VIRULENCE 2016, VOL. 7, NO. 7, 789–805 http://dx.doi.org/10.1080/21505594.2016.1192743

RESEARCH PAPER

Pathophysiological mechanisms of diarrhea caused by the Vibrio cholerae O1 El Tor variant: an in vivo study in mice Saravut Satitsria,#, Pawin Pongkorpsakolb,#, Potjanee Srimanotec, Varanuj Chatsudthiponga,d,e, and Chatchai Muanprasata,b,d,e a Department of Physiology, Faculty of Science, Mahidol University, Ratchathewi, Bangkok, Thailand; bGraduate Program in Translational Medicine, Research Center, Faculty of Medicine, Ramathibodi Hospital, Mahidol University, Ratchathewi, Bangkok, Thailand; cGraduate Studies, Faculty of Allied Health Science, Thammasat University, Rangsit, Prathumthani, Thailand; dExcellent Center for Drug Discovery, Faculty of Science, Mahidol University, Ratchathewi, Bangkok, Thailand; eCenter of Excellence on Medical Biotechnology (CEMB), S&T Postgraduate Education and Research Development Office (PERDO), Ministry of Education, Bangkok, Thailand

ABSTRACT

Cholera is caused by infection with Vibrio cholerae. This study aimed to investigate the pathophysiology of diarrhea caused by the V. cholerae O1 El Tor variant (EL), a major epidemic strain causing severe diarrhea in several regions. In the ligated ileal loop model of EL-induced diarrhea in the ICR mice, a cystic fibrosis transmembrane conductance regulator (CFTR) inhibitor and a calciumactivated chloride channel (CaCC) inhibitor similarly inhibited intestinal fluid secretion. In addition, barrier disruption and NF-kB-mediated inflammatory responses, e.g., iNOS and COX-2 expression, were observed in the infected ileal loops. Interestingly, intestinal fluid secretion and barrier disruption were suppressed by NF-kB and COX-2 inhibitors, whereas an iNOS inhibitor suppressed barrier disruption without affecting fluid secretion. Furthermore, EP2 and EP4 PGE2 receptor antagonists ameliorated the fluid secretion in the infected ileal loops. The amount of cholera toxin (CT) produced in the ileal loops by the EL was »2.4-fold of the classical biotype. The CT transcription inhibitor virstatin, a toll-like receptor-4 (TLR-4) antibody and a CT antibody suppressed the ELinduced intestinal fluid secretion, barrier disruption and COX-2 expression. The CT at levels detected during EL infection induced mild intestinal barrier disruption without inducing inflammatory responses in mouse intestine. Collectively, this study indicates that CT-induced intestinal barrier disruption and subsequent TLR-4-NF-kB-mediated COX-2 expression are involved in the pathogenesis of EL-induced diarrhea and represent promising novel therapeutic targets of cholera.

Introduction Cholera is a severe watery diarrhea caused by intestinal infection with the Gram-negative bacterium Vibrio cholerae. Annually, hundreds of thousands of cholera cases have been reported with an overall case mortality rate of »1–2%.1 The principal virulence factor of V. cholerae is cholera toxin (CT), which is composed of an enzymatic (A) subunit and 5 binding (B) subunits. After binding of its B subunit to GM1 ganglioside receptors located in the apical membrane of intestinal epithelial cells (IEC), CT is internalized and the CT A subunit is released into the cytosol, where it induces intracellular cAMP generation enabling cAMP-mediated intestinal fluid secretion.2 The majority of cholera outbreaks were caused by V. cholerae serotype O1, which is divided into classical (CL)

ARTICLE HISTORY

Received 11 January 2016 Revised 15 May 2016 Accepted 16 May 2016 KEYWORDS

CFTR; cholera; diarrhea; inflammation; El Tor variant; PGE2; Vibrio cholera

and El Tor (ET) biotypes. There have been 7 cholera pandemics since 1817. The CL biotype caused the first 6 cholera pandemics, while ET biotype caused the seventh pandemic, which began in 1961 on Sulawesi Island, Indonesia.3,4 The 2 biotypes differ in that the CL biotype generally causes more severe diarrhea because it produces higher amounts of CT, while the ET biotype has the greater ability to survive in the environment and cause infection.1 However, in 1982, a classical biotype reemerged in Bangladesh.4 Co-existence of the 2 biotypes promoted an emergence of a mixed biotype i.e., El Tor variant (EL), which was first isolated in 2002 in Bangladesh and recently caused several cholera outbreaks worldwide.5,6 In addition to exhibiting ET phenotypes, the EL carries a gene sequence encoding the CT B

CONTACT Chatchai Muanprasat, MD, Ph.D [email protected] Department of Physiology, Faculty of Science, Mahidol University, Rama VI Road, Ratchathewi, Bangkok 10400, Thailand. Color versions of one or more of the figures in this article can be found online at www.tandfonline.com/kvir. # These authors equally contributed to this work. Supplemental data for this article can be accessed on the publisher’s website. © 2016 Taylor & Francis

790

S. SATITSRI ET AL.

subunit (ctxB) of the CL biotype.5 Of note, patients infected with the EL usually develop more severe diarrhea and dehydration than those infected with either the CL or ET strain.7-9 Interestingly, it has been shown that the amount of CT produced by the EL is > 10 times higher than that by the CL or the ET strain in rabbit ileal loops.10 The higher amount of CT production is thought to explain, at least in part, the severe diarrheal symptoms caused by the EL. Intestinal fluid secretion is primarily driven by transepithelial Cl- secretion, which is triggered by the elevation of intracellular cAMP or Ca2C.11 Cystic fibrosis transmembrane conductance regulator (CFTR) and Ca2C-activated Cl- channel (CaCC) are the 2 principal routes for Cl- efflux across the apical membrane of IEC following cAMP or Ca2C stimulation.12 CT elevates intracellular cAMP and subsequently elicits CFTRmediated Cl- secretion and the inhibition of electroneutral NaCl absorption.13 This, in turn, causes net fluid secretion resulting in secretory diarrhea. Using the CL, our group established an adult mouse ligated ileal model of V. cholerae-induced diarrhea.14 We demonstrated that the intestinal fluid secretion induced by the CL was not associated with intestinal barrier disruption and completely abrogated by the CFTR inhibitor CFTRinh-172. Intestinal fluid secretion can also be promoted by intestinal inflammation, in which proinflammatory mediators enhance intestinal fluid secretion directly via their prosecretory effects or indirectly via the leak flux mechanism as a result of intestinal barrier leakage.11,15 Recently, it has been shown that V. cholerae El Tor Ogawa induces the mucosal innate immune response in humans via mechanisms involving tolllike receptor-4 (TLR-4)-mediated nuclear factor kappa B (NF-kB) activation.16,17 Likewise, exposure to V. cholerae provokes NF-kB-mediated inflammatory responses in cultured IEC18 Since EL strain causes severe diseases, this study aimed to investigate the pathogenesis of the EL in comparison with CL strain using the adult mouse closed loop model of V. cholerae infection. We demonstrated that EL induced intestinal fluid secretion and barrier disruption via mechanisms involving NF-kB-mediated inflammation.

Results CFTR and CaCC-mediated intestinal fluid secretion and intestinal barrier disruption in an adult mouse model of EL-induced diarrhea To establish an adult mouse model of EL-induced diarrhea, different amounts of the EL were inoculated into

closed ileal loops. Fluid secretion was evaluated using the loop weight/length ratio 12 h post-inoculation.14 As shown in the Fig S1, the maximal fluid secretion was observed with an inoculation dose of 1 £ 105 CFU/ loop. Therefore, this amount of inoculum was used in subsequent experiments in this study. To investigate the contribution of CFTR-mediated fluid secretion to the EL-induced fluid secretion, CFTRinh-172 (20 mg) was intraperitoneally administered to mice in 2 doses 6 h apart. This dose of CFTRinh-172 has been shown to produce >90% inhibition of CFTR-mediated fluid secretion in mice.19 As shown in Figure 1A, CFTRinh-172 inhibited EL-induced intestinal fluid secretion by »50%. Since CaCC provides an alternative pathway for intestinal Cl- secretion,20 involvement of CaCC-mediated fluid secretion was investigated using CaCCinh-A01 (34 mg; every 6 h). CaCCinh-A01 at this dose has previously been shown to fully inhibit CaCC in mouse intestine.21 As depicted in Figure 1A, CaCCinh-A01 inhibited EL-induced fluid secretion by »50%. Interestingly, a combined treatment of CFTRinh-172 and CaCCinh-A01 suppressed ELinduced fluid secretion by »95%. These results indicate that CFTR and CaCC contribute equally to mediate Cl--driven fluid secretion during EL infection. Intestinal fluid secretion induced by the CL was completely inhibited by CFTRinh-172 and was unaffected by CaCCinhA01, which is consistent with our previous work,14 (Fig. 1A). In addition, the effect of EL infection on intestinal barrier integrity was investigated using measurements of trans-intestinal fluorescien isothiocyanate (FITC)-dextran (4 kDa) flux in vivo. As shown in Figure 1B, FITC-dextran flux was increased in the ELinfected group and unaltered in the CL-infected group. These results indicate that EL infection was associated with intestinal barrier disruption. A combined treatment of CFTRinh-172 and CaCCinh-A01 had no effect on the EL-induced FITC-dextran flux (Fig. 1B), indicating that the EL-induced barrier leakage is not a consequence of the mechanical stress within the expanded ligated ileal loops. Inflammatory responses in intestinal tissues of EL-infected mice To determine the inflammatory response to the EL infection, NF-kB translocation into the nucleus and the expression of proinflammatory mediators were analyzed in the EL-infected ileal loops. As shown in Figure 2A, the EL significantly induced NF-kB nuclear translocation, indicating activation of NF-kB signaling in mouse intestine. Likewise, quantitative real-time PCR of intestinal tissues demonstrated that the EL infection induced a

VIRULENCE

791

Figure 1. Roles of CFTR and CaCC in EL-induced intestinal fluid secretion and the effect of EL infection on intestinal barrier disruption. (A) Contribution of CFTR and CaCC to EL-induced intestinal fluid secretion. Ileal loops were inoculated with EL or CL (105 CFU/loop) with or without intraperitoneal administration of CFTRinh-172, CaCCinh-A01 or CFTRinh-172 plus CaCCinh-A01. At 12 h after bacterial challenge, ileal loops were removed for measurements of loop weight/length ratio. Data are expressed as means of weight/length ratio § SEM  , p < 0.001 compared with PBS-instilled group; ###, p < 0.001 compared with EL-infected group; DD, p < 0.01 compared with CLinfected group using one-way ANOVA with Tukey’s post hoc test (n D 4–9 mice per group). (B) Effect of EL infection on intestinal barrier function. At 12 h after inoculation with EL with or without CFTRinh-172 plus CaCCinh-A01 or CL, FITC-dextran flux assays were performed. Data are expressed as means of FITC-dextran concentrations § SEM. , p < 0.001 compared with PBS-instilled group; ##, p < 0.01 compared with CL-infected group; NS, non-significant, using one-way ANOVA with Tukey’s post hoc test. (n D 4–10 mice per group).

significant upregulation in the mRNA expression of proinflammatory cytokines including TNF-a, IL-1b, IL6 and IL-8 (Figure 2B). Interestingly, the effects of the EL on both nuclear translocation of NF-kB and proinflammatory cytokine expression were higher than that of the CL, which is not significantly different from the noninfected group.

Intestinal inflammation is known to be associated with the upregulated expression of inducible nitric oxide synthase (iNOS) and cyclooxygenase 2 (COX2), which play important roles in the regulation of intestinal Cl- secretion and barrier integrity via the actions of their products, nitric oxide (NO) and prostaglandin E2 (PGE2), respectively.22 Therefore, protein

792

S. SATITSRI ET AL.

Figure 2. Effect of EL infection on the inflammatory response in mouse intestine. (A) Effect of EL on nuclear translocation of phosphorylated NF-kB. Expressions of phosphorylated NF-kB (p65) in cytosolic fractions and nuclear fractions were analyzed using western blot analysis. Data are expressed as the mean of relative band intensity § SEM. NS, non-significant; , p < 0.01;  , p < 0.001 compared with PBS-instilled group; #, p < 0.05 compared with CL-infected group (n D 7 mice per group). b-actin and Lamin B1 were used as loading controls of cytosolic fraction and nuclear fraction, respectively. (B) Relative mRNA expression of proinflammatory cytokines analyzed by real-time quantitative PCR. Results are normalized to GAPDH mRNA levels. Data are expressed as fold changes over control § SEM. NS, non-significant; , p < 0.01; , p < 0.001 compared with PBSinstilled group; #, p < 0.05 compared with CL-infected group (n D 4–10 samples per group). (C) Protein expressions of iNOS and COX-2 analyzed by protein gel blot analysis. Data are expressed as the mean of relative band intensity § SEM. NS, non-significant; , p < 0.01 compared with PBS-instilled group; #, p < 0.05 compared with CL-infected group (n D 4–6 mice per group). Statistical analysis was performed using one-way ANOVA with Tukey’s post hoc test.

VIRULENCE

expression of iNOS and COX-2 was investigated in intestinal tissues using western blot analysis. As shown in Figure 2C, expression of iNOS and COX-2 was significantly increased in EL-infected ileal loops compared with non-infected tissues. In contrast, the CL did not significantly affect iNOS and COX-2 expression in mouse intestine.

Roles of NO and PGE2 in the pathogenesis of EL-induced diarrhea Since NO and PGE2 are important modulators of intestinal ion transport and barrier function,23,24 we hypothesized that NF-kB-mediated expression of iNOS and COX-2 may contribute to the pathogenesis of ELinduced diarrhea through the effects of NO and PGE2. Therefore, the effects of BAY 11-7082 (NF-kB inhibitor, 20 mg/kg, i.p.), aminoguanidine (AG, iNOS inhibitor, 35 mg/kg, i.p.) and rofecoxib (COX-2 inhibitor, 10 mg/ kg, i.p.) on EL-induced intestinal fluid secretion and barrier disruption were investigated. As shown in Figure 3A, EL-induced fluid secretion was almost completely inhibited by BAY 11-7082 and rofecoxib, and unaffected by AG. As analyzed by FITC-dextran flux assays, EL-induced intestinal barrier disruption was markedly suppressed by treatment with BAY 11-7082, AG and rofecoxib (Fig. 3B). Interestingly, BAY 11-7082 treatment suppressed EL-induced expression of iNOS and COX-2 in intestinal tissue (Fig. 3C). In addition, AG treatment reduced iNOS and COX-2 expression (Fig. 3C). This observation may be ascribed to the inhibitory effect of AG on iNOS expression25 and the role of NO in sustaining NF-kB activation.26 Figure 3D and E demonstrated that BAY 11-7082 suppressed levels of NO and PGE2 in the intestinal tissues of EL-infected mice. Likewise, EL-induced production of NO and PGE2 was effectively inhibited by AG and rofecoxib, respectively. In addition, microscopic and ultrastructural analyses of mouse intestine were performed. Microscopic evaluation using H&E staining demonstrated that EL-infected mouse intestine demonstrated a severe dilated lacteal pattern, extended submucosa, congested blood vessels and villus blunting (Fig. 4A). Interestingly, these signs of severe inflammatory responses were suppressed by treatment with BAY 11-7082, AG and rofecoxib (Fig. 4A). In addition, transmission electron microscopy was employed to analyze the integrity of tight junctions. Of note, intestinal tissues of EL-infected mice exhibited widening of the apical intercellular space, indicating the disruption of tight junctions (Fig. 4B). In addition, dramatic loss of microvilli was observed in the EL-infected mice (Fig. 4B). These structural abnormalities were prevented

793

by treatment with BAY 11-7082, AG and rofecoxib (Fig. 4B). EP2 and EP4 receptors of PGE2 are involved in EL-induced intestinal fluid secretion It has been shown that PGE2 induces Cl- secretion across IEC via EP2 and EP4 receptor-mediated intracellular cAMP elevation.24,27 Based on the fact that EL-induced intestinal fluid secretion is suppressed by COX-2 inhibitor rofecoxib, we hypothesized that the EP2 and EP4 receptors may be involved in EL-induced intestinal fluid secretion. As shown in Figure 5A, EL-induced intestinal fluid secretion was markedly inhibited by AH-6809 (EP2 receptor antagonist, 5 mg/kg, i.p.) and L-161982 (EP4 receptor antagonist, 10 mg/kg, i.p.). It has also been demonstrated that crosstalk between cAMP and Ca2C signaling exists in IEC, i.e., cAMP signaling is associated with elevation of intracellular Ca2C levels.28 To investigate the presence of this signaling crosstalk during EL infection, we analyzed the expression of phosphorylated Ca2C/calmodulin-dependent protein kinase II (p-CaMKII), a Ca2C-sensitive protein kinase involved in CaCC activation in IEC,29 in mouse intestinal tissues using protein gel blot analysis. EL infection was associated with enhanced phosphorylation of CaMKII (Fig. 5B), which was suppressed by either AH-6809 or L-161982. These findings indicate that the EP2 and EP4 receptors are involved in EL-induced intestinal fluid secretion through pathways involving crosstalk between cAMP and Ca2C signaling. Contribution of CT and TLR-4-mediated inflammation in EL-induced diarrhea It has been suggested that elevated CT production might account for the increased severity of diarrhea caused by EL infection.10 In addition, CT disrupts intestinal tight junction integrity,30 and CT and V. cholerae activate the immune response via a toll-like receptor 4 (TLR-4),16,31 which is expressed in both intestinal epithelial cells and immune cells.32,33 Therefore, we hypothesized that the EL induces intestinal fluid secretion and barrier disruption via a mechanism involving CT-TLR-4-mediated inflammatory responses (i.e., iNOS and COX-2 upregulation). Of note, the amounts of CT in the EL- and CLinfected ileal loops were »66.8 mg/mL and 28.1 mg/mL, respectively. Interestingly, intraluminal administration of virstatin (1.50 mg/mL), an inhibitor of CT expression, and TLR-4 antibodies (1:100 dilution) significantly reduced EL-induced intestinal fluid secretion (Fig. 6A) and barrier leakage (Fig. 6B). Similarly, EL-induced COX-2 expression was significantly suppressed by either

794

S. SATITSRI ET AL.

Figure 3. Role of NF-kB-mediated iNOS and COX-2 expression in EL-induced fluid secretion and barrier disruption in mouse intestine. Mouse ileal loops were inoculated with EL with or without intraperitoneal administration of NF-kB inhibitor BAY 11-7082 (BAY), iNOS inhibitor aminoguanidine (AG), or COX-2 inhibitor rofecoxib (Rof). At 12 h post-inoculation, ileal loops were removed for measurements of loop weight/length ratio and biochemical assays, or subjected to measurements of FITC-dextran flux. (A) Intestinal fluid secretion measured from loop weight/length ratio. Data are expressed as means of weight/length ratio § SEM , p< 0.001 compared with PBSinstilled group; ###, p < 0.001 compared with EL-infected control group (n D 4–9 mice per group). (B) Intestinal barrier function measured by FITC-dextran flux. Data are expressed as means of FITC-dextran concentrations § SEM , p < 0.001 compared with PBSinstilled group; #, p < 0.05; ##, p < 0.01 compared with EL-infected control group (n D 4–10 mice per group). (C) Protein expressions of iNOS and COX-2 analyzed by western blot analysis. A representative immunoblot of 5 mice is shown. (D) Measurements of NO in mouse intestinal tissues using Griess test. Data are expressed as means of NO concentrations § SEM , p < 0.05 compared with PBSinstilled group; #, p < 0.05; ##, p < 0.01 compared with EL-infected control group (n D 5–8 mice per group). (E) Measurements of PGE2 in mouse intestinal tissues using ELISA. Data are expressed as means of PGE2 concentrations § SEM , p < 0.01 compared with PBSinstilled group; ##, p < 0.01; ###, p < 0.001 compared with EL-infected control group (n D 3–5 mice per group). Statistical analysis was performed using one-way ANOVA with Tukey’s post hoc test.

virstatin or TLR-4 antibodies (Fig. 6C). The EL-induced iNOS upregulation was suppressed by virstatin, but not by TLR-4 antibodies (Fig. 6C), indicating that EL induces iNOS expression via TLR-4-independent pathways.

To confirm the role of CT in the pathogenesis of the EL-induced intestinal fluid secretion and barrier disruption, CT was neutralized using horse anti-CT neutralizing antibodies (1:100 dilution). Administration of CT

VIRULENCE

795

Figure 4. Histological and ultrastructural analyses of mouse intestine following EL infection. Mouse ileal loops were inoculated with EL with or without intraperitoneal administration of NF-kB inhibitor BAY 11-7082 (BAY), iNOS inhibitor aminoguanidine (AG), or COX-2 inhibitor rofecoxib (Rof). At 12 h post-inoculation, ileal loops were removed for histological and ultrastructural examinations. (A) Representative images of hematoxylin and eosin-stained tissues (upper panel, 40X; lower panel, 80X). Green arrow indicates dilated lacteal pattern. Orange asterisk indicates extended submucosa. Blue arrow indicates congested blood vessels. (n D 4 mice per group) (B) Representative images acquired from transmission electron microscope. Red arrow indicates irregular tight junctions. Black arrow indicates normal structure of tight junction (n D 4 mice per group)

antibodies significantly suppressed EL-induced fluid secretion (Fig. 7A), barrier disruption (Fig. 7B), and iNOS and COX-2 expression (Fig. 7C). Isotype control experiments showed that the horse IgG had no effect on intestinal fluid secretion and barrier integrity (data not shown). Furthermore, the effects of a purified classical CT, which contains similar amino acid sequences to that of EL, on intestinal fluid secretion, barrier integrity and inflammatory responses were investigated. The CT at

doses ranging from 10 mg/mL to 100 mg/mL was used to replicate the amount of CT detected in the EL-infected ileal loops. As shown in Fig. 8A, CT at all doses induced significant intestinal fluid secretion. In addition, CT dose-dependently induced modest intestinal barrier leakage (Fig. 8B). The barrier-disrupting effects of CT at 50 mg/mL and 100 mg/mL were »10 and 5 folds less than that of EL. Interestingly, CT at 50 mg/mL, which is approximated to the level in EL-infected loops, had no

796

S. SATITSRI ET AL.

Figure 5. Involvement of EP2 and EP4 receptors of PGE2 in mediating intestinal fluid secretion and crosstalk to calcium signaling during EL infection. Mouse ileal loops were inoculated with EL with or without intraperitoneal administration of EP2 PGE2 antagonist AH-6809 or EP4 PGE2 antagonist L-161982. At 12 h post-inoculation, ileal loops were removed for measurements of loop weight/length ratio or protein gel blot analysis. (A) Intestinal fluid secretion measured from loop weight/length ratio. Data are expressed as means of weight/ length ratio § SEM , p < 0.001 compared with PBS-instilled group; ###, p < 0.001 compared with EL-infected control group (n D 5– 8 mice per group). (B) Effect on CaMKII phosphorylation. Western blot analysis of lysates of mouse intestinal tissues was performed using antibodies against phosphorylated CaMKII (p-CaMKII). Data are expressed as means of relative band intensity § SEM , p < 0.01 compared with PBS-instilled group; ###, p < 0.001 compared with EL-infected control group (n D 3–4 mice per group). Statistical analysis was performed using one-way ANOVA with Tukey’s post hoc test.

significant effect on iNOS and COX-2 expression 3 h and 6 h post-treatment (Fig. 8C). LPS from Escherichia coli was used as a positive control in this experiment. These results suggest that the pathogenesis of EL-induced intestinal fluid secretion and intestinal barrier disruption involves CT-induced intestinal barrier leakage with subsequent upregulation of iNOS and COX-2 expression through TLR-4-independent and dependent pathways, respectively.

Discussion It has been observed that the EL, which is currently the common circulating strain of V. cholerae, causes more severe diarrhea than either the CL or the ET strains of V. cholerae. In this study, the pathophysiological mechanisms of the EL-induced diarrhea were investigated in an adult mouse closed loop model of V. cholerae infection. Interestingly, we demonstrated that the mechanisms by

which EL induces diarrhea are distinct from that of the CL in that its intestinal fluid secretion is driven by both CFTR and CaCC-mediated Cl- secretion and is accompanied by barrier disruption. Furthermore, our findings indicate that CT-induced intestinal barrier disruption and NF-kB-mediated intestinal inflammatory responses, especially the upregulation of iNOS and COX-2 expression, underlies the intestinal fluid secretion and barrier leakage observed in EL-infected mice. The EL has been shown to cause recent cholera outbreaks with more severe diarrheal symptoms. In addition to producing higher levels of CT, the EL exhibited higher virulence in an infant mouse cholera model than either the CL or ET biotypes.34 In our study, we demonstrated that EL-induced fluid secretion was equally inhibited (»50%) by CFTRinh-172 and CaCCinh-A01, and it was completely abolished by the combined treatments. In contrast, CL-induced fluid secretion was completely inhibited by CFTRinh-172. These results indicate that Clsecretion through both CFTR and CaCC provides the

VIRULENCE

797

Figure 6. Role of CT expression and TLR-4 in mediating EL-induced fluid secretion and barrier disruption in mouse intestine. Mouse ileal loops were inoculated with EL with or without virstatin (inhibitor of CT expression) or TLR-4 antibodies. At 12 h post-inoculation, ileal loops were removed for measurements of loop weight/length ratio or western blot analysis, or subjected to FITC-dextran flux assays. (A) Intestinal fluid secretion measured from loop weight/length ratio. Data are expressed as means of weight/length ratio § SEM , p< 0.001 compared with PBS-instilled group; #, p < 0.05; ##, p < 0.01 compared with EL-infected control group (n D 5–8 mice per group). (B) Intestinal barrier function measured by FITC-dextran flux assays. Data are expressed as means of FITC-dextran concentrations § SEM  , p < 0.001 compared with PBS-instilled group; #, p < 0.05; ###, p < 0.001 compared with EL-infected control group (n D 4–7 mice per group). (C) iNOS and COX-2 expressions analyzed by protein gel blotting. Data are expressed as means of relative band intensity § SEM , p < 0.01; , p < 0.001 compared with PBS-instilled group; #, p < 0.05; ##, p < 0.01; ###, p < 0.001 compared with EL-infected control group (n D 4–6 mice per group). Statistical analysis was performed using one-way ANOVA with Tukey’s post hoc test.

driving force for fluid secretion during the EL infection, whereas CL-induced fluid secretion is driven mainly by CFTR-mediated Cl- secretion. Indeed, it has previously been shown that, compared with stimulation of a single pathway, activation of both cAMP and Ca2C signaling pathways results in a synergistic enhancement of Clsecretion, partly due to increased apical Cl- permeability and the increased driving force resulting from the opening of more basolateral KC channels.35,36 Therefore, we speculate that enhanced Cl- secretion may account for the severe diarrheal symptoms in patients infected with the EL. In addition, our findings demonstrated that EL

infection was accompanied by intestinal barrier disruption. Indeed, intestinal barrier disruption can promote diarrhea through the leak flux mechanism, in which tight junction leakage of intestinal epithelia allows the movement of water and ions into the intestinal lumen. Taken together, our results suggest that both enhanced Clsecretion and intestinal barrier disruption may account for the severe diarrhea and intestinal fluid loss in patients infected with the EL. Inhibition of NF-kB abolished EL-induced intestinal fluid secretion and barrier disruption, suggesting that the inflammatory responses play a central role in the

798

S. SATITSRI ET AL.

Figure 7. Attenuation of EL-induced fluid secretion, barrier disruption and expression of iNOS and COX-2 in mouse intestine through CT neutralization. Mouse ileal loops were inoculated with EL with or without CT antibodies (CT Ab). At 12 h post-inoculation, ileal loops were removed for measurements of loop weight/length ratio or western blot analysis, or subjected to FITC-dextran flux assays. (A) Intestinal fluid secretion measured from loop weight/length ratio. Data are expressed as means of weight/length ratio § SEM , p < 0.05; , p < 0.001 compared with PBS-instilled group; #, p < 0.05 compared with EL-infected control group (n D 5–8 mice per group). (B) Intestinal barrier integrity measured by FITC-dextran flux assays. Data are expressed as means of FITC-dextran concentrations § SEM , p < 0.001 compared with PBS-instilled group; #, p < 0.05 compared with EL-infected control group (n D 4–7 mice per group). (C) Expressions of iNOS and COX-2 analyzed by protein gel blotting. Data are expressed as means of relative band intensity § SEM , P < 0.05, , p < 0.01; , p < 0.001 compared with PBS-instilled group; ##, p < 0.01 compared with EL-infected control group (n D 3–5 mice per group). Statistical analysis was performed using one-way ANOVA with Tukey’s post hoc test.

pathogenesis of diarrhea caused by the EL. Compared with the CL, the EL induced more inflammatory responses characterized by higher expression of proinflammatory cytokines and mediators. It is noteworthy that CT has been shown to disrupt intestinal barrier integrity in mice via the inhibition of Rab11-mediated tight junction assembly through GM1 receptor-dependent cAMP signaling pathway.30 We found that inhibition of CT using virstatin or CT antibodies, and inhibition of TLR-4 using TLR-4 antibodies abrogated

the intestinal fluid secretion and barrier disruption induced by the EL. In addition, we found that COX-2 and iNOS expression was suppressed by CT inhibition, whereas TLR-4 antibodies inhibited COX-2 expression without affecting iNOS expression. These data indicate that EL induces COX-2 and iNOS expression via TLR-4dependent and TLR-4-independent mechanisms, respectively. The purified CT at 50 mg/mL and 100 mg/mL, which is comparable to that produced by EL in the closed ileal loops (66.8 mg/mL), induced modest intestinal

VIRULENCE

799

Figure 8. Effect of purified CT on intestinal fluid secretion, barrier disruption and expression of iNOS and COX-2 in mouse intestine. Mouse ileal loops were instilled with PBS or PBS containing 10 mg/mL, 50 mg/mL or 100 mg/mL of CT. At 12 h post-treatment, ileal loops were removed for (A) measurements of loop weight/length ratio and (B) FITC-dextran flux assays. Data are expressed as means § SEM , p< 0.05; , p < 0.01; , p < 0.001 compared with PBS-instilled group (n D 4 mice per group). (C) Effect of CT on expression of iNOS and COX-2. Mouse ileal loops were instilled with PBS with or without CT (50 mg/mL). Three or 6 hours later, ileal loops were removed for measurements of iNOS and COX-2 expression using western blot analysis. A representative immunoblot is shown. LPS (0.4 mg/mL, 6-h exposure) was used as a positive control. Data are expressed as means of relative band intensity § SEM. NS, non-significant; , p < 0.05 compared with PBS-instilled group (n D 4 mice per group). Statistical analysis was performed using one-way ANOVA with Tukey’s post hoc test.

barrier disruption without affecting the proinflammatory responses including iNOS and COX-2 expression. In light of the aforementioned findings, the pathogenesis of the EL-induced diarrhea may be initiated by a CTinduced intestinal barrier defect via the classical GM1 receptor-cAMP signaling pathway, followed by translocation of virulence factors into the intestinal submucosa and, subsequently, activation of NF-kB-mediated inflammatory responses. TLR-4 is expressed in the basolateral membrane of IEC and in immune cells, and is known to recognize bacterial LPS.32,33 Therefore, it is speculated that the translocated LPS may activate TLR-4 in both IEC and immune cells, causing the inflammatory responses especially upregulation of COX-2 expression.

The increase in iNOS expression may be induced by other EL-derived virulence factors including flagellin, which has previously been shown to induce NF-kB activation and IL-8 production in IEC via toll-like receptor537. Notably, we previously found that the CL does not affect intestinal barrier integrity despite its CT production.14 The difference in pathophysiology of these 2 strains of V. cholerae may be explained, at least in part, by the difference in levels of CT production, which was »2.4-fold higher by the EL compared with the CL. In agreement with this notion, previous studies have demonstrated that the amount of CT produced by EL was »10 times higher than that by CL and ET strains and that ctxAB operon of EL is similar to that of CL.10,34

800

S. SATITSRI ET AL.

Therefore, we speculate that the observed differences in diarrheal pathogenesis of these 2 strains of V. cholerae may not be due to the inherent difference of CT molecules, but may be resulted from the difference in levels of CT expression. This notion warrants future investigation using different doses of CT purified from different strains of V. cholerae. Indeed, the inflammatory properties of CT have already been demonstrated in both immune cells and epithelial cells31,38,39; for example, CT feeding activated canonical NF-kB (one heterodimer type, p50-p65) and mRNA expression of NF-kB-dependent proinflammatory cytokines in mesenteric lymph node and Peyer’s patch cells. Not only GM1, but also TLR–4 and other receptors interact with CT B subunit.31,40 Contribution of these receptors warrants further investigation. In this study, TLR–4-NF-kB signaling is found to play an important role in the pathogenesis of diarrhea, inflammation, and barrier disruption in response to EL inoculation. The TLR–4-NF-kB signaling can be induced by a variety of microbial products and endogenous components released during tissue damages; for example, LPS, CT, Mrp8, Mrp14, HMGB1, histone components and cold-inducible RNA-binding protein.31 Inflammatory responses were observed in response to live bacteria EL, but not purified CT. This discrepancy might be that duration of host responses to purified toxin might be shorter; starting from few minutes to few hours and gradually decline to the baseline. In contrast, inoculated live bacteria CL might take longer times to adapt, colonize, grow, and produce toxin when compared to EL strain. CL-derived toxin at the same amount of ELderived toxin may induce inflammation and barrier damages. This possibility could not be excluded. Further investigation is required to conduct experiments in a time and dose-dependent manner for each stimulus. The present study also reveals the important role of iNOS and COX-2 in mediating EL-induced fluid secretion and barrier disruption. The EL-induced intestinal fluid secretion was markedly suppressed by either the COX-2 inhibitor rofecoxib or EP2/EP4 receptor antagonists. These results indicate that PGE2 derived from COX-2 induces intestinal fluid secretion through the EP2 and EP4 receptors. Interestingly, we found that the EL infection induced CaMKII phosphorylation in mouse intestine and that this effect was suppressed by treatment with EP2 or EP4 receptor antagonists. It is known that EP2 and EP4 receptors signal through cAMP pathways in IEC.27 This suggests that the EL-induced CaMKII phosphorylation results from the crosstalk from cAMP to Ca2C signaling in IEC.28 In addition, our findings lead to the implication that, during EL infection, EP2 and

EP4 receptor stimulation by PGE2 results in CFTR and CaCC-mediated Cl- secretion through cAMP and Ca2C-dependent signaling pathways. In addition, it was observed that inhibition of either iNOS or COX2 prevented EL–induced intestinal barrier disruption. This observation is consistent with findings from other studies identifying the role of iNOS and COX-2 in mediating intestinal barrier disruption during infection by enteroinvasive E. coli, Salmonella dublin or rotavirus.22,41 Of particular interest, AG suppressed iNOS and COX-2 expression in the EL-infected intestine. This effect is consistent with previous observations that AG reduces iNOS mRNA expression25 and that NO sustains NF-kB activation.26 The latter may account for the inhibitory effect of AG on COX-2 expression. However, measurements of NO and PGE2 demonstrated that AG and rofecoxib selectively suppressed levels of NO and PGE2, respectively, and that BAY 11-7082 suppressed both NO and PGE2. These results indicate that AG has an insignificant effect on PGE2 production. The EL-induced intestinal fluid secretion is mediated by PGE2, whereas the ELinduced intestinal barrier leakage is resulted from both NO and PGE2. In addition, our findings suggest that COX-2 inhibitors and PGE2 EP2/EP4 receptor antagonists may be of therapeutic value in the treatment of EL-induced diarrhea. This notion warrants further investigations using both animal and human models. One of the limitations of the closed ileal loop model is the possible effect of mechanical stress within the distended ileal loops on disrupting intestinal barrier integrity. However, our results showed that the complete inhibition of intestinal fluid accumulation by a combined treatment of CFTRinh-172 and CaCCinh-A01 did not significantly affect the degree of EL-induced intestinal barrier disruption. This finding suggests that the ELinduced intestinal barrier disruption does not result from the mechanical stress within the distended ileal loops. Nonetheless, our findings require confirmation in other animal models e.g. infant rabbit non-ligated ileal loop model of cholera. In conclusion, in an adult mouse model of ELinduced diarrhea, the pathophysiological mechanisms of intestinal fluid secretion and intestinal barrier disruption involve the CT-induced intestinal barrier disruption and subsequent LPS-TLR-4-NF-kB-mediated expression of COX-2. Both CFTR and CaCC mediate Cl--derived intestinal fluid secretion via PGE2-induced EP2/EP4 receptor activation. Intestinal barrier disruption is due to the effects of NO and PGE2 produced by iNOS and COX-2 (Fig. 9). These findings may explain the mechanisms underlying the severe diarrheal symptoms of

VIRULENCE

801

Figure 9. Illustration of pathophysiological mechanisms of EL-induced intestinal fluid secretion and intestinal barrier disruption in mice. (1) EL produces CT, which induces intestinal barrier disruption. (2) LPS derived from EL translocates to the serosal side of intestinal epithelial cells (IEC) and binds to TLR-4 in both IEC and immune cells. (3) NF-kB activation leads to COX-2 expression and increased PGE2 production. (4) PGE2 binds to EP2 and EP4 receptors on IEC, resulting in generation of intracellular cAMP. (5) Intracellular cAMP elevation together with crosstalk to the Ca2C-dependent signaling pathway induces intestinal Cl- secretion via CFTR and CaCC, and causes intestinal barrier disruption. In addition, NO derived from NF-kB-mediated iNOS expression is involved in EL-induced intestinal barrier disruption.

patients infected with EL and provide a rational basis for the development of novel therapeutic approaches for cholera especially inhibition of TLR-4-mediated NF-kB signaling and PGE2 antagonism.

Materials and methods Ethics statement This study has been approved by the Institutional Animal Care and Use Committee of the Faculty of Science,

Mahidol University (permit number 318). This study was performed in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health, USA. Materials CFTRinh-172, CaCCinh-A01 and BAY 11-7082 were purchased from Calbiochem (Darmstadt, Germany). Aminoguanidine, Rofecoxib, L-161982 and AH-6809 were from Sigma-Aldrich (St. Louis, MA, USA).

802

S. SATITSRI ET AL.

Virstatin was purchased from Santa Cruz (Dallas, TX, USA). TLR-4 neutralizing antibody was purchased from InvivoGen (San Diego, CA, USA). Horse antiCT neutralizing antibody was kindly provided by the Chemo-Sero-Therapeutic Research Institute (KAKETSUKEN) of Kumamoto, Japan. Purified CT (V. cholerae 569B Inaba) and LPS from Escherichia coli 0157: H7 were obtained from List Biological Laboratories, Inc. (Campbell, CA, USA). Culture of Vibrio cholerae V. cholerae 569B Inaba (Classical O1 strain; designated as “CL”) and V. cholerae G27875 Ogawa (El Tor variant O1 strain; designated as “EL”) were used in this study.6 They were cultured, and the inoculum was prepared as described previously.14 Mouse model of cholera Six-week-old male ICR outbred mice (30–35 g) were acquired from the National Laboratory Animal Center, Bangkok, Thailand. The mouse model of V. choleraeinduced diarrhea was generated as previously described.14 Briefly, the closed ileal loop was inoculated with 0.1 mL of phosphate buffered saline (PBS), PBS containing CL (105 CFU/loop) or the EL (105 CFU/loop or otherwise indicated) with/without administration of the indicated treatments. The dosages for inhibitor/antibody treatments were selected based on their effectiveness and safety profiles reported in previous studies.19,42-47 In some experiments, 0.1 mL of PBS containing the purified CT at 10 mg/mL, 50 mg/mL, or 100 mg/mL was instilled into the closed ileal loops. At 3 h, 6 h, or 12 h post-inoculation/ CT administration, the mice were re-anesthetized and ileal loops were removed for determining fluid secretion from measurements of weight/length ratio and for other analyses after removal of intestinal fluids. Assays of cholera toxin The amount of CT was measured using a GM1 enzymelinked immunosorbent assay as previously described.14 The quantity of CT in ileal loops was estimated from the curve of standard CT.

anesthetized. Intestinal fluid was removed and replaced with 0.2 mL of PBS containing 20 mg FITC-dextran. Thirty minutes later, blood from the mice was collected by cardiac puncture to determine the FITC-dextran concentration in plasma using a fluorospectrophotometer (Bio-Tek Instrument, Helsinki, Finland). Western blot analysis Mouse ileum was removed and homogenized in a lysis buffer containing 0.3 M sucrose, 25 mM imidazole and 1 mM EDTA, 1 mM PMSF and protease inhibitors (Roche, Basel, Switzerland). In some experiments, nuclear extraction was performed using a nuclear extraction kit (Thermo Scientific, Waltham, MA, USA). SDSpolyacrylamide gel electrophoresis was performed on fixed amounts of proteins, which were then transferred onto nitrocellulose membranes (Merck Millipore, Darmstadt, Germany). After blocking for 1 h with 5% non-fat dry milk or 5% bovine serum albumin, proteins were incubated overnight with rabbit iNOS monoclonal antibody (Cell signaling, Danvers, MA, USA), rabbit COX-2 monoclonal (Cell signaling, Danvers, MA, USA), rabbit phosphorylated CaMKII (Cell signaling, Danvers, MA, USA), rabbit phosphorylated NF-kB (Cell signaling, Danvers, MA, USA), rabbit Lamin B1 (Abcam, Cambridge, UK), or rabbit b-actin antibodies (Cell signaling, Danvers, MA, USA). Membranes were then washed with Tris-Boric Saline plus 0.05% Tween 20, incubated with anti-rabbit IgG conjugated to horseradish peroxidase (Abcam, Cambridge, UK), submerged with Luminata Forte Western HRP substrate (Merck Millipore, Darmstadt, Germany), and exposed to X-ray film. Band intensity was analyzed using Image J 1.49 software (National Institutes of Health, USA). Quantitative real-time PCR Mouse ileum was homogenized in Trizol (Thermo Scientific, Waltham, MA, USA). Isolated RNA was converted Table 1. Primer sequences used for mRNA expression analysis by quantitative real-time PCR. Gene

Primer sequence (50 –30 )

TNF-a

F R F R F R F R F R

In vivo measurement of intestinal barrier integrity

IL-1b

Intestinal barrier integrity was evaluated using fluorescein isothiocyanate (FITC)-dextran (molecular weight of 4 kDa) flux assays as previously described.14 Briefly, at 12 h after CT administration or inoculation with PBS, PBS containing CL (105 CFU/loop) or the EL (105 CFU/loop), mice were re-

IL-6 IL-8 GAPDH

CATCTTCTCAAAATTCGAGTGACAA TGGAGGGACCCCAAAAGATG TTGAGGGACCCCAAAAGATG TGGACAGCCCAGGTCAAAG TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC CGCCCAGACAGAAGTCATAG TCCTCCTTTCCAGGTCAGTTA GCCAAGAGGGTCATCATCTC CCTTCCACAATGCCAAAGTT

VIRULENCE

into cDNA using iscript cDNA select synthesis kit (Biorad, Hercules, CA, USA). Quantitative real-time PCR was performed using the Applied Biosystems 7500 Real-Time PCR system (Applied Biosystems, Carlsbad, California, USA) with KAPA SYBR green (Wilmington, MA, USA) for DNA amplicon measurement under the following conditions: 95 C 10 min; 40 cycles of 95 C for 3 s and 60 C for 30 s. Primers of target genes (Table 1) were synthesized by Biodesign (Pathumthani, Thailand). Target genes were normalized to GAPDH. The calculation of mRNA expression was performed using ddCT method. Nitric oxide measurement Nitric oxide (NO) measurement was performed by Griess test as previously described.48 Briefly, protein lysates were mixed at 1:1 ratio with Griess reagent containing 0.1% w/v N-(1-Naphthyl) Ethylenediamine dihydrochloride (NEDD) (Sigma-Aldrich, St. Louis, MA, USA) and 1% w/v sulfanilamide (Sigma-Aldrich, St. Louis, MA, USA). Absorbance of the mixture was measured using a fluorospectrophotometer at a wavelength of 540 nm. The amount of NO in the sample was estimated from the standard curve created using known concentrations of sodium nitrite. Prostaglandin E2 measurement Prostaglandin E2 (PGE2) in tissue lysates was measured using the PGE2 ELISA kit (Abcam, Cambridge, UK). Briefly, tissue lysates were added to ELISA plates, followed by competitive PGE2-tagged alkaline phosphatases, PGE2 antibodies and substrate solutions. Absorbance at 570 nm was measured using a fluorospectrophotometer. The amount of PGE2 in the samples was estimated from the standard curve generated using known concentrations of PGE2. Histological examination of mouse intestine Intestinal tissues dissected from ileal loops were fixed for 24 h in 4% paraformaldehyde, followed by tissue dehydration using graded alcohol and paraffin embedding. The processed tissues were cut into 5 mm-thick sections, which were stained with hematoxylin and eosin (H&E) reagents. Tissue slices were visualized using a light microscope for histological analysis. Transmission electron microscopy Mouse ileum preserved in 2.5% glutaraldehyde was submerged with 1% osmium tetroxide, dehydrated with

803

ethanol and embedded in Araldite 502 resin (SigmaAldrich, St. Louis, MA, USA). The samples were cut by ultramicrotome, and the sections were stained with saturated uranyl acetate before image acquisition using a transmission electron microscope (Technai 20, Philips, Eindhoven, The Netherlands). The apical junctions of intestinal epithelial cells were captured to characterize the ultrastructure of tight junctions. Statistical analysis Data are expressed as the means § SEM. Each group was compared and analyzed using one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test or Student’s t-test where appropriate. The p-value of < 0.05 was considered statistically significantly. All data were analyzed in GraphPad Prism 5 (La Jolla, CA, USA)

Disclosure of potential conflicts of interest No potential conflicts of interest were disclosed.

Funding This work is supported by grants from Thailand Research Fund and Mahidol University (grant RSA5680006) and Mahidol University (government budget) (to C.M.). Financial supports from the Faculty of Science, Mahidol University, and the Office of the Higher Education Commission and Mahidol University under the National Research Universities Initiative are also gratefully acknowledged (to C.M.). Financial supports from the Thailand Research Fund and Mahidol University through the Royal Golden Jubilee Ph.D. Program (Grant No. PHD/0105/2556) to S.S. and C.M. are acknowledged.

References [1] Sack DA, Sack RB, Nair GB, Siddique AK. Cholera. Lancet 2004; 363:223-33; PMID:14738797; http://dx.doi.org/ 10.1016/S0140-6736(03)15328-7 [2] Muanprasat C, Chatsudthipong V. Cholera: pathophysiology and emerging therapeutic targets. Future Med Chem 2013; 5:781-98; PMID:23651092; http://dx.doi. org/10.4155/fmc.13.42 [3] Bart KJ, Huq Z, Khan M, Mosley WH. Seroepidemiologic studies during a simultaneous epidemic of infection with El Tor Ogawa and classical Inaba Vibrio cholerae. J Infect Dis 1970; 121:Suppl 121:17C; PMID:4912068; http://dx. doi.org/10.1093/infdis/121.Supplement.S17 [4] Samadi AR, Huq MI, Shahid N, Khan MU, Eusof A, Rahman AS, Yunus M, Faruque AS. Classical Vibrio cholerae biotype displaces EL tor in Bangladesh. Lancet 1983; 1:805-7; PMID:6132141; http://dx.doi.org/10.1016/ S0140-6736(83)91860-3 [5] Nair GB, Faruque SM, Bhuiyan NA, Kamruzzaman M, Siddique AK, Sack DA. New variants of Vibrio cholerae O1 biotype El Tor with attributes of the classical biotype

804

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

S. SATITSRI ET AL.

from hospitalized patients with acute diarrhea in Bangladesh. J Clin Microbiol 2002; 40:3296-9; PMID:12202569; http://dx.doi.org/10.1128/JCM.40.9.3296-3299.2002 Na-Ubol M, Srimanote P, Chongsa-Nguan M, Indrawattana N, Sookrung N, Tapchaisri P, Yamazaki S, Bodhidatta L, Eampokalap B, Kurazono H, et al. Hybrid & El Tor variant biotypes of Vibrio cholerae O1 in Thailand. Indian J Med research 2011; 133:387-94; PMID:21537091 Schwartz BS, Harris JB, Khan AI, Larocque RC, Sack DA, Malek MA, Faruque AS, Qadri F, Calderwood SB, Luby SP, et al. Diarrheal epidemics in Dhaka, Bangladesh, during three consecutive floods: 1988, 1998, and 2004. Am J Trop Med Hygiene 2006; 74:1067-73; PMID:16760521 Siddique AK, Nair GB, Alam M, Sack DA, Huq A, Nizam A, Longini IM, Jr., Qadri F, Faruque SM, Colwell RR, et al. El Tor cholera with severe disease: a new threat to Asia and beyond. Epidemiol Infect 2010; 138:347-52; PMID:19678971; http://dx.doi.org/ 10.1017/S0950268809990550 Harris AM, Chowdhury F, Begum YA, Khan AI, Faruque AS, Svennerholm AM, Harris JB, Ryan ET, Cravioto A, Calderwood SB, et al. Shifting prevalence of major diarrheal pathogens in patients seeking hospital care during floods in 1998, 2004, and 2007 in Dhaka, Bangladesh. Am J Trop Med Hygiene 2008; 79:70814; PMID:18981509 Ghosh-Banerjee J, Senoh M, Takahashi T, Hamabata T, Barman S, Koley H, Mukhopadhyay AK, Ramamurthy T, Chatterjee S, Asakura M, et al. Cholera toxin production by the El Tor variant of Vibrio cholerae O1 compared to prototype El Tor and classical biotypes. J Clin Microbiol 2010; 48:4283-6; PMID:20810767; http://dx.doi.org/ 10.1128/JCM.00799-10 Barrett KE, Keely SJ. Chloride secretion by the intestinal epithelium: molecular basis and regulatory aspects. Annu Rev Physiol 2000; 62:535-72; PMID:10845102; http://dx. doi.org/10.1146/annurev.physiol.62.1.535 Thiagarajah JR, Verkman AS. CFTR inhibitors for treating diarrheal disease. Clin Pharmacol Therapeut 2012; 92:287-90; PMID:22850599; http://dx.doi.org/10.1038/ clpt.2012.114 Field M. Intestinal ion transport and the pathophysiology of diarrhea. J Clin Invest 2003; 111:931-43; PMID: 12671039; http://dx.doi.org/10.1172/JCI200318326 Sawasvirojwong S, Srimanote P, Chatsudthipong V, Muanprasat C. An Adult Mouse Model of -induced Diarrhea for Studying Pathogenesis and Potential Therapy of Cholera. PLoS Neglected Trop Dis 2013; 7:e2293; http:// dx.doi.org/10.1371/journal.pntd.0002293 Guttman JA, Finlay BB. Tight junctions as targets of infectious agents. Biochim Biophys Acta 2009; 1788:832-41; PMID:19059200; http://dx.doi.org/10.1016/ j.bbamem.2008.10.028 Ellis CN, LaRocque RC, Uddin T, Krastins B, MayoSmith LM, Sarracino D, Karlsson EK, Rahman A, Shirin T, Bhuiyan TR, et al. Comparative proteomic analysis reveals activation of mucosal innate immune signaling pathways during cholera. Infect Immun 2015; 83:1089-103; PMID:25561705; http://dx.doi.org/ 10.1128/IAI.02765-14 Das T, Mukherjee S, Chaudhuri K. Effect of quercetin on Vibrio cholerae induced nuclear factor-kappaB

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

activation and interleukin-8 expression in intestinal epithelial cells. Microbes and infection / Institut Pasteur 2012; 14:690-5; PMID:22421109; http://dx.doi. org/10.1016/j.micinf.2012.02.007 Bandyopadhaya A, Das D, Chaudhuri K. Involvement of intracellular signaling cascades in inflammatory responses in human intestinal epithelial cells following Vibrio cholerae infection. Mol Immunol 2009; 46:1129-39; PMID:19110311; http://dx.doi.org/ 10.1016/j.molimm.2008.11.003 Thiagarajah JR, Broadbent T, Hsieh E, Verkman AS. Prevention of toxin-induced intestinal ion and fluid secretion by a small-molecule CFTR inhibitor. Gastroenterology 2004; 126:511-9; PMID:14762788; http:// dx.doi.org/10.1053/j.gastro.2003.11.005 Thiagarajah JR, Ko EA, Tradtrantip L, Donowitz M, Verkman AS. Discovery and development of antisecretory drugs for treating diarrheal diseases. Clin Gastroenterol Hepatol 2014; 12:204-9; PMID:24316107; http://dx. doi.org/10.1016/j.cgh.2013.12.001 Ko EA, Jin BJ, Namkung W, Ma T, Thiagarajah JR, Verkman AS. Chloride channel inhibition by a red wine extract and a synthetic small molecule prevents rotaviral secretory diarrhoea in neonatal mice. Gut 2014; 63:11209; PMID:24052273; http://dx.doi.org/10.1136/gutjnl2013-305663 Resta-Lenert S, Barrett KE. Enteroinvasive bacteria alter barrier and transport properties of human intestinal epithelium: role of iNOS and COX-2. Gastroenterology 2002; 122:1070-87; PMID:11910358; http://dx.doi.org/ 10.1053/gast.2002.32372 Izzo AA, Mascolo N, Capasso F. Nitric oxide as a modulator of intestinal water and electrolyte transport. Dig Dis Sci 1998; 43:1605-20; PMID:9724140; http://dx.doi. org/10.1023/A:1018887525293 van der Merwe JQ, Ohland CL, Hirota CL, MacNaughton WK. Prostaglandin E2 derived from cyclooxygenases 1 and 2 mediates intestinal epithelial ion transport stimulated by the activation of proteaseactivated receptor 2. J Pharmacol Exp Therapeut 2009; 329:747-52; PMID:19190238; http://dx.doi.org/ 10.1124/jpet.108.145466 Yang CW, Yu CC, Ko YC, Huang CC. Aminoguanidine reduces glomerular inducible nitric oxide synthase (iNOS) and transforming growth factor-beta 1 (TGFbeta1) mRNA expression and diminishes glomerulosclerosis in NZB/W F1 mice. Clin Exp Immunol 1998; 113:258-64; PMID:9717976; http://dx.doi.org/10.1046/ j.1365-2249.1998.00632.x Clancy RM, Gomez PF, Abramson SB. Nitric oxide sustains nuclear factor kappaB activation in cytokine-stimulated chondrocytes. Osteoarthritis Cartilage 2004; 12:552-8; PMID:15219570; http://dx.doi.org/10.1016/j. joca.2004.04.003 Dey I, Lejeune M, Chadee K. Prostaglandin E2 receptor distribution and function in the gastrointestinal tract. Br J Pharmacol 2006; 149:611-23; PMID:17016496; http:// dx.doi.org/10.1038/sj.bjp.0706923 Hoque KM, Woodward OM, van Rossum DB, Zachos NC, Chen L, Leung GP, Guggino WB, Guggino SE, Tse CM. Epac1 mediates protein kinase A-independent mechanism of forskolin-activated intestinal chloride secretion. J Gen

VIRULENCE

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

Physiol 2010; 135:43-58; PMID:20038525; http://dx.doi.org/ 10.1085/jgp.200910339 Worrell RT, Frizzell RA. CaMKII mediates stimulation of chloride conductance by calcium in T84 cells. Am J Physiol 1991; 260:C877-82; PMID:1708204 Guichard A, Cruz-Moreno B, Aguilar B, van Sorge NM, Kuang J, Kurkciyan AA, Wang Z, Hang S, Pineton de Chambrun GP, McCole DF, et al. Cholera toxin disrupts barrier function by inhibiting exocyst-mediated trafficking of host proteins to intestinal cell junctions. Cell Host Microbe 2013; 14:294-305; PMID:24034615; http://dx. doi.org/10.1016/j.chom.2013.08.001 Phongsisay V, Iizasa E, Hara H, Yoshida H. Evidence for TLR4 and FcRgamma-CARD9 activation by cholera toxin B subunit and its direct bindings to TREM2 and LMIR5 receptors. Mol Immunol 2015; 66:463-71; PMID:26021803; http://dx.doi.org/ 10.1016/j.molimm.2015.05.008 Guo S, Al-Sadi R, Said HM, Ma TY. Lipopolysaccharide causes an increase in intestinal tight junction permeability in vitro and in vivo by inducing enterocyte membrane expression and localization of TLR-4 and CD14. Am J Pathol 2013; 182:375-87; PMID:23201091; http://dx.doi. org/10.1016/j.ajpath.2012.10.014 Gribar SC, Anand RJ, Sodhi CP, Hackam DJ. The role of epithelial Toll-like receptor signaling in the pathogenesis of intestinal inflammation. J Leukoc biol 2008; 83:493-8; PMID:18160540; http://dx.doi.org/10.1189/jlb.0607358 Son MS, Megli CJ, Kovacikova G, Qadri F, Taylor RK. Characterization of Vibrio cholerae O1 El Tor biotype variant clinical isolates from Bangladesh and Haiti, including a molecular genetic analysis of virulence genes. J Clin Microbiol 2011; 49:3739-49; PMID:21880975; http://dx.doi.org/10.1128/JCM.01286-11 Dharmsathaphorn K, Pandol SJ. Mechanism of chloride secretion induced by carbachol in a colonic epithelial cell line. J Clin Invest 1986; 77:348-54; PMID:3003156; http://dx.doi.org/10.1172/JCI112311 Cartwright CA, McRoberts JA, Mandel KG, Dharmsathaphorn K. Synergistic action of cyclic adenosine monophosphate- and calcium-mediated chloride secretion in a colonic epithelial cell line. J Clin Invest 1985; 76:1837-42; PMID:2997291; http://dx.doi.org/10.1172/JCI112176 Harrison LM, Rallabhandi P, Michalski J, Zhou X, Steyert SR, Vogel SN, Kaper JB. Vibrio cholerae flagellins induce Toll-like receptor 5-mediated interleukin-8 production through mitogen-activated protein kinase and NF-kappaB activation. Infect Immun 2008; 76:5524-34; PMID:18809662; http://dx.doi.org/10.1128/IAI.00843-08 Kim KJ, Kim HA, Seo KH, Lee HK, Kang BY, Im SY. Cholera toxin breakdowns oral tolerance via activation of canonical NF-kappaB. Cell Immunol 2013; 285:92-9; PMID:24140867; http://dx.doi.org/10.1016/ j.cellimm.2013.09.006

805

[39] Schnitzler AC, Burke JM, Wetzler LM. Induction of cell signaling events by the cholera toxin B subunit in antigen-presenting cells. Infect Immun 2007; 75:3150-9; PMID:17353279; http://dx.doi.org/10.1128/IAI.00581-06 [40] Wands AM, Fujita A, McCombs JE, Cervin J, Dedic B, Rodriguez AC, Nischan N, Bond MR, Mettlen M, Trudgian DC, et al. Fucosylation and protein glycosylation create functional receptors for cholera toxin. eLife 2015; 4:e09545; PMID:26512888; http://dx.doi.org/10.7554/eLife.09545 [41] Borghan MA, Mori Y, El-Mahmoudy AB, Ito N, Sugiyama M, Takewaki T, Minamoto N. Induction of nitric oxide synthase by rotavirus enterotoxin NSP4: implication for rotavirus pathogenicity. J Gen Virol 2007; 88:2064-72; PMID:17554041; http://dx.doi.org/10.1099/vir.0.82618-0 [42] Keller SA, Hernandez-Hopkins D, Vider J, Ponomarev V, Hyjek E, Schattner EJ, Cesarman E. NF-kappaB is essential for the progression of KSHV- and EBVinfected lymphomas in vivo. Blood 2006; 107:3295302; PMID:16380446; http://dx.doi.org/10.1182/blood2005-07-2730 [43] Kang KM, Lee GS, Lee JH, Choi IW, Shin DW, Lee YH. Effects of iNOS inhibitor on IFN-gamma production and apoptosis of splenocytes in genetically different strains of mice infected with Toxoplasma gondii. Korean J Parasitol 2004; 42:175-83; PMID:15591835; http://dx.doi.org/ 10.3347/kjp.2004.42.4.175 [44] Azari MF, Profyris C, Le Grande MR, Lopes EC, Hirst J, Petratos S, Cheema SS. Effects of intraperitoneal injection of Rofecoxib in a mouse model of ALS. Eur J Neurol 2005; 12:357-64; PMID:15804265; http://dx.doi.org/ 10.1111/j.1468-1331.2004.00987.x [45] Shakhnovich EA, Hung DT, Pierson E, Lee K, Mekalanos JJ. Virstatin inhibits dimerization of the transcriptional activator ToxT. Proc Natl Acad Sci U S A 2007; 104:2372-7; PMID:17283330; http://dx.doi.org/10.1073/ pnas.0611643104 [46] Yoon YS, Kim SY, Kim MJ, Lim JH, Cho MS, Kang JL. PPARgamma activation following apoptotic cell instillation promotes resolution of lung inflammation and fibrosis via regulation of efferocytosis and proresolving cytokines. Mucosal Immunol 2015; 8:1031-46; PMID:25586556; http://dx.doi.org/10.1038/mi.2014.130 [47] Shamir D, Keila S, Weinreb M. A selective EP4 receptor antagonist abrogates the stimulation of osteoblast recruitment from bone marrow stromal cells by prostaglandin E2 in vivo and in vitro. Bone 2004; 34:157-62; PMID:14751573; http://dx.doi.org/ 10.1016/j.bone.2003.09.008 [48] Colasanti M, Persichini T, Menegazzi M, Mariotto S, Giordano E, Caldarera CM, Sogos V, Lauro GM, Suzuki H. Induction of nitric oxide synthase mRNA expression. Suppression by exogenous nitric oxide. J Biol Chem 1995; 270:26731-3; PMID:7592903; http://dx.doi.org/ 10.1074/jbc.270.45.26731