Molecular and Cellular Probes (1990) 4, 40 9-414
PCR detection of Plasmodium falciparum by oligonucleotide probes G . jaureguiberry,' 2 * 1 . Hatin, L. d'Auriol' and G . Galibert' 'Laboratoire d'Hématologie Expérimentale UPR 41 CNRS, Centre Hayem, Hôpital Saint Louis, 2 Pl . du Dr . Alfred Fournier, 75010 Paris, France and 2INSERM U 13 Hôpital Claude Bernard, 10 Av . de la Porte d'Aubervilliers, 75019 Paris, France (Received 4 April 1990, Accepted 23 April 1990)
PCR experiments using rRNA sequence-specific oligonucleotides were used to detect Plasmodium falciparum DNA and Plasmodium vivax DNA from cultures and blood samples .
KEYWORDS :
PCR, ribosomal RNA, Plasmodium falciparum, oligonucleotide probes .
INTRODUCTION Antibody-based diagnostic procedures have been proposed as alternatives to microscopic diagnosis of malaria . These procedures rely on the detection of circulating antigens or antibodies . However, this approach is not sensitive enough to detect low-level parasitaemia and it does not distinguish between past and active infections . DNA diagnostic procedures were also developed, based on hybridization of cloned genomic fragments or oligonucleotide probes to the repetitive genomic DNA of Plasmodium falciparum .' -8 A number of other promising candidate probes for use in DNA hybridization-based diagnosis were tested in a clinical vaccine trial and shown to be less useful than previously thought .' McCutchan et al . have recently determined the primary sequence of the small (18S) rRNA subunit genes of P . falciparum 10 which are present at four copies per genome. The comparison of the sequence of human 18S rRNA with the 18S rRNA sequence of P . falciparum allows the identification of regions with no homology (these regions extended to 30% of the sequence) . Within these regions it is possible to define specific oligonucleotide which can be used for PCR amplification . * Author to whom correspondence should be addressed .
© 1990 Academic Press Limited
0890-8508/90/050409+06 $03 .00/0 409
410
G . Jaureguiberry et aL
We report here a series of PCR experiments using rRNA sequence-specific oligonucleotide to identify P . falciparum DNA and P . vivax DNA from culture and blood samples .
MATERIALS AND METHODS DNA from P . falciparum Asynchronous culture of clinical isolates FCM 29 clone C1 and uncloned FCM 31 were harvested at parasitaemia of 10-15% for extraction of DNA . DNA was isolated by lysis of parasitized red blood cells by 0 . 01 % saponin (BDH) at 37°C for 20 ruin . The lysate was incubated for 1 h at 37°C in 1 X SSC containing 5% N-lauiroyl sarcosine (Sigma) with 1 mg m1 - ' of proteinase K and extracted by the phenol/ chloroform method . The aqueous phase was dialysed against TE (Tris 10 mm, pH 8 . 0, EDTA 1 mm) and the DNA was separated by equilibrium gradient centrifugation (SW41 38,000 rpm 48h at 10 ° C) in caesium chloride (d =1 . 55 g cm -3 ) in the presence of ethidium bromide (250 µg ml - ') . The single band of DNA was extracted by isobutanol to eliminate ethidium bromide and dialysed against TE . DNA from P . vivax was kindly provided by Dr Peter David .
DNA from human placenta Human placenta (320 g) were Waring blended in Tris 50 mm, pH 7 . 5, EDTA 10 mm treated by 50 gg of proteinase K and incubated for 1 h at 37°C with slow agitation and the DNA was extracted by phenol/chloroform and treated by RNase as currently described .
Blood samples Blood (50 µl) was collected in ACD tubes from patients presenting a parasitaemia of 0 . 001-7 . 5% and washed twice in 10 mm NaCl, 10 mm EDTA . The pellet was homogenized in 6 M guanidinium hydrochloride, 7-5m ammonium acetate, '1% sodium sarkosyl, proteinase K, 15 mg ml -1 . The mixture was heated to 60°C for l h . DNA was precipitated by 2 vol of ethyl alcohol, washed and then dissolved in 20 p.l of TE .
Oligonucleotides Oligonucleotides were synthetized by the phosphoramite chemistry with an automatic synthetizer (BIOSEARCH 8600) . After deprotection the oligonucleotides were purified by acrylamide gel electrophoresis . Two oligonucleotides were chosen according to the primary sequence of the ribosomal RNA of P . falciparum 10 and were used for amplification . One of them corresponds to the position 914-933 of the sequence and the second to position 1125-1105 on the complementary strand .
PCR detection of
Plasmodium falciparum
41 1
The oligonucleotide hybridizing to the amplified sequence corresponds to ACGAAAGTTAAGGGAGTGAAGACCA, position 1042 to 1066 of the rRNA sequence. The amplification was done according to Saiki et al ." with a Perkin-Elmer thermal cycler (Table 1) .
Detection An aliquot of 1 % of the reaction mixture was denatured by addition of NaOH 0 . 4 M/ EDTA 25 mm and incubated at 37-C for 15 min . This denatured aliquot was applied to a Gelman membrane (Biotrace) pretreated by 20 X SSC using a Schleicher and Schuell manifold slot-blot system . The membrane was neutralized by immersing first in 20 X SSC and then in 2 X SSC . The membrane was then dried at 80°C for 30 min and used for hybridization .
DNA hybridization The oligonucleotide probe was end labelled using y- 32 P ATP (3000 ci mmole - ') and T4 polynucleotide kinase . Prehybridization was carried out in 10 ml of 5 X SSC, 5 X Dennardt's solution, 0t5% SDS at 56°C for 1 h followed by another four of hybridization in the same buffer containing the labelled probe . Following hybridization the blot was washed at room temperature in 2 X SSC, 0. 1 % SDS, 5 min and then at 63 ° C for 15 min in 5 X SSC, 0 . 1 % SDS before being sealed in Saran wrap and exposed to X-ray film for 12 h with a Cronex Hi + screen .
Microscopy The microscopic examinations were performed as follows : thick and thin smears were prepared from each patient . Slides were stained with Giemsa and examined
Table 1 .
Operating the DNA thermal cycler for PCR experiments Time (min)
Temperature
Denaturation Annealing Extension
5 1 1 . 30
92 °C 48°C 72°C
Cycles 2-25
Denaturation Annealing Extension
1 1 1 . 30
92°C 48°C 72°C
Last cycle
Denaturation Annealing Extension
1 1 5
92°C 48°C 72° C
Cycle
Operation
First cycle
412
G . Jaureguiberry et al.
2
3
4
6
7
8
9
Fig. 1 . DNA was extracted from samples amplified and hybridized as described in the text . Slot 1 : 1 Vg of P . falciparum DNA ; slot 2 : oligonucleotides alone ; slot 3 : 1 pg human DNA; slots 4-9: 10-fold dilution of 1 pg P. falciparum DNA with human DNA .
twice. Parasites were quantified by counting the number of infected erythrocytes/ 200 white blood cells (WBCs) . Parasitaemia was calculated assuming 8 X 103 "BC and 5 X 10 6 red blood cells (RBC) pl - ' of blood .
RESULTS AND DISCUSSION As shown in Fig . 1, slot 1 and in Fig . 2a, slot 4, PCR-amplified DNA of P . falciparum gives a very strong response after hybridization with an oligonucleotide probe corresponding to position 1042-1066 of the rRNA sequence of P . falciparum . With identical conditions of amplification and detection, human DNA gives no detectable signal (Fig . 1, slot 3) . Since very often PCR amplfication gives false-positive responses the quality of reagents used were tested in a control test tube containing everything except P. falciparum DNA (Fig . 1, slot 2). To test the sensitivity of the method serial 10-fold dilutions of 1 .tg P. falciparum DNA were done with human DNA . These dilutions were amplified as above and 1 of each solution was blotted and hybridized with the same oligonucleotide probe . The level of sensitivity is shown on Fig . 1, slots 4-9
PCR detection of
41 3
Plasmodium falciparum
2
3
4
a
b
Fig. 2 . Samples were extracted, amplified and hybridized as described in the text . (a) Slot 1 : blood sample, 1 .3% parasitaemia ; slot 2 : blood sample, 0 .001 % parasitaemia; slot 3 : blood sample, 1 . 6% parasitaemia ; slot 4 : 1 µg P. falciparum DNA ; slot 5 : 1 µg P . vivax. (b) Slot 1 : blood sample, 1 . 3% parasitaemia; slot 2: blood sample, 0. 001% parasitaemia ; slot 3 : blood sample, 3% parasitaemia ; slot 4: P. falciparum culture in vitro, 0. 1 % parasitaemia ; slot 5 : blood sample, 7. 5% parasitaemia; slot 6: 1 .tg P . falciparum .
slot 9 corresponding to the dilution 10 -6 . This corresponds to 0 . 01 pg of P . falciparum DNA (i .e . 0 . 5 genome equivalent) . Blood samples from patients with parasitaemia between 0 . 001% and 7 . 5% determined by microscopic examination were treated as described in Materials and Methods . After amplification 10% of the solution was blotted on the membrane as already described . Figure 2b shows a very strong response with the patient who had 7 . 5o/o parasitaemia as well as a just detectable hybridization signal in blood from a patient with 0-001% parasitaemia (Fig . 2a, slot 2) . As shown in Fig . 2a, slot 5 a positive signal was also obtained with the same amount of P . vivax . However, the response was less intense, probably because of the presence of some mismatches either in the amplifier and/or the detection probe . This technique should be particularly useful in detecting the presence of plasmodia in blood bank samples .
ACKNOWLEDGEMENTS This work was supported by the Centre National de la Recherche Scientifique (CNRS) and Institut National de la Santé et de la Recherche Médicale (INSERM) .
414
G. Jaureguiberry et al.
REFERENCES 1 . Frazen, L ., Shabo, R., Perlmann, H . et al. (1984) . Analysis of clinical specimen by hybridization with a probe containing repetitive DNA from P. falciparum . A novel approach to malaria diagnosis . Lancet i, 525-8. 2 . Enea, V . (1986) . Sensitive and specific DNA probe for detection of P . falciparum . Molecular and Cellular Biology 6, 321-4 . 3 . Aslund, L ., Frazen, L ., Westin, G ., Persson, T ., Wigzell, H . & Petterson, U . (1985) . Highly reiterated non-coding sequence in the genome of P . falciparum is composed of 21 base pair tandem repeats . Journal of Molecular Biology 185, 509-16 . 4 . Barker, R . H . Jr., Suebsaeng, L., Rooney, W ., Alecim, G . A ., Dourado, N . V . & Wirth, D . F . (19136) . Specific DNA probe for the diagnosis of P . falciparum malaria . Science 231, 1434-6 . 5 . Holmberg, M., Shenton, F . C., Frazen, L . et al . (1987) . Use of DNA hybridization assay for the detection of P . falciparum in field trials . American journal of Tropical Medicine and Hygiene 37, 230-4. 6. Oguendo, P ., Goman, M ., MacKay, M., Langsley, G ., Walliker, D . & Scaife, J . (1986) . Characterization of a repetitive DNA sequence from the malaria parasite. P . falciparum . Molecular and Biochemical Parasitology 18, 89-101 . 7 . McLaughlin, G . L ., Collins, W. E . & Campbell, G . H . (1987) . Comparison of genomic, synthetic and combined DNA probes for detecting P . falciparum DNA. Journal of Clinical Microbiology 25, 7915. 8. Zolg, J . W., Antrade, E . & Scott, E. D . (1987) . Detection of P. falciparum DNA using repetitive DNA clones as species-specific probes . Molecular and Biochemical Parasitology 22, 145-51 . 9. Lamar, D . E ., McLaughlin, G . L ., Wirth, D . F ., Barker, R. J ., Zolg, J . W. & Chulay, J . D . (19139) . Comparison of thick films, in vitro culture and DNA hybridization probes for detecting P. falciparum malaria. American journal of Tropical Medicine and Hygiene 40, 3-6. 10. McCutchan, T . F., De La Cruz, V . F., Lal, A . A ., Gunderson, J. H ., Elwood, H . J. & Sogin, M . L . (1988) . Primary sequences of two small subunit ribosomal RNA genes from P. falciparum . Molecular and Biochemical Parasitology 28, 63-8 . 11 . Saiki, R . K ., Ssharf, S., Faloona, F . et al. (1985) . Enzymatic amplification of ß globin genornic sequences and restriction site analysis for diagnosis of sickle cell anemia . Science 230, 1350-4
PCR detection of Plasmodium falciparum by oligonucleotide probes G . jaureguiberry,' 2 * 1 . Hatin, L. d'Auriol' and G . Galibert' 'Laboratoire d'Hématologie Expérimentale UPR 41 CNRS, Centre Hayem, Hôpital Saint Louis, 2 Pl . du Dr . Alfred Fournier, 75010 Paris, France and 2INSERM U 13 Hôpital Claude Bernard, 10 Av . de la Porte d'Aubervilliers, 75019 Paris, France (Received 4 April 1990, Accepted 23 April 1990)
PCR experiments using rRNA sequence-specific oligonucleotides were used to detect Plasmodium falciparum DNA and Plasmodium vivax DNA from cultures and blood samples .
KEYWORDS :
PCR, ribosomal RNA, Plasmodium falciparum, oligonucleotide probes .
INTRODUCTION Antibody-based diagnostic procedures have been proposed as alternatives to microscopic diagnosis of malaria . These procedures rely on the detection of circulating antigens or antibodies . However, this approach is not sensitive enough to detect low-level parasitaemia and it does not distinguish between past and active infections . DNA diagnostic procedures were also developed, based on hybridization of cloned genomic fragments or oligonucleotide probes to the repetitive genomic DNA of Plasmodium falciparum .' -8 A number of other promising candidate probes for use in DNA hybridization-based diagnosis were tested in a clinical vaccine trial and shown to be less useful than previously thought .' McCutchan et al . have recently determined the primary sequence of the small (18S) rRNA subunit genes of P . falciparum 10 which are present at four copies per genome. The comparison of the sequence of human 18S rRNA with the 18S rRNA sequence of P . falciparum allows the identification of regions with no homology (these regions extended to 30% of the sequence) . Within these regions it is possible to define specific oligonucleotide which can be used for PCR amplification . * Author to whom correspondence should be addressed .
© 1990 Academic Press Limited
0890-8508/90/050409+06 $03 .00/0 409
410
G . Jaureguiberry et aL
We report here a series of PCR experiments using rRNA sequence-specific oligonucleotide to identify P . falciparum DNA and P . vivax DNA from culture and blood samples .
MATERIALS AND METHODS DNA from P . falciparum Asynchronous culture of clinical isolates FCM 29 clone C1 and uncloned FCM 31 were harvested at parasitaemia of 10-15% for extraction of DNA . DNA was isolated by lysis of parasitized red blood cells by 0 . 01 % saponin (BDH) at 37°C for 20 ruin . The lysate was incubated for 1 h at 37°C in 1 X SSC containing 5% N-lauiroyl sarcosine (Sigma) with 1 mg m1 - ' of proteinase K and extracted by the phenol/ chloroform method . The aqueous phase was dialysed against TE (Tris 10 mm, pH 8 . 0, EDTA 1 mm) and the DNA was separated by equilibrium gradient centrifugation (SW41 38,000 rpm 48h at 10 ° C) in caesium chloride (d =1 . 55 g cm -3 ) in the presence of ethidium bromide (250 µg ml - ') . The single band of DNA was extracted by isobutanol to eliminate ethidium bromide and dialysed against TE . DNA from P . vivax was kindly provided by Dr Peter David .
DNA from human placenta Human placenta (320 g) were Waring blended in Tris 50 mm, pH 7 . 5, EDTA 10 mm treated by 50 gg of proteinase K and incubated for 1 h at 37°C with slow agitation and the DNA was extracted by phenol/chloroform and treated by RNase as currently described .
Blood samples Blood (50 µl) was collected in ACD tubes from patients presenting a parasitaemia of 0 . 001-7 . 5% and washed twice in 10 mm NaCl, 10 mm EDTA . The pellet was homogenized in 6 M guanidinium hydrochloride, 7-5m ammonium acetate, '1% sodium sarkosyl, proteinase K, 15 mg ml -1 . The mixture was heated to 60°C for l h . DNA was precipitated by 2 vol of ethyl alcohol, washed and then dissolved in 20 p.l of TE .
Oligonucleotides Oligonucleotides were synthetized by the phosphoramite chemistry with an automatic synthetizer (BIOSEARCH 8600) . After deprotection the oligonucleotides were purified by acrylamide gel electrophoresis . Two oligonucleotides were chosen according to the primary sequence of the ribosomal RNA of P . falciparum 10 and were used for amplification . One of them corresponds to the position 914-933 of the sequence and the second to position 1125-1105 on the complementary strand .
PCR detection of
Plasmodium falciparum
41 1
The oligonucleotide hybridizing to the amplified sequence corresponds to ACGAAAGTTAAGGGAGTGAAGACCA, position 1042 to 1066 of the rRNA sequence. The amplification was done according to Saiki et al ." with a Perkin-Elmer thermal cycler (Table 1) .
Detection An aliquot of 1 % of the reaction mixture was denatured by addition of NaOH 0 . 4 M/ EDTA 25 mm and incubated at 37-C for 15 min . This denatured aliquot was applied to a Gelman membrane (Biotrace) pretreated by 20 X SSC using a Schleicher and Schuell manifold slot-blot system . The membrane was neutralized by immersing first in 20 X SSC and then in 2 X SSC . The membrane was then dried at 80°C for 30 min and used for hybridization .
DNA hybridization The oligonucleotide probe was end labelled using y- 32 P ATP (3000 ci mmole - ') and T4 polynucleotide kinase . Prehybridization was carried out in 10 ml of 5 X SSC, 5 X Dennardt's solution, 0t5% SDS at 56°C for 1 h followed by another four of hybridization in the same buffer containing the labelled probe . Following hybridization the blot was washed at room temperature in 2 X SSC, 0. 1 % SDS, 5 min and then at 63 ° C for 15 min in 5 X SSC, 0 . 1 % SDS before being sealed in Saran wrap and exposed to X-ray film for 12 h with a Cronex Hi + screen .
Microscopy The microscopic examinations were performed as follows : thick and thin smears were prepared from each patient . Slides were stained with Giemsa and examined
Table 1 .
Operating the DNA thermal cycler for PCR experiments Time (min)
Temperature
Denaturation Annealing Extension
5 1 1 . 30
92 °C 48°C 72°C
Cycles 2-25
Denaturation Annealing Extension
1 1 1 . 30
92°C 48°C 72°C
Last cycle
Denaturation Annealing Extension
1 1 5
92°C 48°C 72° C
Cycle
Operation
First cycle
412
G . Jaureguiberry et al.
2
3
4
6
7
8
9
Fig. 1 . DNA was extracted from samples amplified and hybridized as described in the text . Slot 1 : 1 Vg of P . falciparum DNA ; slot 2 : oligonucleotides alone ; slot 3 : 1 pg human DNA; slots 4-9: 10-fold dilution of 1 pg P. falciparum DNA with human DNA .
twice. Parasites were quantified by counting the number of infected erythrocytes/ 200 white blood cells (WBCs) . Parasitaemia was calculated assuming 8 X 103 "BC and 5 X 10 6 red blood cells (RBC) pl - ' of blood .
RESULTS AND DISCUSSION As shown in Fig . 1, slot 1 and in Fig . 2a, slot 4, PCR-amplified DNA of P . falciparum gives a very strong response after hybridization with an oligonucleotide probe corresponding to position 1042-1066 of the rRNA sequence of P . falciparum . With identical conditions of amplification and detection, human DNA gives no detectable signal (Fig . 1, slot 3) . Since very often PCR amplfication gives false-positive responses the quality of reagents used were tested in a control test tube containing everything except P. falciparum DNA (Fig . 1, slot 2). To test the sensitivity of the method serial 10-fold dilutions of 1 .tg P. falciparum DNA were done with human DNA . These dilutions were amplified as above and 1 of each solution was blotted and hybridized with the same oligonucleotide probe . The level of sensitivity is shown on Fig . 1, slots 4-9
PCR detection of
41 3
Plasmodium falciparum
2
3
4
a
b
Fig. 2 . Samples were extracted, amplified and hybridized as described in the text . (a) Slot 1 : blood sample, 1 .3% parasitaemia ; slot 2 : blood sample, 0 .001 % parasitaemia; slot 3 : blood sample, 1 . 6% parasitaemia ; slot 4 : 1 µg P. falciparum DNA ; slot 5 : 1 µg P . vivax. (b) Slot 1 : blood sample, 1 . 3% parasitaemia; slot 2: blood sample, 0. 001% parasitaemia ; slot 3 : blood sample, 3% parasitaemia ; slot 4: P. falciparum culture in vitro, 0. 1 % parasitaemia ; slot 5 : blood sample, 7. 5% parasitaemia; slot 6: 1 .tg P . falciparum .
slot 9 corresponding to the dilution 10 -6 . This corresponds to 0 . 01 pg of P . falciparum DNA (i .e . 0 . 5 genome equivalent) . Blood samples from patients with parasitaemia between 0 . 001% and 7 . 5% determined by microscopic examination were treated as described in Materials and Methods . After amplification 10% of the solution was blotted on the membrane as already described . Figure 2b shows a very strong response with the patient who had 7 . 5o/o parasitaemia as well as a just detectable hybridization signal in blood from a patient with 0-001% parasitaemia (Fig . 2a, slot 2) . As shown in Fig . 2a, slot 5 a positive signal was also obtained with the same amount of P . vivax . However, the response was less intense, probably because of the presence of some mismatches either in the amplifier and/or the detection probe . This technique should be particularly useful in detecting the presence of plasmodia in blood bank samples .
ACKNOWLEDGEMENTS This work was supported by the Centre National de la Recherche Scientifique (CNRS) and Institut National de la Santé et de la Recherche Médicale (INSERM) .
414
G. Jaureguiberry et al.
REFERENCES 1 . Frazen, L ., Shabo, R., Perlmann, H . et al. (1984) . Analysis of clinical specimen by hybridization with a probe containing repetitive DNA from P. falciparum . A novel approach to malaria diagnosis . Lancet i, 525-8. 2 . Enea, V . (1986) . Sensitive and specific DNA probe for detection of P . falciparum . Molecular and Cellular Biology 6, 321-4 . 3 . Aslund, L ., Frazen, L ., Westin, G ., Persson, T ., Wigzell, H . & Petterson, U . (1985) . Highly reiterated non-coding sequence in the genome of P . falciparum is composed of 21 base pair tandem repeats . Journal of Molecular Biology 185, 509-16 . 4 . Barker, R . H . Jr., Suebsaeng, L., Rooney, W ., Alecim, G . A ., Dourado, N . V . & Wirth, D . F . (19136) . Specific DNA probe for the diagnosis of P . falciparum malaria . Science 231, 1434-6 . 5 . Holmberg, M., Shenton, F . C., Frazen, L . et al . (1987) . Use of DNA hybridization assay for the detection of P . falciparum in field trials . American journal of Tropical Medicine and Hygiene 37, 230-4. 6. Oguendo, P ., Goman, M ., MacKay, M., Langsley, G ., Walliker, D . & Scaife, J . (1986) . Characterization of a repetitive DNA sequence from the malaria parasite. P . falciparum . Molecular and Biochemical Parasitology 18, 89-101 . 7 . McLaughlin, G . L ., Collins, W. E . & Campbell, G . H . (1987) . Comparison of genomic, synthetic and combined DNA probes for detecting P . falciparum DNA. Journal of Clinical Microbiology 25, 7915. 8. Zolg, J . W., Antrade, E . & Scott, E. D . (1987) . Detection of P. falciparum DNA using repetitive DNA clones as species-specific probes . Molecular and Biochemical Parasitology 22, 145-51 . 9. Lamar, D . E ., McLaughlin, G . L ., Wirth, D . F ., Barker, R. J ., Zolg, J . W. & Chulay, J . D . (19139) . Comparison of thick films, in vitro culture and DNA hybridization probes for detecting P. falciparum malaria. American journal of Tropical Medicine and Hygiene 40, 3-6. 10. McCutchan, T . F., De La Cruz, V . F., Lal, A . A ., Gunderson, J. H ., Elwood, H . J. & Sogin, M . L . (1988) . Primary sequences of two small subunit ribosomal RNA genes from P. falciparum . Molecular and Biochemical Parasitology 28, 63-8 . 11 . Saiki, R . K ., Ssharf, S., Faloona, F . et al. (1985) . Enzymatic amplification of ß globin genornic sequences and restriction site analysis for diagnosis of sickle cell anemia . Science 230, 1350-4
