This article was downloaded by: [OARE Consortium] On: 27 June 2015, At: 02:07 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Plant Signaling & Behavior Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/kpsb20
PDH45 overexpressing transgenic tobacco and rice plants provide salinity stress tolerance via less sodium accumulation a
a
a
a
Manoj Nath , Bharti Garg , Ranjan Kumar Sahoo & Narendra Tuteja a
Plant Biology; Plant Molecular Biology Group; International Center for Genetic Engineering and Biotechnology; Aruna Asaf Ali Marg; New Delhi, India Published online: 01 Apr 2015.
Click for updates To cite this article: Manoj Nath, Bharti Garg, Ranjan Kumar Sahoo & Narendra Tuteja (2015) PDH45 overexpressing transgenic tobacco and rice plants provide salinity stress tolerance via less sodium accumulation, Plant Signaling & Behavior, 10:4, e992289, DOI: 10.4161/15592324.2014.992289 To link to this article: http://dx.doi.org/10.4161/15592324.2014.992289
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
RESEARCH PAPER Plant Signaling & Behavior 10:4, e992289; April 2015; © 2015 Taylor & Francis Group, LLC
PDH45 overexpressing transgenic tobacco and rice plants provide salinity stress tolerance via less sodium accumulation Manoj Nath, Bharti Garg, Ranjan Kumar Sahoo, and Narendra Tuteja* Plant Biology; Plant Molecular Biology Group; International Center for Genetic Engineering and Biotechnology; Aruna Asaf Ali Marg; New Delhi, India
Downloaded by [OARE Consortium] at 02:07 27 June 2015
Keywords: CoroNa Green dye, pea DNA helicase 45 (PDH45), salinity stress tolerance, sodium ions accumulation, transgenic tobacco and rice
Salinity stress negatively affects the crop productivity worldwide, including that of rice. Coping with these losses is a major concern for all countries. The pea DNA helicase, PDH45 is a unique member of helicase family involved in the salinity stress tolerance. However, the exact mechanism of the PDH45 in salinity stress tolerance is yet to be established. Therefore, the present study was conducted to investigate the mechanism of PDH45-mediated salinity stress tolerance in transgenic tobacco and rice lines along with wild type (WT) plants using CoroNa Green dye based sodium localization in root and shoot sections. The results showed that under salinity stress root and shoot of PDH45 overexpressing transgenic tobacco and rice accumulated less sodium (NaC) as compared to their respective WT. The present study also reports salinity tolerant (FL478) and salinity susceptible (Pusa-44) varieties of rice accumulated lowest and highest NaC level, respectively. All the varieties and transgenic lines of rice accumulate differential NaC ions in root and shoot. However, roots accumulate high NaC as compared to the shoots in both tobacco and rice transgenic lines suggesting that the NaC transport in shoot is somehow inhibited. It is proposed that the PDH45 is probably involved in the deposition of apoplastic hydrophobic barriers and consequently inhibit NaC transport to shoot and therefore confers salinity stress tolerance to PDH45 overexpressing transgenic lines. This study concludes that tobacco (dicot) and rice (monocot) transgenic plants probably share common salinity tolerance mechanism mediated by PDH45 gene.
Introduction Salinity stress negatively impacts and reduces rice productivity; the effect is especially severe on high yielding varieties. A comprehensive understanding of salinity stress at molecular level is essential to develop high yielding salinity tolerant varieties, which can be effectively grown in salt-affected areas. Rice is the main staple crop and provides essential daily calories to over half of the world population.1,2 In recent era, helicases have evolved as an important and emerging player in the abiotic stress tolerance, including salinity stress.3-9 Among helicases, pea DNA helicase, PDH45 is a unique member, which contains DESD and SRT instead of the typical DEAD/H and SAT in motifs V and VI, respectively.10 In earlier reports, overexpression of salt-inducible PDH45 in tobacco and rice (IR64 and PB1) leads to the salinity stress tolerance without compromising yield.11-13 Although the detailed mechanism of helicase, in salinity resistance, remains unclear but recently it was reported in rice (PB1 variety) that overexpression of PDH45 mediates salinity tolerance by generating induced reactive oxygen species (ROS) and also protects photosynthetic machinery.11
Recently, it was reported that hydrophobic barrier formation in roots further reduces bypass flow in high salt concentration.14 The casparian bands and suberin lamellae are the usual apoplastic barriers inside endodermis and exodermis of plant roots15 owing to the deposition of hydrophobic suberin and/or lignin in the pores of the radial and anticlinal walls and also deposition of lignin as secondary wall thickenings on the inner face of the primary cell walls.16 Further, bypass flow closely paralleled the extent of suberin deposition over the course of exposure to salinity stress and is negatively correlated with suberin deposits.17 CoroNa Green AM binds with sodium (NaC) and is specific NaC indicator that shows increase in fluorescence intensity indicates increasing NaC accumulation. In this study, role of PDH45 helicase in salinity stress was investigated using CoroNa Green AM dye specific to NaC localization. The present study also reports CoroNa Green based NaC accumulation in root and shoot of tobacco as well as different rice varieties and transgenic lines along with WT, i.e., IR64 (moderate salinity tolerant), overexpressing PDH45 transgenic lines (PDH45 L1 and L2), salinity tolerant (FL478) and salinity susceptible (Pusa-44).
*Correspondence to: Narendra Tuteja, Email: [email protected] Submitted: 10/16/2014; Revised: 10/31/2014; Accepted: 10/31/2014 http://dx.doi.org/10.4161/15592324.2014.992289
www.tandfonline.com
Plant Signaling & Behavior
e992289-1
Results
Downloaded by [OARE Consortium] at 02:07 27 June 2015
CoroNa Green, fluorescent NaC specific dye provides a valuable means for non-destructive monitoring to detect the spatial and temporal distribution of NaC. To investigate the NaC accumulation, root and shoot were analyzed using CoroNa Green dye in tobacco and rice transgenics. NaC localization in roots and shoots of tobacco transgenic plants CoroNa Green based comparative analysis reveals that the roots (Fig. 1A) and shoot (Fig. 1B) of WT accumulates less NaC as compared to PDH45 transgenic line. Moreover, on comparative analysis among root and shoot of WT and PDH45 transgenic plants showed the higher accumulation of NaC ions in root as compared to shoot. Therefore, further to elucidate the role of PDH45, different rice varieties and transgenic lines were analyzed using CoroNa Green along with WT.
Comparative NaC localization in root and shoot of different rice varieties and transgenic lines The root anatomical study demonstrated that the epidermis, mesenchyma and vascular bundle of IR64 and Pusa-44 accumulate highest NaC level. On the other hand, epidermis, mesenchyma and vascular bundle of PDH45 transgenic lines (L1 and L2) and FL478 contain moderate and lowest level of NaC while the vascular bundle had similar NaC level. The moderate NaC term is used for transgenic lines because the accumulation was less than the wild type (IR64) and Pusa-44. Overall, comparative root anatomical study revealed that the highest NaC accumulation was observed in the IR64 (moderately salinity tolerant) and Pusa-44 (salinity susceptible) varieties. The similar trend for NaC accumulation was observed in the 2 PDH45 transgenic lines (L1 and L2), whereas it was less than wild type (IR64) (Fig. 2 and Table 1). Comparative shoot anatomy at 1 cm from the shoot base (border between root-shoot), showed that IR64 and Pusa-44 accumulate high NaC while PDH45 transgenic lines L1 and L2 had similar NaC level. However as compared to the wild type (IR64) the NaC was less in the case of transgenic lines. The lowest NaC was observed in the case of salinity tolerant variety, FL478. Similar comparative shoot anatomical results were also observed for the 3 varieties and 2 transgenic lines at 2-3 cm from the shoot base (Fig. 3 and Table 1). It was observed that the NaC accumulation was always higher in root as compared to shoot in all the rice varieties and transgenics studied in which experiments were performed in triplicates (Supplementary Figs. S1 and S2). The duplicate data of 2 times are shown in Supplementary Figs. S1 and S2.
Discussion
Figure 1. CoroNa Green based NaC accumulation in PDH45 tobacco transgenic and wild type (WT) plants. (A) Root tips. (B) Shoot.
e992289-2
In rice shoots, the NaC majorly enters through apoplastic bypass and is transported by apoplastic pathway using solvent drag and bypassing casparian bands.18,19 Although exposing the rice under salinity stress leads to the deposition of suberin that further provides strength to the apoplastic barriers and such barriers block NaC transport to shoots.16 The salinity tolerant variety (Pokkali) revealed more extensive hydrophobic barriers in its roots as compared to the salinity susceptible variety (IR20).17,20 The PDH45 overexpression enhances salinity tolerance without compromising yield as compared to WT (IR64).11 The results of this study, revealed differential accumulation of NaC in salinity stress in 3 rice varieties and 2 transgenic lines analyzed. The comparative root NaC localization analysis shows that the salinity tolerant variety (FL478) and salinity susceptible varieties (IR64 and Pusa-44) accumulate lowest and highest NaC, respectively. However, the PDH45 transgenic lines (L1 and L2) accumulate less NaC as compare to WT (IR64). Similarly, differential NaC level was also observed in shoots of all 5 rice transgenics/varieties analyzed, though the NaC concentration in case of root was found higher as compared to the shoot (Fig. 2 and 3).
Plant Signaling & Behavior
Volume 10 Issue 4
Downloaded by [OARE Consortium] at 02:07 27 June 2015
Figure 2. CoroNa Green based NaC accumulation in root of 3 rice varieties and 2 transgenic lines. Transverse section of root (1 cm from root tip). Scale bar 100 mm. (B) Enlarged view of vascular bundle. Scale bar 50 mm. WT: Wild type. (C) Labeling transverse section of root. ep: Epidermis, ex: exodermis, me: mesodermis, en: endodermis, ae: aerenchyma, and vb: vascular bundle.
In salinity stress, different plant varieties respond differently via a plethora of biochemical, physiological and molecular mechanisms. Kanai et al.21 using CoroNa Green dye in common reed (Phragmites australis) demonstrates that the starch granule increased in response to salinity stress at shoot base and binds Table 1. NaC accumulation in root and shoot of rice transgenic lines and varieties IR64 PDH45 L1 PDH45 L2 FL478 Pusa-44 Root*
Epidermis Mesenchyma Vascular Bundle Shoot 1 cm from shoot base 3 cm from shoot base
High High High High
Moderate Moderate Moderate Low
Moderate Moderate Moderate Low
Low Low Low Low
High High High High
High
Low
Low
Low
High
*Root florescence intensity is high as compared to shoot.
www.tandfonline.com
with NaC consequently leads to the decrease in free cytosolic Na . Therefore, it was proposed that the site-specific production of NaC-binding starch granules constitutes a novel salt tolerance mechanism. In another report, Kavitha et al.22 found that the root protoplast of salinity tolerant variety (Pokkali) accumulate less NaC compared to the salinity susceptible variety (IR20) using CoroNa Green dye. While Zhang et al.23 reported that salinity tolerant genotypes (FL478 and IR651) accumulates less NaC and also maintained lower ratios of NaC/KC, NaC/Ca2C and NaC/ Mg2C when compared to the salinity susceptible genotypes (IR29 and Azucena) under salinity stress. Similarly in this study it was observed that salinity tolerant (FL478) and PDH45 transgenic lines accumulate less NaC then salinity susceptible varieties (IR64 and Pusa-44). The findings of present study showed that PDH45 overexpressing plants maintained comparatively lower levels of NaC toxicity in roots than shoots under salinity stress might be due to the NaC efflux from the roots, which is suggested earlier also.24 C
Plant Signaling & Behavior
e992289-3
Downloaded by [OARE Consortium] at 02:07 27 June 2015
Figure 3. CoroNa Green based NaC accumulation in shoot of 3 rice varieties and 2 transgenic lines. Transverse section of shoot (A). 1 cm from shoot base. (B) 3 cm from shoot base. Scale bar 200 mm. WT:-Wild type. (C) Labeling of Shoot transverse section. ep: Epidermis, en: endodermis, ae: aerenchyma, vb: vascular bundle, S: Stem, and LS: Leaf sheath.
In many dicots, NaC can be retrieved and stored in leaf petioles and in stems, whereas in monocots NaC ions may be retrieved and accumulated in leaf sheaths and in stems elongating regions.25,26 The cytochrome P450, CYP86A1, ASFT, FAR1, FHT and ESB1 genes coding for a suberin biosynthetic enzyme,27 which develop apoplastic barriers in roots and thereby provide tolerance in response to salt stress.14 In the present study, the differential NaC accumulation in root and shoot of WT and PDH45 overexpressing transgenic lines suggested that pea DNA helicase is probably involved in the inhibition of NaC entry inside root and also in NaC transport from root to shoot that leads to the salinity stress tolerance via its role in the deposition of additional apoplastic barriers to block the NaC entry into the cytosol. Here, findings of less NaC accumulation in shoots in the tolerant rice varieties/ transgenic lines are similar with finding of Krishnamurthy et al.17 who reported that additional suberized hydrophobic
e992289-4
barriers and reduced entry of NaC into shoots under salt stress conditions. Therefore, our findings in sustaining least NaC in shoot suggest that PDH45 gene may be involved similar salinity tolerance mechanism in defined tobacco (dicot) and rice (monocot) transgenic plants in response to salinity stress. However, further study is needed to investigate the precise mechanism of salinity tolerance in plant mediated via PDH45 helicase.
Materials and Methods Plasmids construction and transformation of tobacco and rice plants The complete ORF of PDH45 cDNA (1.2 kb; Accession number Y17186.1) was PCR amplified using the gene specific primers (Forward: GGAATTCCGGATGGCGACAACTTC TGTG Reverse: GGGGTACCCCTTATATAAGATCACCAA
Plant Signaling & Behavior
Volume 10 Issue 4
TATTCATTGG) and cloned into pCAMBIA series of vector as described earlier.28 The transgenic tobacco and IR64 rice plants overexpressing PDH45 transgenics were raised as described earlier.29,30 Plant growth and salinity stress WT and PDH45 transgenic plants of Tobacco were grown in vermiculite pots for 15 days. The rice varieties FL478 (salinity tolerant), salinity susceptible (Pusa-44) and WT (IR64) along with PDH45 overexpressing salinity tolerant transgenic lines (PDH45 L1 and L2) were grown in vermiculite pots for 15 days. Further, these plants were subjected to salinity stress using 200 mM NaCl for 24 hour in triplicate.
Authors’ Contributions
MN designed and conducted the experiments, interpreted the results, analyzed the data and drafted the manuscript. BG designed and conducted the experiments, interpreted the results, analyzed the data and drafted the manuscript. RKS conducted the experiments. NT designed the experiments, interpreted the results, analyzed the data and drafted the manuscript. Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
Downloaded by [OARE Consortium] at 02:07 27 June 2015
Acknowledgments
Comparative anatomy and CoroNa Green based NaC localization After imposing the salinity stress, the primary root and shoot of tobacco were sectioned using razor blade. While rice crown roots (1 cm from the root tip) and shoot (1 and 3 cm from the shoot base) of the rice transgenic/varieties were cut by free hand sectioning method using razor blade. Further, these sections were subjected to CoroNa Green AM dye (Invitrogen, Ltd., Carlsbad, CA, USA) according to the method adopted by Huda et al.31 NaC fluorescence and image was analyzed using confocal microscopy (Model Nikon A1R). The confocal settings were as follows: excitation 488 nm, emission 510–530 nm, frame 512x 512. All the analysis was conducted in triplicate. References 1. Singh AK, Kumar R, Pareek A, Sopory SK, Singla-Pareek SL. Overexpression of rice CBS domain containing protein improves salinity, oxidative, and heavy metal tolerance in transgenic tobacco. Mol Biotech 2012; 52:205-16. 2. Singh S, Modi MK, Gill SS, Tuteja N. Rice: genetic engineering approaches for abiotic stress tolerance – retrospects and prospects. Improving crop productivity in sustainable agriculture, In: Tuteja N, Gill SS, Tuteja R (eds) Wiley-VCH Verlag GmbH and Co, KGaA, Germany 2012; 203-25. 3. Tuteja N, Tuteja R. Prokaryotic and eukaryotic DNA helicases. Essential molecular motor proteins for cellular machinery. Eur J Biochem 2004; 271:1835-48; PMID:15128294; http://dx.doi.org/10.1111/j.14321033.2004.04093.x 4. Tuteja N, Singh LP, Gill SS, Tuteja R. Salinity Stress: A Major Constraint in Crop Production. Improving crop resistance to abiotic stress In: Tuteja N, Gill SS, Tiburcio AF, Tuteja R (eds) Wiley-VCH Verlag GmbH and Co, KGaA, Germany 2012; 71-96. 5. Tuteja N, Gill SS, Tuteja R. Helicases in improving abiotic stress tolerance in crop plants. Improving crop resistance to abiotic stress In: Tuteja N, Gill SS, Tiburcio AF, Tuteja R (eds) Wiley- VCHVerlag GmbH and Co, KGaA, Germany 2012; 433-45. 6. Owttrim GW. RNA helicases and abiotic stress. Nucleic Acids Res 2006; 34:3220-30; PMID:16790567; http://dx.doi.org/10.1093/nar/ gkl408 7. Owttrim GW. RNA helicases: Diverse roles in prokaryotic response to abiotic stress. Plant Signal Behav 2013; 10:95-109. 8. Vashisht AA, Tuteja N. Stress responsive DEAD-box helicases: a new pathway to engineer plant stress tolerance. J Photochem Photobiol 2006; 84:150-60; PMID:16624568; http://dx.doi.org/10.1016/j. jphotobiol.2006.02.010
www.tandfonline.com
We thank Dr. Alok Sinha for critical reading of the manuscript. Funding
The work on stress tolerance in N. T.’s laboratory is partially supported by Department of Biotechnology, Government of India. Supplemental Material
Supplemental data for this article can be accessed on the publisher’s website
9. Umate P, Tuteja R, Tuteja N. Genome-wide analysis of helicase gene family from rice and Arabidopsis: a comparison with yeast and human. Plant Mol Biol 2010; 73:449-65; PMID:20383562; http://dx.doi.org/ 10.1007/s11103-010-9632-5 10. Pham XH, Reddy MK, Ehtesham NZ, Matta B, Tuteja N. A DNA helicase from Pisum sativum is homologous to translation initiation factor and stimulates topoisomerase I activity. Plant J 2000; 24:219-29; PMID:11069696; http://dx.doi.org/10.1046/j.1365313x.2000.00869.x 11. Gill SS, Tajrishi M, Madan M, Tuteja N. A DESD-box helicase functions in salinity stress tolerance by improving photosynthesis and antioxidant machinery in rice (Oryza sativa L. cv. PB1). Plant Mol Biol 2013; 82:122; PMID:23456247; http://dx.doi.org/10.1007/ s11103-013-0031-6 12. Sahoo RK, Gill SS, Tuteja N. Pea DNA helicase 45 promotes salinity stress tolerance in IR64 rice with improved yield. Plant Signal Behav 2012; 7:1042-6; PMID:22827940; http://dx.doi.org/10.4161/ psb.20915 13. Sanan-Mishra N, Pham XH, Sopory SK, Tuteja N. Pea DNA helicase 45 overexpression in tobacco confers high salinity tolerance without affecting yield. Proc Natl Acad Sci U S A 2005; 102:509-14; PMID: 15630095; http://dx.doi.org/10.1073/pnas. 0406485102 14. Krishnamurthy P, Jyothi-Prakash PA, Qin L, He J, Li Q, Lo CS, Kumar PP. Role of root hydrophobic barriers in salt exclusion of a mangrove plant Avicennia officinalis. Plant Cell Environ 2014; 37:1656-71; PMID:24417377; http://dx.doi.org/10.1111/pce.12272 15. Schreiber L, Hartmann K, Skrabs M, Zeier J. Apoplastic barriers in roots: chemical composition of endodermal and hypodermal cell walls. J Exp Bot 1999; 50:1267-80 16. Naseer S, Lee Y, Lapierre C, Franke R, Nawrath C, Geldner N. Casparian strip diffusion barrier in
Plant Signaling & Behavior
17.
18.
19.
20.
21.
22.
23.
Arabidopsis is made of a lignin polymer without suberin. PNAS 2012; 109:10101-6; PMID:22665765; http://dx.doi.org/10.1073/pnas.1205726109 Krishnamurthy P, Ranathunge K, Nayak S ,Schreiber L, Mathew MK. Root apoplastic barriers block NaC transport to shoots in rice (Oryza sativa L.). J Exp Bot 2011; 62:4215-28; PMID:21558150; http://dx.doi. org/10.1093/jxb/err135 Gong HJ, Randall DP, Flowers TJ. Silicon deposition in the root reduces sodium uptake in rice (Oryza sativa L.) seedlings by reducing bypass flow. Plant Cell Environ 2006; 29:1970-9; PMID:16930322; http://dx.doi. org/10.1111/j.1365-3040.2006.01572.x Ranathunge K, Steudle E, Lafitte R. Blockage of apoplastic bypass-flow of water in rice roots by insoluble salt precipitates analogous to a Pfeffer cell. Plant Cell Environ 2005; 28:121-33; http://dx.doi.org/10.1111/ j.1365-3040.2004.01245.x Krishnamurthy P, Ranathunge K, Franke R, Prakash HS, Schreiber L, Mathew MK. The role of root apoplastic transport barriers in salt tolerance of rice (Oryza sativa L.). Planta 2009; 230:119-34; PMID:19363620; http://dx.doi.org/10.1007/s00425-009-0930-6 Kanai M, Higuchi K, Hagihara T, Konishi T, Ishii T, Fujita N, Nakamura Y, Maeda Y, Yoshiba M, Tadano T. Common reed produces starch granules at the shoot base in response to salt stress. New Phytol 2007; 176:572-80; PMID:17953542; http://dx.doi.org/ 10.1111/j.1469-8137.2007.02188.x Kavitha PG, Miller AJ, Mathew MK, Maathuis FJM. Rice cultivars with differing salt tolerance contain similar cation channels in their root cells. J Exp Bot 2012; 63:3289-96; PMID:22345644; http://dx.doi.org/ 10.1093/jxb/ers052 Zhang Z ,Liu Q, Song H, Rong X, Ismail A. Responses of contrasting Rice (Oryza sativa L.) genotypes to salt stress as affected by nutrient concentrations. Agricultural Sci China 2011; 10:195-206; http://dx.doi.org/ 10.1016/S1671-2927(09)60306-0
e992289-5
27. Beisson F, Li-Beisson Y, Pollard M. Solving the puzzles of cutin and suberin polymer biosynthesis. Curr Opin Plant Biol 2012; 15:329-37; PMID:22465132; http:// dx.doi.org/10.1016/j.pbi.2012.03.003 28. Amin M, Elias SM, Hossain A, Ferdousi A, Rahman MS, Tuteja N, Seraj Z I. Overexpression of a DEAD box helicase, PDH45, confers both seedling and reproductive stage salinity tolerance to rice (Oryza sativa L.). Mol Breeding 2012; 30(1):345-54; http://dx.doi.org/ 10.1007/s11032-011-9625-3 29. Sahoo RK, Tuteja N. Development of Agrobacteriummediated transformation technology for mature seedderived callus tissues of indica rice cultivar IR64. GM Crops Food 2012; 3:123-8; PMID:22538224; http:// dx.doi.org/10.4161/gmcr.20032
30. Pathi, KM, Tula S, Tuteja N. High frequency regeneration via direct somatic embryogenesis and efficient Agrobacterium-mediated genetic transformation of tobacco. Plant Signal Behav 2013; 8(6):e24354; PMID:23518589; http://dx.doi.org/10.4161/ psb.24354 31. Huda KMK, Banu MSA, Garg B, Tula S, Tuteja R, Tuteja N. OsACA6, a P-type IIB Ca2CATPase, promotes salinity and drought stress tolerance in tobacco by ROS scavenging and enhancing the expression of stress-responsive genes. Plant J 2013; 76:997-1015; PMID:24128296; http://dx.doi.org/10.1111/ tpj.12352
Downloaded by [OARE Consortium] at 02:07 27 June 2015
24. Matsushita N, Matoh T. Characterization of NaC exclusion mechanisms of salt- tolerant reed plants in comparison with salt-sensitive rice plants. Physiologia Plantarum 1991; 83:170-6; http://dx.doi.org/10.1111/ j.1399-3054.1991.tb01298.x 25. Wolf O, Munns R, Tonnet M L, Jeschke WD. The role of the stem in the portioning of NaC and KC in salt treated barley. J Exp Bot 1991; 42, 697-704; http://dx. doi.org/10.1093/jxb/42.6.697 26. Davenport R J, Munnoz-Mayor A, Jha D, Essah PA, Rus A, Tester M. The NaC transgenic transporter AtHKT, controls retrieval of NaC from the xylem in Arabidopsis. Plant Cell Environ 2007; 30:497-507; PMID:17324235; http://dx.doi.org/10.1111/j.13653040.2007.01637.x
e992289-6
Plant Signaling & Behavior
Volume 10 Issue 4
Plant Signaling & Behavior Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/kpsb20
PDH45 overexpressing transgenic tobacco and rice plants provide salinity stress tolerance via less sodium accumulation a
a
a
a
Manoj Nath , Bharti Garg , Ranjan Kumar Sahoo & Narendra Tuteja a
Plant Biology; Plant Molecular Biology Group; International Center for Genetic Engineering and Biotechnology; Aruna Asaf Ali Marg; New Delhi, India Published online: 01 Apr 2015.
Click for updates To cite this article: Manoj Nath, Bharti Garg, Ranjan Kumar Sahoo & Narendra Tuteja (2015) PDH45 overexpressing transgenic tobacco and rice plants provide salinity stress tolerance via less sodium accumulation, Plant Signaling & Behavior, 10:4, e992289, DOI: 10.4161/15592324.2014.992289 To link to this article: http://dx.doi.org/10.4161/15592324.2014.992289
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
RESEARCH PAPER Plant Signaling & Behavior 10:4, e992289; April 2015; © 2015 Taylor & Francis Group, LLC
PDH45 overexpressing transgenic tobacco and rice plants provide salinity stress tolerance via less sodium accumulation Manoj Nath, Bharti Garg, Ranjan Kumar Sahoo, and Narendra Tuteja* Plant Biology; Plant Molecular Biology Group; International Center for Genetic Engineering and Biotechnology; Aruna Asaf Ali Marg; New Delhi, India
Downloaded by [OARE Consortium] at 02:07 27 June 2015
Keywords: CoroNa Green dye, pea DNA helicase 45 (PDH45), salinity stress tolerance, sodium ions accumulation, transgenic tobacco and rice
Salinity stress negatively affects the crop productivity worldwide, including that of rice. Coping with these losses is a major concern for all countries. The pea DNA helicase, PDH45 is a unique member of helicase family involved in the salinity stress tolerance. However, the exact mechanism of the PDH45 in salinity stress tolerance is yet to be established. Therefore, the present study was conducted to investigate the mechanism of PDH45-mediated salinity stress tolerance in transgenic tobacco and rice lines along with wild type (WT) plants using CoroNa Green dye based sodium localization in root and shoot sections. The results showed that under salinity stress root and shoot of PDH45 overexpressing transgenic tobacco and rice accumulated less sodium (NaC) as compared to their respective WT. The present study also reports salinity tolerant (FL478) and salinity susceptible (Pusa-44) varieties of rice accumulated lowest and highest NaC level, respectively. All the varieties and transgenic lines of rice accumulate differential NaC ions in root and shoot. However, roots accumulate high NaC as compared to the shoots in both tobacco and rice transgenic lines suggesting that the NaC transport in shoot is somehow inhibited. It is proposed that the PDH45 is probably involved in the deposition of apoplastic hydrophobic barriers and consequently inhibit NaC transport to shoot and therefore confers salinity stress tolerance to PDH45 overexpressing transgenic lines. This study concludes that tobacco (dicot) and rice (monocot) transgenic plants probably share common salinity tolerance mechanism mediated by PDH45 gene.
Introduction Salinity stress negatively impacts and reduces rice productivity; the effect is especially severe on high yielding varieties. A comprehensive understanding of salinity stress at molecular level is essential to develop high yielding salinity tolerant varieties, which can be effectively grown in salt-affected areas. Rice is the main staple crop and provides essential daily calories to over half of the world population.1,2 In recent era, helicases have evolved as an important and emerging player in the abiotic stress tolerance, including salinity stress.3-9 Among helicases, pea DNA helicase, PDH45 is a unique member, which contains DESD and SRT instead of the typical DEAD/H and SAT in motifs V and VI, respectively.10 In earlier reports, overexpression of salt-inducible PDH45 in tobacco and rice (IR64 and PB1) leads to the salinity stress tolerance without compromising yield.11-13 Although the detailed mechanism of helicase, in salinity resistance, remains unclear but recently it was reported in rice (PB1 variety) that overexpression of PDH45 mediates salinity tolerance by generating induced reactive oxygen species (ROS) and also protects photosynthetic machinery.11
Recently, it was reported that hydrophobic barrier formation in roots further reduces bypass flow in high salt concentration.14 The casparian bands and suberin lamellae are the usual apoplastic barriers inside endodermis and exodermis of plant roots15 owing to the deposition of hydrophobic suberin and/or lignin in the pores of the radial and anticlinal walls and also deposition of lignin as secondary wall thickenings on the inner face of the primary cell walls.16 Further, bypass flow closely paralleled the extent of suberin deposition over the course of exposure to salinity stress and is negatively correlated with suberin deposits.17 CoroNa Green AM binds with sodium (NaC) and is specific NaC indicator that shows increase in fluorescence intensity indicates increasing NaC accumulation. In this study, role of PDH45 helicase in salinity stress was investigated using CoroNa Green AM dye specific to NaC localization. The present study also reports CoroNa Green based NaC accumulation in root and shoot of tobacco as well as different rice varieties and transgenic lines along with WT, i.e., IR64 (moderate salinity tolerant), overexpressing PDH45 transgenic lines (PDH45 L1 and L2), salinity tolerant (FL478) and salinity susceptible (Pusa-44).
*Correspondence to: Narendra Tuteja, Email: [email protected] Submitted: 10/16/2014; Revised: 10/31/2014; Accepted: 10/31/2014 http://dx.doi.org/10.4161/15592324.2014.992289
www.tandfonline.com
Plant Signaling & Behavior
e992289-1
Results
Downloaded by [OARE Consortium] at 02:07 27 June 2015
CoroNa Green, fluorescent NaC specific dye provides a valuable means for non-destructive monitoring to detect the spatial and temporal distribution of NaC. To investigate the NaC accumulation, root and shoot were analyzed using CoroNa Green dye in tobacco and rice transgenics. NaC localization in roots and shoots of tobacco transgenic plants CoroNa Green based comparative analysis reveals that the roots (Fig. 1A) and shoot (Fig. 1B) of WT accumulates less NaC as compared to PDH45 transgenic line. Moreover, on comparative analysis among root and shoot of WT and PDH45 transgenic plants showed the higher accumulation of NaC ions in root as compared to shoot. Therefore, further to elucidate the role of PDH45, different rice varieties and transgenic lines were analyzed using CoroNa Green along with WT.
Comparative NaC localization in root and shoot of different rice varieties and transgenic lines The root anatomical study demonstrated that the epidermis, mesenchyma and vascular bundle of IR64 and Pusa-44 accumulate highest NaC level. On the other hand, epidermis, mesenchyma and vascular bundle of PDH45 transgenic lines (L1 and L2) and FL478 contain moderate and lowest level of NaC while the vascular bundle had similar NaC level. The moderate NaC term is used for transgenic lines because the accumulation was less than the wild type (IR64) and Pusa-44. Overall, comparative root anatomical study revealed that the highest NaC accumulation was observed in the IR64 (moderately salinity tolerant) and Pusa-44 (salinity susceptible) varieties. The similar trend for NaC accumulation was observed in the 2 PDH45 transgenic lines (L1 and L2), whereas it was less than wild type (IR64) (Fig. 2 and Table 1). Comparative shoot anatomy at 1 cm from the shoot base (border between root-shoot), showed that IR64 and Pusa-44 accumulate high NaC while PDH45 transgenic lines L1 and L2 had similar NaC level. However as compared to the wild type (IR64) the NaC was less in the case of transgenic lines. The lowest NaC was observed in the case of salinity tolerant variety, FL478. Similar comparative shoot anatomical results were also observed for the 3 varieties and 2 transgenic lines at 2-3 cm from the shoot base (Fig. 3 and Table 1). It was observed that the NaC accumulation was always higher in root as compared to shoot in all the rice varieties and transgenics studied in which experiments were performed in triplicates (Supplementary Figs. S1 and S2). The duplicate data of 2 times are shown in Supplementary Figs. S1 and S2.
Discussion
Figure 1. CoroNa Green based NaC accumulation in PDH45 tobacco transgenic and wild type (WT) plants. (A) Root tips. (B) Shoot.
e992289-2
In rice shoots, the NaC majorly enters through apoplastic bypass and is transported by apoplastic pathway using solvent drag and bypassing casparian bands.18,19 Although exposing the rice under salinity stress leads to the deposition of suberin that further provides strength to the apoplastic barriers and such barriers block NaC transport to shoots.16 The salinity tolerant variety (Pokkali) revealed more extensive hydrophobic barriers in its roots as compared to the salinity susceptible variety (IR20).17,20 The PDH45 overexpression enhances salinity tolerance without compromising yield as compared to WT (IR64).11 The results of this study, revealed differential accumulation of NaC in salinity stress in 3 rice varieties and 2 transgenic lines analyzed. The comparative root NaC localization analysis shows that the salinity tolerant variety (FL478) and salinity susceptible varieties (IR64 and Pusa-44) accumulate lowest and highest NaC, respectively. However, the PDH45 transgenic lines (L1 and L2) accumulate less NaC as compare to WT (IR64). Similarly, differential NaC level was also observed in shoots of all 5 rice transgenics/varieties analyzed, though the NaC concentration in case of root was found higher as compared to the shoot (Fig. 2 and 3).
Plant Signaling & Behavior
Volume 10 Issue 4
Downloaded by [OARE Consortium] at 02:07 27 June 2015
Figure 2. CoroNa Green based NaC accumulation in root of 3 rice varieties and 2 transgenic lines. Transverse section of root (1 cm from root tip). Scale bar 100 mm. (B) Enlarged view of vascular bundle. Scale bar 50 mm. WT: Wild type. (C) Labeling transverse section of root. ep: Epidermis, ex: exodermis, me: mesodermis, en: endodermis, ae: aerenchyma, and vb: vascular bundle.
In salinity stress, different plant varieties respond differently via a plethora of biochemical, physiological and molecular mechanisms. Kanai et al.21 using CoroNa Green dye in common reed (Phragmites australis) demonstrates that the starch granule increased in response to salinity stress at shoot base and binds Table 1. NaC accumulation in root and shoot of rice transgenic lines and varieties IR64 PDH45 L1 PDH45 L2 FL478 Pusa-44 Root*
Epidermis Mesenchyma Vascular Bundle Shoot 1 cm from shoot base 3 cm from shoot base
High High High High
Moderate Moderate Moderate Low
Moderate Moderate Moderate Low
Low Low Low Low
High High High High
High
Low
Low
Low
High
*Root florescence intensity is high as compared to shoot.
www.tandfonline.com
with NaC consequently leads to the decrease in free cytosolic Na . Therefore, it was proposed that the site-specific production of NaC-binding starch granules constitutes a novel salt tolerance mechanism. In another report, Kavitha et al.22 found that the root protoplast of salinity tolerant variety (Pokkali) accumulate less NaC compared to the salinity susceptible variety (IR20) using CoroNa Green dye. While Zhang et al.23 reported that salinity tolerant genotypes (FL478 and IR651) accumulates less NaC and also maintained lower ratios of NaC/KC, NaC/Ca2C and NaC/ Mg2C when compared to the salinity susceptible genotypes (IR29 and Azucena) under salinity stress. Similarly in this study it was observed that salinity tolerant (FL478) and PDH45 transgenic lines accumulate less NaC then salinity susceptible varieties (IR64 and Pusa-44). The findings of present study showed that PDH45 overexpressing plants maintained comparatively lower levels of NaC toxicity in roots than shoots under salinity stress might be due to the NaC efflux from the roots, which is suggested earlier also.24 C
Plant Signaling & Behavior
e992289-3
Downloaded by [OARE Consortium] at 02:07 27 June 2015
Figure 3. CoroNa Green based NaC accumulation in shoot of 3 rice varieties and 2 transgenic lines. Transverse section of shoot (A). 1 cm from shoot base. (B) 3 cm from shoot base. Scale bar 200 mm. WT:-Wild type. (C) Labeling of Shoot transverse section. ep: Epidermis, en: endodermis, ae: aerenchyma, vb: vascular bundle, S: Stem, and LS: Leaf sheath.
In many dicots, NaC can be retrieved and stored in leaf petioles and in stems, whereas in monocots NaC ions may be retrieved and accumulated in leaf sheaths and in stems elongating regions.25,26 The cytochrome P450, CYP86A1, ASFT, FAR1, FHT and ESB1 genes coding for a suberin biosynthetic enzyme,27 which develop apoplastic barriers in roots and thereby provide tolerance in response to salt stress.14 In the present study, the differential NaC accumulation in root and shoot of WT and PDH45 overexpressing transgenic lines suggested that pea DNA helicase is probably involved in the inhibition of NaC entry inside root and also in NaC transport from root to shoot that leads to the salinity stress tolerance via its role in the deposition of additional apoplastic barriers to block the NaC entry into the cytosol. Here, findings of less NaC accumulation in shoots in the tolerant rice varieties/ transgenic lines are similar with finding of Krishnamurthy et al.17 who reported that additional suberized hydrophobic
e992289-4
barriers and reduced entry of NaC into shoots under salt stress conditions. Therefore, our findings in sustaining least NaC in shoot suggest that PDH45 gene may be involved similar salinity tolerance mechanism in defined tobacco (dicot) and rice (monocot) transgenic plants in response to salinity stress. However, further study is needed to investigate the precise mechanism of salinity tolerance in plant mediated via PDH45 helicase.
Materials and Methods Plasmids construction and transformation of tobacco and rice plants The complete ORF of PDH45 cDNA (1.2 kb; Accession number Y17186.1) was PCR amplified using the gene specific primers (Forward: GGAATTCCGGATGGCGACAACTTC TGTG Reverse: GGGGTACCCCTTATATAAGATCACCAA
Plant Signaling & Behavior
Volume 10 Issue 4
TATTCATTGG) and cloned into pCAMBIA series of vector as described earlier.28 The transgenic tobacco and IR64 rice plants overexpressing PDH45 transgenics were raised as described earlier.29,30 Plant growth and salinity stress WT and PDH45 transgenic plants of Tobacco were grown in vermiculite pots for 15 days. The rice varieties FL478 (salinity tolerant), salinity susceptible (Pusa-44) and WT (IR64) along with PDH45 overexpressing salinity tolerant transgenic lines (PDH45 L1 and L2) were grown in vermiculite pots for 15 days. Further, these plants were subjected to salinity stress using 200 mM NaCl for 24 hour in triplicate.
Authors’ Contributions
MN designed and conducted the experiments, interpreted the results, analyzed the data and drafted the manuscript. BG designed and conducted the experiments, interpreted the results, analyzed the data and drafted the manuscript. RKS conducted the experiments. NT designed the experiments, interpreted the results, analyzed the data and drafted the manuscript. Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
Downloaded by [OARE Consortium] at 02:07 27 June 2015
Acknowledgments
Comparative anatomy and CoroNa Green based NaC localization After imposing the salinity stress, the primary root and shoot of tobacco were sectioned using razor blade. While rice crown roots (1 cm from the root tip) and shoot (1 and 3 cm from the shoot base) of the rice transgenic/varieties were cut by free hand sectioning method using razor blade. Further, these sections were subjected to CoroNa Green AM dye (Invitrogen, Ltd., Carlsbad, CA, USA) according to the method adopted by Huda et al.31 NaC fluorescence and image was analyzed using confocal microscopy (Model Nikon A1R). The confocal settings were as follows: excitation 488 nm, emission 510–530 nm, frame 512x 512. All the analysis was conducted in triplicate. References 1. Singh AK, Kumar R, Pareek A, Sopory SK, Singla-Pareek SL. Overexpression of rice CBS domain containing protein improves salinity, oxidative, and heavy metal tolerance in transgenic tobacco. Mol Biotech 2012; 52:205-16. 2. Singh S, Modi MK, Gill SS, Tuteja N. Rice: genetic engineering approaches for abiotic stress tolerance – retrospects and prospects. Improving crop productivity in sustainable agriculture, In: Tuteja N, Gill SS, Tuteja R (eds) Wiley-VCH Verlag GmbH and Co, KGaA, Germany 2012; 203-25. 3. Tuteja N, Tuteja R. Prokaryotic and eukaryotic DNA helicases. Essential molecular motor proteins for cellular machinery. Eur J Biochem 2004; 271:1835-48; PMID:15128294; http://dx.doi.org/10.1111/j.14321033.2004.04093.x 4. Tuteja N, Singh LP, Gill SS, Tuteja R. Salinity Stress: A Major Constraint in Crop Production. Improving crop resistance to abiotic stress In: Tuteja N, Gill SS, Tiburcio AF, Tuteja R (eds) Wiley-VCH Verlag GmbH and Co, KGaA, Germany 2012; 71-96. 5. Tuteja N, Gill SS, Tuteja R. Helicases in improving abiotic stress tolerance in crop plants. Improving crop resistance to abiotic stress In: Tuteja N, Gill SS, Tiburcio AF, Tuteja R (eds) Wiley- VCHVerlag GmbH and Co, KGaA, Germany 2012; 433-45. 6. Owttrim GW. RNA helicases and abiotic stress. Nucleic Acids Res 2006; 34:3220-30; PMID:16790567; http://dx.doi.org/10.1093/nar/ gkl408 7. Owttrim GW. RNA helicases: Diverse roles in prokaryotic response to abiotic stress. Plant Signal Behav 2013; 10:95-109. 8. Vashisht AA, Tuteja N. Stress responsive DEAD-box helicases: a new pathway to engineer plant stress tolerance. J Photochem Photobiol 2006; 84:150-60; PMID:16624568; http://dx.doi.org/10.1016/j. jphotobiol.2006.02.010
www.tandfonline.com
We thank Dr. Alok Sinha for critical reading of the manuscript. Funding
The work on stress tolerance in N. T.’s laboratory is partially supported by Department of Biotechnology, Government of India. Supplemental Material
Supplemental data for this article can be accessed on the publisher’s website
9. Umate P, Tuteja R, Tuteja N. Genome-wide analysis of helicase gene family from rice and Arabidopsis: a comparison with yeast and human. Plant Mol Biol 2010; 73:449-65; PMID:20383562; http://dx.doi.org/ 10.1007/s11103-010-9632-5 10. Pham XH, Reddy MK, Ehtesham NZ, Matta B, Tuteja N. A DNA helicase from Pisum sativum is homologous to translation initiation factor and stimulates topoisomerase I activity. Plant J 2000; 24:219-29; PMID:11069696; http://dx.doi.org/10.1046/j.1365313x.2000.00869.x 11. Gill SS, Tajrishi M, Madan M, Tuteja N. A DESD-box helicase functions in salinity stress tolerance by improving photosynthesis and antioxidant machinery in rice (Oryza sativa L. cv. PB1). Plant Mol Biol 2013; 82:122; PMID:23456247; http://dx.doi.org/10.1007/ s11103-013-0031-6 12. Sahoo RK, Gill SS, Tuteja N. Pea DNA helicase 45 promotes salinity stress tolerance in IR64 rice with improved yield. Plant Signal Behav 2012; 7:1042-6; PMID:22827940; http://dx.doi.org/10.4161/ psb.20915 13. Sanan-Mishra N, Pham XH, Sopory SK, Tuteja N. Pea DNA helicase 45 overexpression in tobacco confers high salinity tolerance without affecting yield. Proc Natl Acad Sci U S A 2005; 102:509-14; PMID: 15630095; http://dx.doi.org/10.1073/pnas. 0406485102 14. Krishnamurthy P, Jyothi-Prakash PA, Qin L, He J, Li Q, Lo CS, Kumar PP. Role of root hydrophobic barriers in salt exclusion of a mangrove plant Avicennia officinalis. Plant Cell Environ 2014; 37:1656-71; PMID:24417377; http://dx.doi.org/10.1111/pce.12272 15. Schreiber L, Hartmann K, Skrabs M, Zeier J. Apoplastic barriers in roots: chemical composition of endodermal and hypodermal cell walls. J Exp Bot 1999; 50:1267-80 16. Naseer S, Lee Y, Lapierre C, Franke R, Nawrath C, Geldner N. Casparian strip diffusion barrier in
Plant Signaling & Behavior
17.
18.
19.
20.
21.
22.
23.
Arabidopsis is made of a lignin polymer without suberin. PNAS 2012; 109:10101-6; PMID:22665765; http://dx.doi.org/10.1073/pnas.1205726109 Krishnamurthy P, Ranathunge K, Nayak S ,Schreiber L, Mathew MK. Root apoplastic barriers block NaC transport to shoots in rice (Oryza sativa L.). J Exp Bot 2011; 62:4215-28; PMID:21558150; http://dx.doi. org/10.1093/jxb/err135 Gong HJ, Randall DP, Flowers TJ. Silicon deposition in the root reduces sodium uptake in rice (Oryza sativa L.) seedlings by reducing bypass flow. Plant Cell Environ 2006; 29:1970-9; PMID:16930322; http://dx.doi. org/10.1111/j.1365-3040.2006.01572.x Ranathunge K, Steudle E, Lafitte R. Blockage of apoplastic bypass-flow of water in rice roots by insoluble salt precipitates analogous to a Pfeffer cell. Plant Cell Environ 2005; 28:121-33; http://dx.doi.org/10.1111/ j.1365-3040.2004.01245.x Krishnamurthy P, Ranathunge K, Franke R, Prakash HS, Schreiber L, Mathew MK. The role of root apoplastic transport barriers in salt tolerance of rice (Oryza sativa L.). Planta 2009; 230:119-34; PMID:19363620; http://dx.doi.org/10.1007/s00425-009-0930-6 Kanai M, Higuchi K, Hagihara T, Konishi T, Ishii T, Fujita N, Nakamura Y, Maeda Y, Yoshiba M, Tadano T. Common reed produces starch granules at the shoot base in response to salt stress. New Phytol 2007; 176:572-80; PMID:17953542; http://dx.doi.org/ 10.1111/j.1469-8137.2007.02188.x Kavitha PG, Miller AJ, Mathew MK, Maathuis FJM. Rice cultivars with differing salt tolerance contain similar cation channels in their root cells. J Exp Bot 2012; 63:3289-96; PMID:22345644; http://dx.doi.org/ 10.1093/jxb/ers052 Zhang Z ,Liu Q, Song H, Rong X, Ismail A. Responses of contrasting Rice (Oryza sativa L.) genotypes to salt stress as affected by nutrient concentrations. Agricultural Sci China 2011; 10:195-206; http://dx.doi.org/ 10.1016/S1671-2927(09)60306-0
e992289-5
27. Beisson F, Li-Beisson Y, Pollard M. Solving the puzzles of cutin and suberin polymer biosynthesis. Curr Opin Plant Biol 2012; 15:329-37; PMID:22465132; http:// dx.doi.org/10.1016/j.pbi.2012.03.003 28. Amin M, Elias SM, Hossain A, Ferdousi A, Rahman MS, Tuteja N, Seraj Z I. Overexpression of a DEAD box helicase, PDH45, confers both seedling and reproductive stage salinity tolerance to rice (Oryza sativa L.). Mol Breeding 2012; 30(1):345-54; http://dx.doi.org/ 10.1007/s11032-011-9625-3 29. Sahoo RK, Tuteja N. Development of Agrobacteriummediated transformation technology for mature seedderived callus tissues of indica rice cultivar IR64. GM Crops Food 2012; 3:123-8; PMID:22538224; http:// dx.doi.org/10.4161/gmcr.20032
30. Pathi, KM, Tula S, Tuteja N. High frequency regeneration via direct somatic embryogenesis and efficient Agrobacterium-mediated genetic transformation of tobacco. Plant Signal Behav 2013; 8(6):e24354; PMID:23518589; http://dx.doi.org/10.4161/ psb.24354 31. Huda KMK, Banu MSA, Garg B, Tula S, Tuteja R, Tuteja N. OsACA6, a P-type IIB Ca2CATPase, promotes salinity and drought stress tolerance in tobacco by ROS scavenging and enhancing the expression of stress-responsive genes. Plant J 2013; 76:997-1015; PMID:24128296; http://dx.doi.org/10.1111/ tpj.12352
Downloaded by [OARE Consortium] at 02:07 27 June 2015
24. Matsushita N, Matoh T. Characterization of NaC exclusion mechanisms of salt- tolerant reed plants in comparison with salt-sensitive rice plants. Physiologia Plantarum 1991; 83:170-6; http://dx.doi.org/10.1111/ j.1399-3054.1991.tb01298.x 25. Wolf O, Munns R, Tonnet M L, Jeschke WD. The role of the stem in the portioning of NaC and KC in salt treated barley. J Exp Bot 1991; 42, 697-704; http://dx. doi.org/10.1093/jxb/42.6.697 26. Davenport R J, Munnoz-Mayor A, Jha D, Essah PA, Rus A, Tester M. The NaC transgenic transporter AtHKT, controls retrieval of NaC from the xylem in Arabidopsis. Plant Cell Environ 2007; 30:497-507; PMID:17324235; http://dx.doi.org/10.1111/j.13653040.2007.01637.x
e992289-6
Plant Signaling & Behavior
Volume 10 Issue 4
