Thus, the apparent quantitative differences in residual gene segment amplification after different times of autoclaving should be interpreted with caution, given the observed lack of statistically significant differences. The amount of PCR amplification of Ad2 DNA after 18 min of autoclaving under hydrated conditions (25.2%) versus autoclaving under dry conditions (46.9%) was significantly significant (P = 0.0118; 0.05). These observations suggest that hydrated conditions are more effective than dry conditions with 18 min autoclaving to render Ad2 DNA non-amplifiable. For hydrated conditions, norovirus genomes were sufficiently degraded to achieve lack of RT-PCR amplification following 18 min of autoclaving. However, for the dried norovirus, 1.1% of the initial gene segments were still amplified after 18 min of autoclaving. No norovirus genome amplification was observed after autoclaving this dried sample for 36 min. Using a norovirus assay modified by two-step reverse-transcription PCR (real-time PCR approach using the poly-dT primer for the reversetranscription step), no RT-PCR amplification was observed for dried samples autoclaved for 18 min (Table 2). This suggests that the amplifiable 1.1% of gene targets previously observed were from genomes that had been cleaved or otherwise rendered unamplifiable at one locus or more between the PCR priming site (ORF1/ORF2 junction) and the terminal reverse-transcriptase priming site (polyA tail). In this study, viral genomes were considered damaged on the basis of inability to be PCR amplified, which occurred more easily in the hydrated state than in the dry state. Genome targets of the linear single-stranded RNA viruses studied, MS2 and norovirus GII, were more readily degraded to the point of non-amplifiability than those of a linear double-stranded DNA virus, Ad2. The MS2 genome was the most vulnerable among the three tested, with 18 min of autoclaving enough to destroy its genome under hydrated or dry conditions. In contrast, the adenoviral genomes were more persistent, with detection by nucleic acid amplification after autoclaving
for 36 min under hydrated or dry conditions. These findings are consistent with previous studies, including one which found falsepositive PCR results produced from material contaminated with human cytomegalovirus DNA after autoclaving (Porter-Jordan and Garrett, 1990). In addition, Dwyer and Saksena (1992) reported that 15 min of autoclaving (at 121 ◦ C and 15 psi) was unable to prevent the re-amplification of a 115 base pair product from approximately 1 ng of cell DNA that had been infected by HIV-1 BRU. Similarly, Gefrides et al. (2010) reported that autoclaving takes 2 h to eliminate nanogram quantities of DNA contamination from saliva, with DNA samples from fresh saliva easier to eradicate than dried samples. The one-step RT-qPCR approach commonly used for RNA virus detection targets only a small portion of the genome (98 bp in this assay) for amplification, and RNA strand breaks outside the target region do not affect RT-PCR amplification efficiency. However, it is possible to discriminate apparently cleaved but amplifiable genomic RNA strand regions resulting from small genomic targets by further separating the reverse-transcriptase priming site and the PCR amplification site for amplification across a greater distance to yield a larger fragment, which rendered the target unamplifiable (Wolf et al., 2009). Damage to the autoclaved norovirus RNA genome was thus detected through further separating the reversetranscriptase priming site (poly-A tail) from the PCR priming site (ORF1/ORF2 junction). In contrast to amplification of the shorter target by one-step RT-PCR, this two-step approach using a long target segment of the norovirus genome (2552 bp plus extra polyA; based on Lordsdale sequences accession no. X86577) gave no RT-PCR amplification after autoclaving for 18 min (Table 2). Therefore, norovirus amplification by combined RT-PCR amplification of a short genomic RNA segment observed after 18 min of autoclaving the dried sample was likely obtained from a remaining short norovirus RNA genomic segment in the sample. Dwyer and Saksena (1992) reported that 16 h of ultraviolet UV light exposure (254–300 nm wave length radiation at 30 cm distance from a biosafety cabinet UV lamp) was not a sufficient dose to prevent the re-amplification of 1 ng of cell DNA that had been infected by HIV-1 BRU. A study by Hall and Ballantyne (2004) on the effect of UV exposure on PCR amplification of two micrograms of naked human genomic DNA indicated that 16 min of DNA solution in a UV crosslinker apparatus could prevent DNA amplification, but that it would take 24 h for dehydrated DNA, and 102 h for the equivalent amount of DNA on a dried bloodstain to prevent amplification. Both autoclaving and UV irradiation can be employed to eliminate contaminating DNA from laboratory consumables, but autoclaving is more effective than UV irradiation because it can eliminate short fragments of contaminating DNA more efficiently (Gefrides et al., 2010).
Please cite this article in press as: Choi, W.S., et al., Persistence of viral genomes after autoclaving. J. Virol. Methods (2014), http://dx.doi.org/10.1016/j.jviromet.2013.12.021
214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260
G Model VIRMET 12404 1–4
ARTICLE IN PRESS W.S. Choi et al. / Journal of Virological Methods xxx (2014) xxx–xxx
4
290
A quantitative approach for viral genome degradation by chemical oxidants has not been adequately investigated using nucleic acid amplification. However, by biophysical analysis methods, Tenno et al. (1980) reported that nearly all of the poliovirus 1 genome remains intact after exposure to 0.2 mg/l of chlorine for 30 min. Fujioka et al. (1983) obtained similar results when exposing poliovirus to 2 mg/l of chloramine. Simonet and Gantzer (2006) reported that when the poliovirus genome was exposed to 0.5 mg/l of ClO2 for 120 min, it did not degrade, however, by exposing the poliovirus genome to a higher concentration of ClO2 (5 mg/l), significant degradation (>4.5 log) was observed by PCR, based on lack of amplification of a 76 base pair genomic target. In conclusion, the results of this study demonstrated that viral genomes are damaged more easily under hydrated conditions than dry conditions during autoclaving, and the genomes of singlestranded RNA viruses, such as MS2 and norovirus were degraded more easily than the genome of a linear double-stranded DNA virus (adenovirus). These results suggest that the viral DNA genome is more resistant to degradation by autoclaving than the viral RNA genome. Consequently, the elimination of amplification of viral DNA in samples by PCR is very difficult. Because this study demonstrates incomplete reduction of viral genomes by autoclaving, equipment and materials should be treated by alternative means to remove remaining nucleic acids when possible residual nucleic acid contamination of equipment by viral genomes is suspected and the equipment is planned for use in studies where viral detection by (RT-)PCR amplification is to be performed. Rigorous efforts to eliminate the potential for nucleic acid amplification of residual RNA or DNA are needed to eliminate false positives from samples negative for the target nucleic acids.
291
Acknowledgement
261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289
293
This work was supported by Dongguk University-Gyeongju Research Fund.
294
References
292
295 296
Adams, M.H., 1959. Bacteriophages. Wiley-Interscience, New York. Bae, J., Schwab, K.J., 2008. Evaluation of murine norovirus, feline calicivirus, poliovirus, and MS2 as surrogates for human norovirus in a model of viral
persistence in surface water and groundwater. Applied and Environmental Microbiology 74, 477–484. Bai, M., Campisi, L., Freimuth, P., 1994. Vitronectin receptor antibodies inhibit infection of HeLa and A549 cells by adenovirus type 12 but not by adenovirus type 2. Journal of Virology 68, 5925–5932. Borst, A., Box, A.T.A., Fluit, A.C., 2004. False-positive results and contamination in nucleic acid amplification assays: suggestions for a prevent and destroy strategy. European Journal of Clinical Microbiology and Infectious Diseases 23, 289–299. Dwyer, D.E., Saksena, N., 1992. Failure of ultra-violet irradiation and autoclaving to eliminate PCR contamination. Molecular and Cellular Probes 6, 87–88. Fujioka, R.S., Tenno, K.M., Loh, P.C., 1983. Mechanism of chloramine inactivation of poliovirus: a concern for regulators? In: Jolley, R.L., Brungs, W.A., Contruvo, J.A., Gumming, R.B., Mattice, J.S., Jacobs, V.A. (Eds.), Water Chlorination: Environmental Impacts and Health Effects, vol. 4. Ann Arbor Science Publishers, Ann Arbor, MI. Gefrides, L.A., Powell, M.C., Donley, M.A., Kahn, R., 2010. UV irradiation and autoclave treatment for elimination of contaminating DNA from laboratory consumables. Forensic Science International Genetics 4, 89–94. Hall, A., Ballantyne, J., 2004. Characterization of UVC-induced DNA damage in bloodstains: forensic implications. Analytical and Bioanalytical Chemistry 380, 72–83. Heid, C.A., Stevens, J., Livak, K.J., Williams, P.M., 1996. Real-time quantitative PCR. Genome Research 6, 986–994. Jothikumar, N., Cromeans, T.L., Hill, V.R., Lu, X., Sobsey, M.D., Erdman, D.D., 2005a. Quantitative real-time PCR assays for detection of human adenoviruses and identification of serotypes 40 and 41. Applied and Environmental Microbiology 71, 3131–3136. Jothikumar, N., Lowther, J.A., Henshilwood, K., Lees, D.N., Hill, V.R., Vinjé, J., 2005b. Rapid and sensitive detection of noroviruses by using TaqMan-based one-step reverse transcription-PCR assays and application to naturally contaminated shellfish samples. Applied and Environmental Microbiology 71, 1870–1875. Porter-Jordan, K., Garrett, C.T., 1990. Source of contamination in polymerase chain reaction assay. Lancet 335, 1220. Rodríguez, R.A., Thie, L., Gibbons, C.D., Sobsey, M.D., 2012. Reducing the effects of environmental inhibition in quantitative real-time PCR detection of adenovirus and norovirus in recreational seawaters. Journal of Virological Methods 181, 43–50. Shaw, K., Sesardic, I., Bristol, N., Ames, C., Dagnall, K., Ellis, C., Whittaker, F., Daniel, B., 2008. Comparison of the effects of sterilization techniques on subsequent DNA profiling. International Journal of Legal Medicine 122, 29–33. Simonet, J., Gantzer, C., 2006. Inactivation of poliovirus 1 and F-specific RNA phages and degradation of their genomes by UV irradiation at 254 nanometers. Applied and Environmental Microbiology 72, 7671–7677. Sullivan, K., Johnson, P., Rowlands, D., Allen, H., 2004. New developments and challenges in the use of the UK DNA database: addressing the issue of contaminated consumables. Forensic Science International 146 (Suppl.), S157–S176. Tenno, K.M., Fujioka, R.S., Loh, P.C., 1980. The mechanism of poliovirus inactivation by hypochlorous acid. In: Jolley, R.L., Brungs, W.A., Cunnings, R.B. (Eds.), Water Chlorination: Environmental Impact and Health Effects, vol. 3. Ann Arbor Science Publisher, Ann Arbor, MI, pp. 665–675. Wolf, S., Rivera-Aban, M., Greening, G.E., 2009. Long-range reverse transcription as a useful tool to assess the genomic integrity of norovirus. Food and Environmental Virology 1, 129–136.
Please cite this article in press as: Choi, W.S., et al., Persistence of viral genomes after autoclaving. J. Virol. Methods (2014), http://dx.doi.org/10.1016/j.jviromet.2013.12.021
297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348
ARTICLE IN PRESS Journal of Virological Methods xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
1
Short communication
2
Persistence of viral genomes after autoclaving
3 4 5
Q1
Weon Sang Choi a,∗ , Roberto A. Rodríguez b,1 , Mark D. Sobsey b a b
Department of Biotechnology, College of Science and Technology, Dongguk University-Gyeongju, Gyeongju, Republic of Korea Department of Environmental Sciences and Engineering, Gillings School of Global Public Health, University of North Carolina at Chapel Hill, NC 27599, USA
6
a b s t r a c t
7 8 9 10 11 12 13
Article history: Received 5 June 2013 Received in revised form 26 November 2013 Accepted 11 December 2013 Available online xxx
14 15 16 17 18
19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37
Keywords: Persistence Viral genomes Autoclaving
The ability of autoclaving to degrade viral genomes was investigated by real-time PCR and real-time reverse-transcription (RT)-PCR. Several factors were considered: the nucleic acid composition of the virus (DNA or RNA), hydration state of the sample, and the duration of autoclaving. Viral genomes were damaged more easily under hydrated conditions compared to dry conditions. The genomes of RNA viruses, such as MS2 and norovirus degraded more readily than DNA virus (adenovirus). MS2 genome was the most vulnerable among those tested, with no amplification observed after 18 min of autoclaving. Adenovirus genomes, on the other hand, were detected after autoclaving for 36 min under hydrated or dry conditions. For norovirus, 18 min of autoclaving under hydrated condition or 36 min under dry conditions was enough to destroy noroviral genomes. For noroviral samples, 1.1% of noroviral gene segments were remained after autoclaving for 18 min under dry conditions; however, when a two-step approach was used for the RT-PCR reaction with priming at the poly-A tail about 2552 bp from the qPCR amplification site, the gene segment was not amplified after autoclaving for 18 min. Thus, norovirus amplification observed after 18 min of autoclaving in the dry sample is likely from less than full length genomic segments of norovirus RNA remaining in the sample. © 2014 Published by Elsevier B.V.
The polymerase chain reaction (PCR) is widely used as a tool for detecting viruses in food or environmental samples and several techniques utilizing PCR amplification have been developed for this purpose. The advantages of PCR are its sensitivity, specificity and speed. However, the sensitivity of PCR complicates the interpretation of pathogen detections because of possible false-positive reactions due to persistence of and possible cross-contamination by genetic material of inactivated viruses (review Borst et al., 2004). Contamination can even occur at the manufacturing stage of commercial products (Sullivan et al., 2004; Shaw et al., 2008), despite the general impression that laboratory disposables are safe from DNA contamination. Autoclaving is a routine laboratory practices for eliminating contaminated microorganisms, and reusable equipment is routinely and repeatedly sterilized by autoclaving prior to reuse. A number of published studies have tested the efficacy of autoclaving on the persistence of nucleic acid by PCR (Porter-Jordan and Garrett, 1990; Dwyer and Saksena, 1992; Gefrides et al., 2010). However, almost no information exists on the efficiency of autoclaving for the removal or destruction of viral genomes. The objective
∗ Corresponding author at: Department of Biotechnology, Dongguk UniversityGyeongju, Gyeongju, Gyeongbuk, Republic of Korea. Tel.: +82 54 770 2227; fax: +82 54 770 2386. E-mail address: [email protected] (W.S. Choi). 1 Present address: School of Public Health-El Paso Regional Campus, The University of Texas-Health Science Center at Houston, El Paso, TX 79902, USA.
of the present study was to characterize and quantify the effects of autoclaving on viral genomes. It was anticipated that autoclaving would substantially affect the integrity of viral capsids and genomes which may or may not result in loss of their detection by PCR amplification. Whether there were differences between DNA and RNA virus genome inactivation based on loss of detectability by PCR amplification after autoclaving was determined. Additionally, viral genome degradation leading to loss of PCR detection by autoclaving was also investigated in relation to duration of autoclaving and sample hydration. Male specific coliphage MS2 (ATCC 15597-B1) was grown and assayed by the double agar overlay technique (Adams, 1959). The titer of the MS2 stock was 4.3 × 1010 plaque forming units (pfu)/ml. Adenovirus 2 (ATCC VR-846; Ad2) was grown and assayed on A549 cells in Eagle’s minimum essential medium (MEM) containing 5% fetal bovine serum (Bai et al., 1994). The titer of Ad2 stock was estimated by most probable number (MPN) quantification in inoculated cell cultures, and was 6.25 × 106 MPN infectious units (IU)/ml. The estimated copy number of norovirus genogroup II (GII) stock (extracted from clinical stool samples) was 8.86 × 107 genome copies/ml. MS2 and Ad2 viral stocks (100 l each) were introduced into 25 ml of sterile reagent water in a 125 ml glass bottle. After homogenizing, the bottles were loosely capped and autoclaved (chamber pressure 18–20 psi) for 18 min, or 36 min. For norovirus, 50 l of patient stool diluted in PBS (phosphate buffered saline) (about 4.43 × 106 genome copies) was introduced into a glass test tube containing 1 ml of sterile reagent water. After homogenization,
0166-0934/$ – see front matter © 2014 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.jviromet.2013.12.021
Please cite this article in press as: Choi, W.S., et al., Persistence of viral genomes after autoclaving. J. Virol. Methods (2014), http://dx.doi.org/10.1016/j.jviromet.2013.12.021
38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64
ARTICLE IN PRESS
G Model VIRMET 12404 1–4
W.S. Choi et al. / Journal of Virological Methods xxx (2014) xxx–xxx
2 Table 1 Primers used for PCR in this study. Virus
Primer name
Sequence (5 –3 )
Product size (bp)
Product region
Reference
Male-specific coliphage MS2
MS2KS1 MS2KS2 MS2KS3a
CTCTCTGGCTACCGATCGTC ACACTCCGTTCCCTCAACG ACACGCGGTCCGCTATAACGAGT
235
Replicase
Bae and Schwab (2008)
Adenovirus serotype 2
JTVXF JTVXR JTVXPa
GGACGCCTCGGAGTACCTGAG ACIGTGGGGTTTCTGAACTTGTT CTGGTGCAGTTCGCCCGTGCCA
96
Hexon
Jothikumar et al. (2005a)
Human norovirus GII
JJV2F COG2R RING2-TPa
CAAGAGTCAATGTTTAGGTGGATGAG TCGACGCCATCTTCATTCACA TGGGAGGGCGATCGCAATCT
96
ORF1–ORF2 junction
Jothikumar et al. (2005b)
a
65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115
5 -FAM (6-carboxyflurescein); 3 Black Hole Quencher labeled probe.
the test tube was loosely capped and autoclaved (chamber pressure 18–20 psi) for 18 min. For each test, non-autoclaved viruses were prepared as positive controls and sterile reagent water was used as a negative control against which to measure the efficacy of autoclaving for the degradation of viral genomes resulting in reduced or no PCR amplification. The viral gene copy numbers of the virus positive control samples were calculated and set as 100%, the initial virus concentration. All negative controls without template were negative in fluorescence when subjected to amplification. For autoclaving under dry condition, MS2 and Ad2 viral stock (1 l each) were placed at the bottom of 1.5ml microcentrifuge tubes. Dried virus samples were prepared by leaving tubes uncapped for several hours in a laminar flow chamber. For norovirus, patient stools diluted in PBS (5–20 l) were placed at the bottom of 1.5-ml microcentrifuge tubes, and dried by leaving tubes uncapped overnight in a laminar flow chamber. The inoculated microcentrifuge tubes were autoclaved (chamber pressure 18–20 psi) uncapped for 18 min or 36 min. Autoclaving for 36 min required two successive runs because the time setting of the autoclave was 18 min. Viral samples under dry condition were re-suspended in 100 l water after autoclaving. Viral DNA or RNA was extracted by using the E.Z.N.A.® HP viral DNA/RNA kit (Omega Bio-Tek Inc.). TaqMan PCR and TaqMan RTPCR were performed in a Smart Cycler model V 2.0c (Cepheid, Sunnyvale, CA, USA) using the QuantiTect Probe PCR kit and RTPCR kit (QIAGEN, CA, USA). The TaqMan probe was labeled with the reporter dye 6-carboxyfluorescein (FAM) at its 5 end and a Black Hole Quencher (BHQ) dye at its 3 end. The primers used in this study are summarized in Table 1. For TaqMan PCR of Ad2 DNA, a method reported previously was used (Jothikumar et al., 2005a). Briefly, the amplification reaction mixtures contained 12.5 l of QuantiTect Probe Master Mix (2×), 1 M of each forward (JTVXF) and reverse primer (JTVXR), 0.1 M of TaqMan probe (JTVXP), 2.5 l of Ad2 DNA template and water for a final volume of 25 l. The reaction mixture was subjected to the following conditions: denaturation at 95 ◦ C for 15 min, followed by 45 cycles with 95 ◦ C denaturation for 10 s, 55 ◦ C annealing for 30 s, and 72 ◦ C elongation for 15 s. For norovirus GII TaqMan RT-PCR, a protocol and primer-probe set reported previously was used (Jothikumar et al., 2005b). Briefly, the one-step reverse-transcription PCR mixtures contained 12.5 l of QuantiTect Probe RT-PCR Master Mix (2×), 1 M of each forward (JJGII) and reverse primer (COG2R), 0.1 M of TaqMan probe (Ring2-TP), 0.5 l QuantiTect RT-Mix, 8 units (U) of RNasin (RNAse inhibitor, Promega), 2 l norovirus RNA template and nuclease free water to a final volume of 25 l. The mixtures were subjected to a one-step assay under the following conditions: RT at 50 ◦ C for 30 min and, denaturation at 95 ◦ C for 15 min, followed by 45 cycles with 10 s at 94 ◦ C, 20 s at 55 ◦ C, and 15 s at 72 ◦ C. The primers-probe set for MS2 bacteriophage has been described previously (Bae and Schwab, 2008). The method for MS2 TaqMan RT-PCR was modified, and amplification performed
in a 25 l reaction mixture containing 12.5 l QuantiTect Probe RT-PCR Master Mix, 0.5 M of each forward (MS2KS2) and reverse (MS2KS1) primer, 0.2 M of TaqMan Probe (MS2KS3), 8 U of RNasin, 0.5 l QuantiTect RT-Mix, 2 l MS2 RNA template and nuclease free water to a final volume of 25 l under the following conditions: RT at 50 ◦ C for 30 min and denaturation at 95 ◦ C for 15 min, followed by 45 cycles with 10 s at 94 ◦ C, 30 s at 55 ◦ C, and 15 s at 72 ◦ C. Cycle threshold (Ct) value, representing the number of cycles needed to reach the threshold level of fluorescence, was considered to correlate with the amount of genome target in the sample prior to amplification (Heid et al., 1996), and the viral genome quantity was calculated with equations developed previously (Rodríguez et al., 2012). Standard curves for Ad2 (Jothikumar et al., 2005a) and norovirus (Jothikumar et al., 2005b) were generated using DNA control and RNA transcripts as described previously (Rodríguez et al., 2012). For MS2, standard curves were constructed by plotting the Ct values and plaque numbers. In every real-time PCR run, negative (no template) virus controls were processed as a routine quality control of the assay. For the reverse-transcription of norovirus RNA, 8 l of norovirus RNA was mixed with 1 l of 50 M poly dT(16) and 1 l of dNTP (10 mM), and then the sample was heated at 65 ◦ C for 5 min, and cooled to 4 ◦ C. After cooling the RNA sample, a mixture containing 4 l of 5× RT buffer, 2 l of 0.1 M DTT, 20 U (1 l) of RNasin, 200 U (1 l) of MuLV RT (Invitrogen), and 2.5 l of water was added. The combined mixture was incubated at 37 ◦ C for 50 min, and then 70 ◦ C for 15 min. For TaqMan PCR, the PCR mixture contained 12.5 l of QuantiTect Probe Master Mix (2×), 1 M of each forward (JJGII), and reverse primer (COG2R), 0.1 M of TaqMan probe (Ring2-TP), 2.5 l norovirus cDNA template and water to a final volume of 25 l. The mixtures were subjected to the following conditions: denaturation at 95 ◦ C for 15 min, followed by 45 cycles with 10 s at 94 ◦ C, 20 s at 55 ◦ C, and 15 s at 72 ◦ C. For statistical analysis, the t-test was performed to compare average copy numbers at a confidence level of 95%, or P = 0.05. Average viral gene segment recoveries by (RT-)PCR following autoclaving for MS2, Adenovirus 2, and human norovirus are shown in Table 2. There was no evidence of viable viruses for MS2 and Adenovirus 2 in culture infectivity experiments following autoclaving (data not shown). None of the primer/probe combinations cross-reacted, as shown by the lack of non-specific PCR products observed in gel electrophoresis of control samples subjected to PCR amplification (data not shown). The effect of autoclaving on the MS2 bacteriophage genome RT-PCR amplification was determined and samples containing MS2 particles exhibited no gene segment amplification after 18 min of autoclaving, regardless of their hydration state. These RT-PCR results for autoclaved MS2 suggest that the phage genomes were sufficiently degraded to produce no specific amplicons (Table 2). For determining the effect of autoclaving on the Ad 2 genome, samples were subjected to 18 or 36 min of autoclaving and examined for differences in PCR amplification of dried or hydrated viruses. In general, the copy numbers
Please cite this article in press as: Choi, W.S., et al., Persistence of viral genomes after autoclaving. J. Virol. Methods (2014), http://dx.doi.org/10.1016/j.jviromet.2013.12.021
116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166
ARTICLE IN PRESS
G Model VIRMET 12404 1–4
W.S. Choi et al. / Journal of Virological Methods xxx (2014) xxx–xxx
3
Table 2 The effect of hydration state and autoclave time on the detection of viral genome target segments by RT-PCR following autoclaving. Amplification success is expressed as the percentage (mean ± SDa %) of the initially detectable genome target, detectable in each sample by (RT-)PCR amplification. Autoclave time (min)
MS2 Hydrated
0
100
18
0b
36
Adenovirus 2 Dried 100 0c
Norovirus
Hydrated
Dried
Hydrated
Dried
100
100
100
100
25.2 ± a 10.4d
46.9 ± 7.4e
19.4 ± 8.4e
32.2 ± 7.8c
0c
1.1 ± 0.5g 0f 0c
± numbers are standard deviations. Average of 4 trials. Average of 2 trials. d Average of 7 trials. e Average of 3 trials. f Average of 4 trials. No amplification was observed when using a two-step RT-PCR with poly-dT as primer and real-time PCR for PCR amplification. This method is equivalent to analyzing a longer than 2552 bp segment spanning nucleotides 5003–7555 of the norovirus genome. g Average of 5 trials. a
b c
167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213
of PCR-detected gene segments for Ad2 decreased as the autoclaving treatment time increased. In hydrated samples, 25.2% of the initial amount of Ad2 genomic DNA could be amplified after 18 min of autoclaving, while 19.4% could be amplified after 36 min of autoclaving. However, there was no statistically significant difference in the amount of amplified Ad2 DNA observed between 18 min and 36 min of autoclaving (P = 0.4211; >0.05). In dried samples, 46.9% of the initial viral DNA could be amplified after 18 min of autoclaving, while 32.2% could be amplified after 36 min of autoclaving, and, this difference in amount of PCR-amplified DNA was also not statistically significant (P = 0.1232; >0.05). Thus, the apparent quantitative differences in residual gene segment amplification after different times of autoclaving should be interpreted with caution, given the observed lack of statistically significant differences. The amount of PCR amplification of Ad2 DNA after 18 min of autoclaving under hydrated conditions (25.2%) versus autoclaving under dry conditions (46.9%) was significantly significant (P = 0.0118; 0.05). These observations suggest that hydrated conditions are more effective than dry conditions with 18 min autoclaving to render Ad2 DNA non-amplifiable. For hydrated conditions, norovirus genomes were sufficiently degraded to achieve lack of RT-PCR amplification following 18 min of autoclaving. However, for the dried norovirus, 1.1% of the initial gene segments were still amplified after 18 min of autoclaving. No norovirus genome amplification was observed after autoclaving this dried sample for 36 min. Using a norovirus assay modified by two-step reverse-transcription PCR (real-time PCR approach using the poly-dT primer for the reversetranscription step), no RT-PCR amplification was observed for dried samples autoclaved for 18 min (Table 2). This suggests that the amplifiable 1.1% of gene targets previously observed were from genomes that had been cleaved or otherwise rendered unamplifiable at one locus or more between the PCR priming site (ORF1/ORF2 junction) and the terminal reverse-transcriptase priming site (polyA tail). In this study, viral genomes were considered damaged on the basis of inability to be PCR amplified, which occurred more easily in the hydrated state than in the dry state. Genome targets of the linear single-stranded RNA viruses studied, MS2 and norovirus GII, were more readily degraded to the point of non-amplifiability than those of a linear double-stranded DNA virus, Ad2. The MS2 genome was the most vulnerable among the three tested, with 18 min of autoclaving enough to destroy its genome under hydrated or dry conditions. In contrast, the adenoviral genomes were more persistent, with detection by nucleic acid amplification after autoclaving
for 36 min under hydrated or dry conditions. These findings are consistent with previous studies, including one which found falsepositive PCR results produced from material contaminated with human cytomegalovirus DNA after autoclaving (Porter-Jordan and Garrett, 1990). In addition, Dwyer and Saksena (1992) reported that 15 min of autoclaving (at 121 ◦ C and 15 psi) was unable to prevent the re-amplification of a 115 base pair product from approximately 1 ng of cell DNA that had been infected by HIV-1 BRU. Similarly, Gefrides et al. (2010) reported that autoclaving takes 2 h to eliminate nanogram quantities of DNA contamination from saliva, with DNA samples from fresh saliva easier to eradicate than dried samples. The one-step RT-qPCR approach commonly used for RNA virus detection targets only a small portion of the genome (98 bp in this assay) for amplification, and RNA strand breaks outside the target region do not affect RT-PCR amplification efficiency. However, it is possible to discriminate apparently cleaved but amplifiable genomic RNA strand regions resulting from small genomic targets by further separating the reverse-transcriptase priming site and the PCR amplification site for amplification across a greater distance to yield a larger fragment, which rendered the target unamplifiable (Wolf et al., 2009). Damage to the autoclaved norovirus RNA genome was thus detected through further separating the reversetranscriptase priming site (poly-A tail) from the PCR priming site (ORF1/ORF2 junction). In contrast to amplification of the shorter target by one-step RT-PCR, this two-step approach using a long target segment of the norovirus genome (2552 bp plus extra polyA; based on Lordsdale sequences accession no. X86577) gave no RT-PCR amplification after autoclaving for 18 min (Table 2). Therefore, norovirus amplification by combined RT-PCR amplification of a short genomic RNA segment observed after 18 min of autoclaving the dried sample was likely obtained from a remaining short norovirus RNA genomic segment in the sample. Dwyer and Saksena (1992) reported that 16 h of ultraviolet UV light exposure (254–300 nm wave length radiation at 30 cm distance from a biosafety cabinet UV lamp) was not a sufficient dose to prevent the re-amplification of 1 ng of cell DNA that had been infected by HIV-1 BRU. A study by Hall and Ballantyne (2004) on the effect of UV exposure on PCR amplification of two micrograms of naked human genomic DNA indicated that 16 min of DNA solution in a UV crosslinker apparatus could prevent DNA amplification, but that it would take 24 h for dehydrated DNA, and 102 h for the equivalent amount of DNA on a dried bloodstain to prevent amplification. Both autoclaving and UV irradiation can be employed to eliminate contaminating DNA from laboratory consumables, but autoclaving is more effective than UV irradiation because it can eliminate short fragments of contaminating DNA more efficiently (Gefrides et al., 2010).
Please cite this article in press as: Choi, W.S., et al., Persistence of viral genomes after autoclaving. J. Virol. Methods (2014), http://dx.doi.org/10.1016/j.jviromet.2013.12.021
214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260
G Model VIRMET 12404 1–4
ARTICLE IN PRESS W.S. Choi et al. / Journal of Virological Methods xxx (2014) xxx–xxx
4
290
A quantitative approach for viral genome degradation by chemical oxidants has not been adequately investigated using nucleic acid amplification. However, by biophysical analysis methods, Tenno et al. (1980) reported that nearly all of the poliovirus 1 genome remains intact after exposure to 0.2 mg/l of chlorine for 30 min. Fujioka et al. (1983) obtained similar results when exposing poliovirus to 2 mg/l of chloramine. Simonet and Gantzer (2006) reported that when the poliovirus genome was exposed to 0.5 mg/l of ClO2 for 120 min, it did not degrade, however, by exposing the poliovirus genome to a higher concentration of ClO2 (5 mg/l), significant degradation (>4.5 log) was observed by PCR, based on lack of amplification of a 76 base pair genomic target. In conclusion, the results of this study demonstrated that viral genomes are damaged more easily under hydrated conditions than dry conditions during autoclaving, and the genomes of singlestranded RNA viruses, such as MS2 and norovirus were degraded more easily than the genome of a linear double-stranded DNA virus (adenovirus). These results suggest that the viral DNA genome is more resistant to degradation by autoclaving than the viral RNA genome. Consequently, the elimination of amplification of viral DNA in samples by PCR is very difficult. Because this study demonstrates incomplete reduction of viral genomes by autoclaving, equipment and materials should be treated by alternative means to remove remaining nucleic acids when possible residual nucleic acid contamination of equipment by viral genomes is suspected and the equipment is planned for use in studies where viral detection by (RT-)PCR amplification is to be performed. Rigorous efforts to eliminate the potential for nucleic acid amplification of residual RNA or DNA are needed to eliminate false positives from samples negative for the target nucleic acids.
291
Acknowledgement
261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289
293
This work was supported by Dongguk University-Gyeongju Research Fund.
294
References
292
295 296
Adams, M.H., 1959. Bacteriophages. Wiley-Interscience, New York. Bae, J., Schwab, K.J., 2008. Evaluation of murine norovirus, feline calicivirus, poliovirus, and MS2 as surrogates for human norovirus in a model of viral
persistence in surface water and groundwater. Applied and Environmental Microbiology 74, 477–484. Bai, M., Campisi, L., Freimuth, P., 1994. Vitronectin receptor antibodies inhibit infection of HeLa and A549 cells by adenovirus type 12 but not by adenovirus type 2. Journal of Virology 68, 5925–5932. Borst, A., Box, A.T.A., Fluit, A.C., 2004. False-positive results and contamination in nucleic acid amplification assays: suggestions for a prevent and destroy strategy. European Journal of Clinical Microbiology and Infectious Diseases 23, 289–299. Dwyer, D.E., Saksena, N., 1992. Failure of ultra-violet irradiation and autoclaving to eliminate PCR contamination. Molecular and Cellular Probes 6, 87–88. Fujioka, R.S., Tenno, K.M., Loh, P.C., 1983. Mechanism of chloramine inactivation of poliovirus: a concern for regulators? In: Jolley, R.L., Brungs, W.A., Contruvo, J.A., Gumming, R.B., Mattice, J.S., Jacobs, V.A. (Eds.), Water Chlorination: Environmental Impacts and Health Effects, vol. 4. Ann Arbor Science Publishers, Ann Arbor, MI. Gefrides, L.A., Powell, M.C., Donley, M.A., Kahn, R., 2010. UV irradiation and autoclave treatment for elimination of contaminating DNA from laboratory consumables. Forensic Science International Genetics 4, 89–94. Hall, A., Ballantyne, J., 2004. Characterization of UVC-induced DNA damage in bloodstains: forensic implications. Analytical and Bioanalytical Chemistry 380, 72–83. Heid, C.A., Stevens, J., Livak, K.J., Williams, P.M., 1996. Real-time quantitative PCR. Genome Research 6, 986–994. Jothikumar, N., Cromeans, T.L., Hill, V.R., Lu, X., Sobsey, M.D., Erdman, D.D., 2005a. Quantitative real-time PCR assays for detection of human adenoviruses and identification of serotypes 40 and 41. Applied and Environmental Microbiology 71, 3131–3136. Jothikumar, N., Lowther, J.A., Henshilwood, K., Lees, D.N., Hill, V.R., Vinjé, J., 2005b. Rapid and sensitive detection of noroviruses by using TaqMan-based one-step reverse transcription-PCR assays and application to naturally contaminated shellfish samples. Applied and Environmental Microbiology 71, 1870–1875. Porter-Jordan, K., Garrett, C.T., 1990. Source of contamination in polymerase chain reaction assay. Lancet 335, 1220. Rodríguez, R.A., Thie, L., Gibbons, C.D., Sobsey, M.D., 2012. Reducing the effects of environmental inhibition in quantitative real-time PCR detection of adenovirus and norovirus in recreational seawaters. Journal of Virological Methods 181, 43–50. Shaw, K., Sesardic, I., Bristol, N., Ames, C., Dagnall, K., Ellis, C., Whittaker, F., Daniel, B., 2008. Comparison of the effects of sterilization techniques on subsequent DNA profiling. International Journal of Legal Medicine 122, 29–33. Simonet, J., Gantzer, C., 2006. Inactivation of poliovirus 1 and F-specific RNA phages and degradation of their genomes by UV irradiation at 254 nanometers. Applied and Environmental Microbiology 72, 7671–7677. Sullivan, K., Johnson, P., Rowlands, D., Allen, H., 2004. New developments and challenges in the use of the UK DNA database: addressing the issue of contaminated consumables. Forensic Science International 146 (Suppl.), S157–S176. Tenno, K.M., Fujioka, R.S., Loh, P.C., 1980. The mechanism of poliovirus inactivation by hypochlorous acid. In: Jolley, R.L., Brungs, W.A., Cunnings, R.B. (Eds.), Water Chlorination: Environmental Impact and Health Effects, vol. 3. Ann Arbor Science Publisher, Ann Arbor, MI, pp. 665–675. Wolf, S., Rivera-Aban, M., Greening, G.E., 2009. Long-range reverse transcription as a useful tool to assess the genomic integrity of norovirus. Food and Environmental Virology 1, 129–136.
Please cite this article in press as: Choi, W.S., et al., Persistence of viral genomes after autoclaving. J. Virol. Methods (2014), http://dx.doi.org/10.1016/j.jviromet.2013.12.021
297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348
