Journal of Pathology J Pathol 2015; 236: 302–314 Published online 8 April 2015 in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/path.4524

ORIGINAL PAPER

Paediatric nodal marginal zone B-cell lymphadenopathy of the neck: a Haemophilus influenzae-driven immune disorder? Philip M Kluin,1* Anton W Langerak,2 Jannetta Beverdam-Vincent,3,4 Willemina RR Geurts-Giele,5 Lydia Visser,1 Bea Rutgers,1 Ed Schuuring,1 Joop Van Baarlen,6 King H Lam,5 Kees Seldenrijk,7 Robby E Kibbelaar,8 Peter de Wit,9 Arjan Diepstra,1 Stefano Rosati,1 Max M van Noesel,10 C Michel Zwaan,10 Jarmo CB Hunting,11 Mels Hoogendoorn,12 Ellen J van der Gaag,13 Joost W J van Esser,14 Eveline de Bont,15 Hanneke C Kluin-Nelemans,16 Rik H Winter,17 Jerome R Lo ten Foe17 and Adri GM van der Zanden3,4 1

Department of Pathology and Medical Biology, University Medical Centre Groningen, University of Groningen, Groningen, The Netherlands Department of Immunology, Erasmus MC, University Medical Centre Rotterdam, Rotterdam, The Netherlands 3 Microbiology and Infection Control, Zorggroep Twente, Hengelo, The Netherlands 4 Laboratory for Microbiology, Twente Achterhoek, Hengelo, The Netherlands 5 Department of Pathology, Erasmus Medical Centre Rotterdam, EMCR, Rotterdam, The Netherlands 6 Department of Pathology, LABPON, Hengelo, The Netherlands 7 Department of Pathology, St Antonius Hospital, Nieuwegein, The Netherlands 8 Department of Pathology, Pathologie Friesland, Leeuwarden, The Netherlands 9 Department of Pathology, Amphia Hospital, Breda, The Netherlands 10 Department of Oncology and Hematology, Sophia Children Hospital, Rotterdam, The Netherlands 11 Department of Internal Medicine, St Antonius Ziekenhuis, Nieuwegein, The Netherlands 12 Department of Internal Medicine, Medisch Centrum Leeuwarden, The Netherlands 13 Department of Pediatrics, Zorggroep Twente, Hengelo, The Netherlands 14 Department of Internal Medicine, Amphia Hospital, Breda, The Netherlands 15 Department of Pediatric Oncology & Hematology, University Medical Centre Groningen, University of Groningen, Groningen, The Netherlands 16 Department of Hematology, University Medical Centre Groningen, University of Groningen, Groningen, The Netherlands 17 Department of Medical Microbiology, University Medical Centre Groningen, University of Groningen, Groningen, The Netherlands 2

*Correspondence to: PM Kluin, Department of Pathology and Medical Biology, University Medical Centre Groningen, University of Groningen, Hanzeplein 1, 9700RB, Groningen, The Netherlands. E-mail: [email protected]

Abstract Many hyperplasias and lymphomas of marginal zone B-cells are associated with infection. We identified six children and one adolescent with cervical lymphadenopathy showing prominent polyclonal nodal marginal zone hyperplasia (pNMZH) and four adolescents with monoclonal paediatric nodal marginal zone lymphoma (pNMZL). The clonality status was assessed using BIOMED-2-IG PCR analysis. Haemophilus influenzae was identified in all six cases of pNMZH that could be tested by direct culture (N = 3) or a very sensitive PCR for the H. influenzae gyrase gene in frozen materials (N = 5). H. influenzae was not detected in three pNMZLs and 28 non-specific reactive cervical lymph nodes of age-matched controls, except for a single control node that was obtained during oropharyngeal surgery for a cleft palate showing very low copy numbers of H. influenzae. pNMZH patients were younger than pNMZL patients (median age 12 versus 21 years). pNMZH showed a prominent nodular appearance with variable fibrosis without acute inflammation. Within the nodules, the expanded germinal centres and variably sized marginal zones were colonized by activated B-cells with weak expression of IgD and lack of CD10 and/or BCL6 expression. Some areas showed skewed light chain expression in plasma cells (4/5 cases lambda). In four cases tested, this was confirmed by flow cytometry for surface Ig (3/4 cases lambda). In contrast, pNMZL showed more extensive expansion of marginal zones by centrocytoid cells and often expression of BCL2 protein. Several H. influenzae strains are known to interact with the constant part of IgD on human B-cells, leading to their polyclonal proliferation and activation. We speculate that in vivo stimulation of IgD+ marginal zone B-cells by this bacterium may be implicated in this particular lymphadenopathy that should be distinguished from monoclonal pNMZL. Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Keywords: lymphadenopathy; marginal zone; hyperplasia; paediatric; IgD; infection; Haemophilus influenzae; malignant lymphoma

Received 21 November 2014; Revised 10 February 2015; Accepted 23 February 2015

No conflicts of interest were declared.

Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. www.pathsoc.org.uk

J Pathol 2015; 236: 302–314 www.thejournalofpathology.com

Haemophilus influenzae in paediatric lymphadenopathy

Introduction Expansion of marginal zone B-cells may reflect antigenic stimulation by microorganisms, well-known examples being Helicobacter pylori and its role in gastric MALT (mucosa-associated lymphoid tissue) hyperplasia and lymphoma, Borrelia burgdorferi in some reactive and neoplastic cutaneous lesions, Chlamydia psittaci in some orbital lymphomas, and Campylobacter jejuni in specific intestinal lymphomas (IPSID/alpha chain disease) [1]. In addition, a fraction of nodal and splenic marginal zone B-cell lymphomas are associated with hepatitis C virus [2,3]. Based on a positive culture for Haemophilus influenzae in a cervical lymph node with marginal zone hyperplasia, we retrospectively investigated the pathological and clinical features of seven children/adolescents with polyclonal paediatric marginal zone hyperplasia (pNMZH) and four patients with monoclonal nodal paediatric marginal zone lymphoma (pNMZL), all exclusively affecting the cervical lymph nodes. To that end, we set up a sensitive PCR assay that detects all H. influenzae strains. Since the oroand naso-pharynx of almost all children are heavily colonized by various non-typeable strains [4–9] and the bacterium may be invasive in local (lymphoid) tissues, we also tested a large series of reactive cervical lymph nodes with non-specific features that were obtained from the same age group. Here we report on the exclusive presence of H. influenzae in lymph nodes with polyclonal pNMZH affecting young children but not in the other lymph nodes tested. Additionally, we describe the specific pathological features of this type of hyperplasia.

303

UMCG and the Department of Pathology Friesland, Leeuwarden, The Netherlands. Research was performed according to the research code of the UMCG (https://www.umcg.nl/EN/Research/ Researchers/General/ResearchCode).

Histology, immunohistochemistry, flow cytometry, and molecular analysis Specimens were fixed in 10% phosphate buffered formalin and embedded in paraffin wax. Tissue sections were stained with haematoxylin and eosin, and Giemsa. Immunohistochemistry was performed according to local protocols and centrally (UMCG) in a Nexes or Ultra immunostainer (Ventana–Roche, Tucson, AZ, USA). Monoclonal antibodies included anti CD3, CD5, CD10, CD20, CD21, CD23, CD43, CD79a, BCL2, BCL6, MUM1/IRF4, IRTA1/CD307d, CD138, Ki67, immunoglobulin (Ig) kappa/lambda double colour staining, as well as IgM, IgD, IgG, and IgA in all cases (Supplementary Table 1). In most cases, staining for CD57 and CD279/PD1 was also performed. Flow cytometry on freshly suspended cells was performed locally according to the local protocols. Analysis of IG heavy and light chain gene rearrangements was initially performed in the local laboratories, mostly on paraffin-embedded samples. All samples (frozen material) were re-analysed according to the BIOMED-2-IG protocol in the Department of Immunology, Erasmus MC, Rotterdam [10,11]. In addition, in seven biopsies from six patients, nodules containing the abnormal cells were microdissected from paraffin tissue sections and separately analysed with FR1, FR2, and FR3 IGH PCR. All tests were performed in duplicate.

Materials and methods

PCR for detection of H. influenzae

Between 2001 and 2012, we identified 11 patients with isolated or bilateral cervical lymphadenopathy in which the lymph node showed a prominent expansion of marginal zones and/or a prominent expansion of germinal centres (Table 1). Almost all cases were seen in consultation. All biopsies represented excision biopsies of whole lymph nodes. Clinical staging consisted of whole-body CT scans in six patients, ultrasonography in three patients, bone marrow biopsy in two patients, and bone marrow aspirate with flow cytometry in two patients. In five patients, no staging procedures were performed (Table 1). Two lymphoma patients underwent local radiotherapy (cases 9 and 11). In other patients, no treatment was given. For follow-up, the records were checked by contacting the treating physicians and by a search in the Dutch pathology database PALGA, which covers all pathology laboratories in The Netherlands. Twenty-eight control reactive cervical lymph nodes of age-matched patients were selected from the archives of the Department of Pathology and Medical Biology,

We developed a PCR assay for frozen tissues using general primers covering the gyrase gene of H. influenzae. DNA from formalin-fixed, paraffin-embedded tissues did not yield consistent PCR results. To prevent contamination, sections were cut under strict conditions using disposable knifes and sterile dent sticks. Test and negative control samples (six kidneys with renal cell carcinoma and two spleens removed for idiopathic thrombocytopenic purpura and auto-immune haemolytic anaemia) were alternately cut. In each case, DNA was separately extracted from at least two individual sections, using Qiagen columns [Qiagen minikit protocol, QIAamp® DNA Mini kit (Qiagen cat No 51306; Qiagen GmbH, Hilden, Germany)] and dissolved in 200 μl of buffer. For each PCR experiment, 10 μl and 20 μl of mastermix (Light Cycler 480 Probes Master Roche; art No 04 902 343 001 2× conc; Roche Molecular Diagnostics, Almere, The Netherlands) were used. All samples were spiked with DNA of Cyanobacterium to control for the efficiency of the PCR and the presence of possible inhibitors of the amplification reaction. Amplification was performed on a Lightcycler®

Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. www.pathsoc.org.uk

J Pathol 2015; 236: 302–314 www.thejournalofpathology.com

Gender

Age (years)

Date biopsy & site

Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. www.pathsoc.org.uk

F M

M

F

F

3 4

5

6

7

18

13

12

7 12

5

2008: persistent jugular ln R; 2011: idem

2011: persistent solitary cervical ln, 2–3 cm 2002: single cervical ln 2007: bilateral submandibular ln 2009: persistent solitary ln R, level II; 2011: idem 2008: single cervical ln, 3 × 4 cm

M M

10 11

21 24

21

2004: preauricular and cervical ln L 2011: preauricular ln R 2006: single jugular ln 2 cm R

ln since 8 months; night sweats since 2 months Rhinitis

ln since several months; rhinitis, sore throat, coughing; history: otitis & tonsillitis 2004: tonsillectomy for tonsillitis; 2005: FNA and needle biopsy

FNA 27 months before biopsy

Coughing; rhinitis; 1 year earlier also lymphadenopathy; high LDH Persistent lymph node since 2009

Other symptoms & lab findings

nd nd

CT scan and PET scan: normal CT scan, bm biopsy: normal

CT scan, bm biopsy, cytology and FCM: normal Ultrasound & CT scan: normal

CT scan: normal

nd

Toxoplasma, Borrelia, CMV and EBV neg nd

CT scan; bm cytology with FCM: normal

Ultrasound: normal

nd Ultrasound: normal

nd

nd

Clinical staging

Chlamydia, Toxoplasma, EBV, AST, Leishmania, CMV, rubella neg

Bartonella, CMV, EBV neg VZV pos CMV, EBV neg nd

nd

AST pos CMV & EBV: IgG pos, IgM neg, Toxoplasma neg

Serology

ln: lymph node; bm: bone marrow; R: right; L: left; FNA: fine needle aspiration; neg: negative; nd: not done; FU: follow-up; FCM: flow cytometry.

M

9

Monoclonal paediatric marginal zone lymphoma 8 M 17 2010: single cervical ln of 4 cm

M

2

Polyclonal paediatric marginal zone hyperplasia 1 F 5 2010: single cervical ln

Case

Table 1. Clinical data of 11 patients with paediatric nodal marginal zone hyperplasia and paediatric nodal marginal zone lymphoma

Antibiotics without effect Radiotherapy

Radiotherapy; no recurrence

Surgical excision, expectative

Expectative

Expectative, antibiotics without results, steroids: complete remission Expectative

Expectative Expectative

Expectative

Expectative

Therapy

28 Biopsy after 16 months: non-reactive ln; total 72+

117

47

Relapse after 36 months; total 102

Relapse L after 9 months; second relapse R after 24 months; total 83 57

135 77

31

53

FU (months)

304 PM Kluin et al

J Pathol 2015; 236: 302–314 www.thejournalofpathology.com

Haemophilus influenzae in paediatric lymphadenopathy

480 Real-Time PCR instrument (Roche Molecular Diagnostics, Almere, The Netherlands). For the bacterial gyrase gene, the forward primer CACTTCgCTATATgTTggTTgAT, the reverse primer CCATCATAgTTTggCgAgAA, and the probe FAM-CTgCAATgCgTTATACCgAAgTgC-TMR were used (Supplementary Figure 1). The specificity of the primers and probe against H. influenzae was checked in the NCBI database and validated on a large number of samples (data not shown). The forward primer and the probe also detected H. parahaemolyticus and H. parainfluenzae. The PCR results of H. parainfluenzae DNA dilution showed ten-fold reduced fluorescence compared with H. influenzae and the absence of a smooth S-curve. However, the PCR results for H. influenzae and H. parahaemolyticus were comparable. The sensitivity of the assay was determined in serial dilutions of a H. influenzae positive control sample with 10–20 × 103 copies per μl (Amplirun Haemophilus influenzae DNA control; Vircell, Granada, Spain) (Supplementary Table 2) and in several serial dilution experiments of clinical samples (Supplementary Table 3). PCR for H. influenzae on the eight negative control samples yielded negative results with Cp values greater than 40. Based on these tests, the threshold Cp value for a consistently positive sample was set at 37.00; negative samples were classified as Cp ≥ 40; and samples with Cp values greater than 37 and less than 40 were retested. To check the amount of human DNA input in the samples, a quantitative HBB (β-globin) PCR assay was performed. Forward primer TM TGGGTTTCTGATAGGCACTGACT, reverse primer TM AACAGCATCAGG AGTGGACAGAT, and probe TM FAM-TCTACCCTT GGACCCAGAGGTTCTTTGAGT-BBQ were used.

Results Over a period of 13 years, we identified seven cases of polyclonal paediatric nodal marginal zone hyperplasia (pNMZH) and four cases of monoclonal paediatric marginal zone lymphoma (pNMZL). Clonality analysis was performed using IG gene rearrangement analysis according to the BIOMED-2-IG protocol [11].

Clinical data and pathology of polyclonal pNMZH Seven patients, aged 5–18 years, presented with unilateral (N = 6) or bilateral (N = 1) cervical lymphadenopathy. Four patients had persistent/recurrent lymphadenopathy, the longest being 4 and 6 years (cases 5 and 7, Table 1). Interestingly, these two patients suffered from localized lymphadenopathy for a period of 2 and 3 years before the first biopsy was taken, but also had a histologically proven recurrence 2 and 3 years after this biopsy (Table 2, biopsies 5A, 5B, 7A, and 7B). The other two patients (cases 1 and 2) had persisting lymphadenopathy (1 and 2 years) before the first biopsy, but without recurrences. Two patients had a history of rhinitis and coughing (cases 1 and 6) and one patient Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. www.pathsoc.org.uk

305

previously had undergone tonsillectomy (case 7). Based on a primary diagnosis of a possible lymphoma, two patients underwent staging by CT scan (cases 6 and 7) and ultrasound (cases 4 and 5). In these four patients no other localizations were found (Table 1). Follow-up from the moment of the first excision biopsy ranged from 31 to 135 months. In all patients, therapy was expectant; in patient 5, antibiotic treatment was given after the relapse in 2011, which did not have any effect, but subsequent prednisone therapy resulted in complete disappearance of lymphadenopathy. The size of the lymph nodes ranged up to 40 mm. All lymph nodes showed partial destruction of the architecture, with in many cases prominent nodular areas, sometimes with some fibrotic bands (Figures 1A and 1B). Follicular hyperplasia was often present outside these distinct nodules. Strongly expanded follicles were present within the nodules, often with blurred contours due to inconspicuous mantle zones. These follicles therefore often mimicked progressively transformed germinal centres (PTGCs; Figure 1B). Variable marginal zones were present, but only one case showed very prominent marginal zones (Figure 1A). The germinal centres and marginal zones contained highly activated medium-sized lymphoid cells (blasts) without any atypia (Figures 1C and 1D). Some degree of apoptosis with accumulation of macrophages could be present. None of the lymph nodes showed any sign of acute inflammation or necrosis, and no bacteria could be identified in specific stains and Giemsa-stained imprints. Immunohistochemistry for immunoglobulins showed prominent staining for IgD, strongly on small lymphocytes corresponding to the residual follicle mantles and weakly on the blasts in the marginal zones and germinal centres, the latter indicating follicular colonization (Figures 1E and 1F). In some cases, some plasma cells expressing IgD were also observed. Immunohistochemistry often showed an irregular, fragmented pattern of CD10 and BCL6 in the germinal centres (Figures 1G and 1H). Only in case 4, with pronounced marginal zones, were the CD10- and BCL6-positive cells organized in more regular nodules. BCL2 staining was absent or weak in the nodules and marginal zones. CD21 staining showed disrupted meshworks of follicular dendritic cells. Staining of the lymphoid cells was difficult to assess because of these meshworks, but they were likely partially positive in cases 1, 2, and 7 (data not shown). CD43 was negative in all six cases that could be tested. Mum1/IRF4 showed variable numbers of plasmacytoid cells ( 80% Nodules BCL2−/+, BCL6−, CD10−/+; MUM1 10%, CD43−, CD307d variable+, Ki67 relatively high, foci 100% Nodules BCL2−, BCL6−, CD10−, MUM 11–20%, CD43−, CD307d variable+, Ki67 highly variable, foci > 80%

Nodules BCL2−, BCL6−, CD10−, MUM1 20%, CD43 nd, CD307d nd, Ki67 highly variable, foci > 80% Nodules BCL2−, BCL6−, CD10−; MUM1 < 10%, CD43−, CD307d variable+, Ki67 highly variable, foci > 80% Nodules BCL2−, BCL6−, CD10−, MUM1 < 10%, CD43−, CD307d variable+, Ki67 highly variable, foci > 80% Nodules BCL2−, BCL6−, CD10−, MUM1 10%, CD43−, CD307d in marginal zones +, Ki67 relatively low, foci > 80%

IHC

λ + large B-cells

nd

Nodules: M + Dw+ Plasma cells: many λ, many M+

Nodules: M + D? Plasma cells: many λ, many M+

70% of B-cells λMD, FMC7+, CD10-

nd

Nodules: M?D+ Plasma cells: focally λ

Nodules: M + D+ Plasma cells: many λ, many M+

nd

2 samples: λMD (k/λ = 0.5), CD10−

Nodules: MD+ Plasma cells: many λ

Nodules: M + D? Plasma cells: polyclonal

20% of B-cells kMD+, CD10−

FCM

Nodules: MDw+ Plasma cells: κ

IHC immunoglobulins‡

306 PM Kluin et al

J Pathol 2015; 236: 302–314 www.thejournalofpathology.com

Bacteriological culture

H. influenzae PCR* (Cp value)

IG clonality*

IG clonality nodules†

Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. www.pathsoc.org.uk

nd

nd

IGH A, C: P/IP IGH B: P/np IGH D, E: IP IGK A, B: P IGL: P

FR1: IP FR2: IP FR3: P

10

9

nd

nd

> 40/> 40

> 40/> 40

IGH A, B, C: M IGH D, E: IP IGK A, B: M IGL: M

IGH A, C: M IGH B: np IGH D, E: IP IGK A: M IGK B: P IGL: P

nd

nd

Monoclonal paediatric marginal zone lymphoma, H. influenzae-negative nd 8 nd 39.30/>40/>40 IGH A, B: M IGH C: IP IGH D: M IGH E: IP IGK A, B: M IGL: P

7B (2011)

Polyclonal paediatric marginal zone hyperplasia, H. influenzae not tested FR1: NP 7A (2008) nd nd IGH A, C: P/IP FR2: NP IGH B: P/np FR3: IP IGH D, E: IP IGK A, B: P IGL: IP

Case

Table 2. Continued

47,XY,+16[4]/47, XY,+add(16) (q11)[3]/46,XY [14]

nd

nd

nd

nd

Karyotype

Nodular+, fibrosis−, variably expanded germinal centres, mantle zone−/+, marginal zones+, merge with germinal centres, mixture of blasts and monocytoid cells Nodular+/−, fibrosis+/−, variably expanded germinal centres, mantle zone−/+, marginal zones+, merge with germinal centres, mostly monocytoid cells

No fibrosis, no nodules, mixture of expanded germinal centres that merge with marginal zones, mantle zones−, mostly monocytoid cells

Nodular++, fibrosis++, in nodules expanded germinal centres, elsewhere normal or florid follicular hyperplasia, mantle zones−, marginal zones+/−, blasts+ Nodular++, fibrosis++, in nodules expanded germinal centres, elsewhere normal or florid follicular hyperplasia, mantle zones−, marginal zones+/−, blasts+

Histology

IgD limited to mantles; few plasma cells, focally mainly κ

IgD limited to mantle zones; plasma cells polyclonal

IgD limited to mantle zones; plasma cells polyclonal

44% κIgMD, CD10w+, FMC7+, CD11c & CD24 partially+

nd

nd

nd

Nodules IgM + Dw+, few plasma cells M+ or D+, in some foci λ > κ

Nodules BCL2−/w, CD10−, BCL6−, MUM1 < 10%, CD43−, CD307d variable+, Ki67 highly variable, foci > 90%

Germinal centres: BCL2−, BCL6+, CD10 + . Marginal zones BCL2+, CD10−, BCL6−, MUM1 < 10%, CD43W+, CD307d nd, Ki67 low, foci > 90% Germinal centres: BCL2−, BCL6+, CD10+, IgD− Marginal zones: BCL2+, CD43+, CD307d marginal zones +, Ki67 > 50% in germinal centres and 20% in marginal zones Germinal centres: BCL2−, CD10+; partially BCL6+ Marginal zones: BCL2+, MUM1 < 5%, CD43 nd, CD307d nd, Ki67 nd

nd

FCM

Nodules IgM + D+, few plasma cells M+ and D+; foci with mainly κ, other λ or mixed

IHC immunoglobulins‡

Nodules BCL2−, BCL6−, CD10−, MUM1 < 10%, CD43nd, CD307d nd; Ki67 highly variable, foci > 90%

IHC

Haemophilus influenzae in paediatric lymphadenopathy 307

J Pathol 2015; 236: 302–314 www.thejournalofpathology.com

IG clonality: results of the central analysis on frozen tissues according to the BIOMED-2-IG protocol [11] as performed in the Department of Immunology of the EMCR. clonality nodules: results of IGH PCR (FR1, FR2, and FFR3) on individual nodules dissected from paraffin-embedded tissue sections; Since some nodules were smaller than others and contained a relatively small number of target cells, some analyses resulted in ‘incomplete polyclonal’ patterns or in ‘no product’. All tests were performed in duplicate. ‡ IHC immunoglobulins: only the predominant expression pattern is shown. For plasma cells, only the immunoglobulin expression within the expanded nodules and not that of the plasma cells in between the nodules or within the areas with more regular hyperplasia is shown. IGH A: tube A, etc. M: monoclonal; NP: no product; P: polyclonal; IP: irregular polyclonal; nd: not done; np: no product; w: weak; IHC: immunohistochemistry; FCM: flow cytometry. † IG

*

IgD in germinal centres and marginal zones similar to BCL2 pattern; very few plasma cells; locally λ > κ Germinal centres: BCL2 variable, BCL6 > CD10; MUM1 < 1%; CD43 nd, CD307d nd, Ki67 nd Monoclonal paediatric marginal zone lymphoma, H. influenzae not tested nd 11 nd nd IGH A, B: M IGH C: P IGH D: M IGH E: IP IGK A: M IGK B: P IGL: P

nd

Nodular+, fibrosis+, expanded germinal centres+, mantle zones variable, marginal zones++, merge with germinal centres, mostly monocytoid cells

IHC immunoglobulins‡ IHC Histology Karyotype IG clonality nodules† IG clonality*

H. influenzae PCR* (Cp value) Bacteriological culture Case

Table 2. Continued

nd

PM Kluin et al

FCM

308

Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. www.pathsoc.org.uk

Unexpectedly, in five of six pNMZH cases tested, some follicles contained predominantly light chain expression in plasma cells. In four cases (cases 2 and 4–6), a predominance of λ + plasma cells was seen; in two cases (cases 1 and 7A), κ + plasma cells dominated (Table 2 and Figures 1J and 1K). By flow cytometry, case 1 showed an abnormal population of 20% κMD+ and CD10− B-cells; case 2 showed a reverse κ/λ ratio with the λ + cells also expressing IgM and IgD but no CD10; case 5 showed the λ + cells being greater than the κ + cells; and case 6 showed very pronounced skewing, 70% of the B-cells being λMD+ and CD10− (Table 2 and Figure 1L). In the two cases tested, cytogenetic analysis showed no abnormalities (Table 2). Complete BIOMED-2-IG analysis was performed on frozen material (Table 2) and a more restricted analysis (at least FR1, FR2, and FR3 PCR of the IGH locus) was performed on paraffin material. In cases 1, 2, and 6, paraffin blocks were used that contained almost exclusively abnormal nodules; in cases 3, 4, 5, and 7, individual nodules were further microdissected from paraffin-embedded tissue sections and analysed separately. All cases, including the analysis of the individual nodules, showed polyclonal or incomplete polyclonal results for all IG targets, except for case 4, in which a weak product was observed in the FR2 PCR test on (undissected) frozen material (IGH tube B; Table 2).

Clinical data and pathology of monoclonal pNMZL Four patients, aged 17–24 years, presented with a unilateral cervical or pre-auricular monoclonal pNMZL. Clinical data are presented in Table 1. In this small series, long-lasting lymphadenopathy was not noted before biopsy and one patient experienced rhinitis. All patients were staged by CT scanning and in two patients, a bone marrow biopsy was also performed; no other localizations were detected. In patient 8, the lymph node was completely removed by surgery and the patient was followed by observation only. One patient was unsuccessfully treated with antibiotics. Two patients were treated with radiotherapy, which resulted in complete remission. Follow-up ranged from 28 to 117 months and no recurrences have been observed to date. All four pNMZL cases showed enlarged lymph nodes with a somewhat nodular appearance and some or no fibrosis (Figure 2A). All cases showed expanded germinal centres and variable expansion of marginal zones, both compartments being populated by centrocyte-like/monocytoid B-cells (Figure 2B). Marginal zone expansion was very prominent in case 8. The most important distinguishing feature between pNMZH and pNMZL was the presence of predominantly centrocyte-like/monocytoid B-cells in the marginal zones of pNMZL versus the activated blasts in pNMZH. BCL2 staining was more often positive than in pNMZH by immunohistochemistry (Table 2 and Figure 2C). Monotypic plasma cells were detected in two cases (case 10, kappa; case 11, lambda). At the J Pathol 2015; 236: 302–314 www.thejournalofpathology.com

Haemophilus influenzae in paediatric lymphadenopathy

309

Figure 1. Pathology of paediatric nodal marginal zone hyperplasia. (A) Case 4. Low magnification of H&E staining. This biopsy shows a marginal zone pattern with prominent germinal centres, remnants of mantle zones, and a prominent marginal zone. (B) Case 6. Low magnification of H&E staining. This biopsy shows prominent nodular structures mimicking progressively transformed germinal centres. (C) Case 6. High magnification to show the morphology of the B-cell blasts with apoptosis. (D) Case 3. High magnification to show the morphology of the B-cell blasts with a more monocytoid appearance of the cytoplasm. (E) Case 4. Immunohistochemistry for IgD, with a large nodule on the right side showing germinal centres, irregular and incomplete mantle zones, and expanded marginal zones, each with IgD expression. In contrast, two small primary follicles are shown in the left upper corner. (F) Case 6. Immunohistochemistry for IgD with a similar pattern of IgD+ nodules, whereas the strongly positive mantle zone B-cells serve as a positive control and the negative interfollicular cells as a negative control. (G) Case 5. Low magnification for CD10. Note the very expanded and disrupted follicles with large areas that lack CD10 expression, alternating with much smaller normal hyperplastic follicles. (H) Case 4. High power for BCL6 expression. This again shows the disrupted follicles that are colonized by BCL6-negative marginal zone cells. (I) Case 2. Ki67 staining showing a nodule with moderate staining and multiple smaller areas inside the nodule that show very intense staining, the latter likely reflecting residual germinal centre B-cells. (J) Case 2. Immunohistochemistry with double staining for kappa (brown) and lambda (red), showing a predominance of lambda-positive plasma cells. (K) Case 6. Immunohistochemistry with double staining for kappa (brown) and lambda (red), showing a strong predominance of lambda-positive plasma cells. (L) Case 6. Flow cytometry for CD20 and lambda, showing that the strongest CD20-positive cells are almost exclusively lambda-positive. Multi-parameter analysis indicated that 70% of the B-cells were lambda IgM/D-positive.

Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. www.pathsoc.org.uk

J Pathol 2015; 236: 302–314 www.thejournalofpathology.com

310

PM Kluin et al

Figure 1. Continued.

genetic level, one case showed clonal chromosomal abnormalities (case 10). In pNMZL, all IG gene clonality tests showed dominant monoclonal peaks in at least two of three assays for FR1, FR2, and FR3, in all four cases also for IGK (Table 2).

Detection of H. influenzae in pNMZH, pNMZL, and control lymph nodes Patient 3 with pNMZH was the index case with a positive bacterial culture from the biopsy. We therefore investigated all bacterial culture results of the other patients. In patient 5, two subsequent (2-year interval) nodes were H. influenzae-positive. No material was left to subtype and compare the bacterial strains. In patient 2, a non-typeable H. influenzae (NTHi) biotype III was cultured. In all three patients, H. influenzae was the only bacterial species cultured. In the other eight patients, including all four pNMZL cases, no material had been submitted for microbiological work-up. We designed a PCR assay for the gyrase gene of all H. influenzae strains (see the Materials and methods section). This assay also efficiently detects H. parahaemolyticus; however, this microorganism is epidemiologically irrelevant [4,12]. In dilutions of a positive control sample, 10–20 bacterial copies were reproducibly detected (Cp 35.37–35.78; Supplementary Table 2). Five samples of pNMZH that could be tested (cases 1–4 and 6) were positive, including the already H.influenzae culture-positive samples 2 and 3. Cp values ranged from 31.20 to 32.72, with a variation of less than 1 Cp between duplicate tests, suggesting approximately 5–20 × 103 bacteria per frozen tissue section (Figure 3A). Case 7 could not be tested by culture or PCR due to the lack of frozen material. Thus, in all six pNMZH patients that could be tested, H. influenzae (and less likely H. parahaemolyticus) was detected by culture and/or PCR. Three of four cases of pNMZL could also be tested by PCR, all cases being negative. The fourth case of pNMZL (case 11) could not be tested due to the lack of frozen tissue (Table 2). Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. www.pathsoc.org.uk

Apart from the biologically irrelevant negative controls (spleens and renal cell carcinomas) used together with each PCR analysis (see the Materials and methods section), we tested cervical lymph nodes from 28 children/adolescents with other types of reactive cervical lymphadenopathy, excluding cases of mycobacterial infections (age 1–24 years; 11 children < 13 years; see Supplementary Table 4). All samples except one were negative (Figure 3B). The exceptional case represented a 2-year-old child who underwent reconstructive surgery for a cleft palate, a cervical lymph node biopsy having been removed during surgery. PCR of this lymph node with follicular hyperplasia yielded inconsistent results in the nine independent PCR reactions on three frozen tissue sections, each section having been analysed in triplicate (Figure 3C). It is likely that this inconsistent positivity was caused by per-operative contamination from the naso/oropharynx.

Discussion Here we report on a new type of polyclonal cervical paediatric lymphadenopathy that is associated with invasive H. influenzae infection. Based on the presentation and involvement of marginal zone B-cells, we have provisionally called this disease ‘paediatric nodal marginal zone hyperplasia’ (pNMZH). This disorder is characterized by prominent, recurrent, and/or long-lasting unilateral and sometimes bilateral cervical lymphadenopathy in children who are otherwise not ill and do not have a specific history of immunodeficiency or frequent upper airway infections. The lymph nodes may be large (up to 4 cm) but the lymphadenopathy apparently is not deleterious, since half of the patients had lymphadenopathy for 1 year or longer before a lymph node was biopsied. The clinical and pathological spectrum of our pNMZH patients was overlapping but in many aspects also different from our four cases of pNMZL and the pNMZL cases that have been previously described [13–15]. In the series described by Jaffe’s group, several patients presented with masses other than cervical. Moreover, similar to our four pNMZL cases, J Pathol 2015; 236: 302–314 www.thejournalofpathology.com

Haemophilus influenzae in paediatric lymphadenopathy

311

Figure 2. Pathology of paediatric nodal marginal zone lymphoma. (A) Case 8. Low magnification of H&E staining. The biopsy shows expanded marginal zones. (B) Case 8. High magnification to show the centrocyte-like cells. (C) Case 8. BCL2 protein immunohistochemistry shows the positive tumour cells.

age was higher (median age 16 years). Histologically, a prominent nodular appearance with structures mimicking progressively transformed germinal centres and with disruption of follicular dendritic cell meshworks was present in both lesions. Expansion of monocytoid B-cells and the formation of easily recognizable marginal zones were, however, more pronounced in pNMZL than in pNMZH. The fibrotic bands seen in several of our pNMZH cases, and to a lesser extent also in our four cases of pNMZL, were not described in the literature [14]. The features also seem to overlap at the immunohistochemical level. In both lesions, the marginal zone B-cell phenotype was supported by the co-expression of IgD, loss of CD10 and BCL6, and increased expression of MUM1/IRF4 as well as IRTA1/CD307d. One possibly helpful diagnostic feature was the frequent BCL2 expression in the marginal zones of pNMZL. All six cases of pNMZH that could be tested by either culture or PCR were positive for H. influenzae, two cases being positive by both techniques. This confirmation by culture (in case 2 further characterized as H. influenzae, NTHi, bioptype III) and the relative infrequency of H. parahaemolyticus strongly support the idea that H. influenzae, and not H. parahaemolyticus, was involved. This finding seems to be highly specific, since the three cases of pNMZL that could be tested by PCR, as well as 27 of 28 age-matched paediatric reactive cervical lymph nodes with other morphologies, were negative. The single lymph node that contained very low numbers of bacterial copies was very likely contaminated during orofacial surgery. Unfortunately, we could not test the lymph node of the oldest patient with pNMZH (case 7, age 18 years) as the sensitive PCR assay was validated in frozen tissue only, this material not being available in all cases. This might have been very informative since H. influenzae especially Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. www.pathsoc.org.uk

colonizes the nasopharynx and tonsils in young children (see below). The biology of H. influenzae infection is complex. Apart from difficulties in the distinction from other species such as H. parainfluenzae, H. haemolyticus, and H. parahaemolyticus, there are numerous strains of H. influenzae with differences in virulence and clinical associations [9,16]. Since the effective vaccination programmes against H. influenzae type B started in 1990, many studies have been dedicated to the non-typeable H. influenzae strains that lack capsular polysaccharides. They play an important pathogenetic role in otitis media, sinusitis, chronic bronchitis, and community-acquired pneumonia. Together with other species such as M. catarrhalis, they transiently colonize the nasopharynx and tonsils of young children. Typically, each strain remains in the upper airway for a few months and is then replaced by a different strain [4,17]. Moreover, like many other species, H. influenzae sheds numerous so-called outer membrane vesicles (OMVs), which also play an important role in pathogenesis [18,19]. There are multiple mechanisms by which the bacterium and/or the shed OMVs can bind to and enter epithelial and other cells [6,20]. A mechanism in relation to B-cells is that H. influenzae, like M. catarrhalis, can specifically bind secreted IgD. Thus, locally secreted IgD in saliva may bind to the bacteria and thereby function as a defence barrier against H. influenzae. However, the bacteria can also be invasive in tonsillar tissue. By binding to surface IgD at the CH1 region, it is postulated to function as a superantigen [4,21–25]. In vitro experiments have shown that H. influenzae, and also OMV-mediated sIgD cross-linking, result in strong proliferation of IgD+ lymphocytes, secretion of poly-reactive IgM and IgD, production of IL6, and sensitization to BAFF [18,19]. In addition, the bacteria J Pathol 2015; 236: 302–314 www.thejournalofpathology.com

312

PM Kluin et al

A

B Amplification Curves

Amplification Curves

Select Zoom

14,389

19,846

13,389

18,346

12,389

16,846 15,346

Fluorescence (465-510)

Fluorescence (465-510)

11,389

Select Zoom

10,389

13,846

9,389

12,346

8,389

10,846

7,389 6,389 5,389 4,389

9,346 7,846 6,346

3,389

4,846

2,389

3,346

1,389

1,846

0,389

0,346

5

10

15

20

25

Cycles

30

35

40

45

5

10

15

20

25

Cycles

30

35

40

45

C Amplification Curves

Select Zoom

14,488 13,488 12,488

Fluorescence (465-510)

11,488 10,488 9,488 8,488 7,488 6,488 5,488 4,488 3,488 2,488 1,488 0,488

5

10

15

20

25

Cycles

30

35

40

45

Figure 3. Pathology of paediatric nodal marginal zone lymphoma. (A) Case 8. Low magnification of H&E staining. The biopsy shows expanded marginal zones. (B) Case 8. High magnification to show the centrocyte-like cells. (C) Case 8. BCL2 protein immunohistochemistry shows the positive tumour cells.

can also be internalized and can temporarily survive within human B-cells. This strongly suggests that the hyperplasia of IgMD+ marginal zone B-cells is pathogenetically related to this infection. We do not know why pNMZH is rare, whereas bacterial colonization of the upper airway is very common. Most importantly, our data suggest that although H. influenzae colonizes tonsillar tissues, it does not reach loco-regional lymph nodes, since all age-matched control cervical lymph nodes obtained percutaneously were negative. Because rare H. influenzae strains might be more virulent, we tried to re-culture and further characterize the bacterium from viably frozen cells that were available in one patient, but unfortunately this procedure failed. Sanger sequencing of the obtained bacterial gyrase PCR products also failed, likely due to the very small amount of DNA template generated (data not shown). In addition to bacterial features, host factors might also play a role. For instance, TLR4 gene polymorphisms have been associated with clearance of H. influenzae [26]. Although two patients had a history of ear, nose, and throat problems, none suffered from recurrent infections or signs of an underlying immunodeficiency. In patient 5, with recurrent bilateral disease and two positive cultures for H. influenzae, antibiotic treatment was unsuccessful, but treatment with Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. www.pathsoc.org.uk

prednisone resulted in complete regression. Moreover, all patients showed spontaneous remission of lymphadenopathy and no development of other diseases, also indicating that there was no underlying serious immune disorder. Another interesting feature in our series of pNMZH is the discordance between Ig protein expression (both in immunohistochemistry and in flow cytometry) and PCR analysis of IG gene rearrangements, also upon PCR analysis of individually dissected nodules. This discordance is reminiscent of the extranodal paediatric marginal zone lesions previously described in tonsils in which predominantly lambda-expressing B-cells and plasma cells were also seen, while IGH PCR yielded polyclonal results [27]. Since the oro/nasopharynx is an important portal of entry for H. influenzae, both lesions may be pathogenetically related. However, specific microorganisms were not searched for in the previous studies. Interestingly, so-called ‘IgD+ only’ B-cells in hyperplastic tonsils without these marginal zone lesions show a very high level of somatic hypermutations [28] and subsequent analysis showed that they reflect relatively large clones that almost exclusively express lambda light chains as well [29,30]. Predominant Ig-lambda expression without monoclonality at the DNA level was also described in HHV8-infected J Pathol 2015; 236: 302–314 www.thejournalofpathology.com

Haemophilus influenzae in paediatric lymphadenopathy

B-cells in multicentric Castleman disease [31]. The skewed light chain expression in these different conditions might be explained by chronic inflammation and NFκB-mediated B-cell receptor editing, a process that specifically targets IGL, relatively late in B-cell ontogeny [32]. However, such a mechanism has been disputed by others [30,33]. Alternatively, it may be that the bacterial superantigen selectively binds not only the CH1 region of IgD but also a region of the Ig-lambda protein, thereby skewing the light chain expression of the expanded B-cells. In conclusion, we describe a novel type of cervical lymphadenopathy in young children with expansion of polyclonal but often Ig-lambda isotype-expressing marginal zone B-cells, which very likely is H. influenzae-driven. Perhaps other microorganisms such as M. catarrhalis that interact in a similar way with IgD may be detected in other patients. Most importantly, this disorder should be distinguished from monoclonal paediatric marginal zone lymphoma.

Acknowledgment We thank Erlin Haacke for performing the IRTA1 immunohistochemistry.

Author contribution statement PMK designed the study, analysed data, and wrote the manuscript. AWL supervised and analysed all IG clonality studies and helped to write the manuscript. JB-V performed most of the PCR experiments for H. influenzae and beta globin. WRRG-G performed all central IG clonality studies. LV designed and performed IgD FACS analyses and helped to write the manuscript. BR prepared all frozen specimens for PCR analysis. JVB and KHL contributed two cases. KS and PdW contributed one case. RK contributed one case and five control samples. ES performed many clonality studies and helped to write the manuscript. SR revised several cases. AD revised several cases and helped to write the manuscript. MMvN and CMZ treated two patients and provided clinical information and follow-up. JCBH, MH, and JWJvE treated one patient and provided clinical information and follow-up. EJvdG and EdB treated two patients and provided clinical information and follow-up. HCK-N treated one patient, provided clinical information and follow-up, and helped to write the manuscript. RHW and JRLtF provided microbiological information. AGMvdZ designed all PCR tests for Haemophilus influenzae, supervised testing of clinical materials, and helped to write the manuscript.

References 1. Suarez F, Lortholary O, Hermine O, et al. Infection-associated lymphomas derived from marginal zone B cells: a model of antigen-driven lymphoproliferation. Blood 2006; 107: 3034–3044. Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. www.pathsoc.org.uk

313

2. Zuckerman E, Zuckerman T, Levine AM, et al. Hepatitis C virus infection in patients with B-cell non-Hodgkin lymphoma. Ann Intern Med 1997; 127:423-428. 3. Hermine O, Lefrere F, Bronowicki JP, et al. Regression of splenic lymphoma with villous lymphocytes after treatment of hepatitis C virus infection. N Engl J Med 2002; 347:89–94. 4. Singh K, Nordstrom T, Morgelin M, et al. Haemophilus influenzae resides in tonsils and uses immunoglobulin D binding as an evasion strategy. J Infect Dis 2014; 209:1418–1428. 5. Garcia-Rodriguez JA, Fresnadillo Martinez MJ. Dynamics of nasopharyngeal colonization by potential respiratory pathogens. J Antimicrob Chemother 2002; 50 (Suppl S2):59–73. 6. Clementi CF, Murphy TF. Non-typeable Haemophilus influenzae invasion and persistence in the human respiratory tract. Front Cell Infect Microbiol 2011; 1:1. 7. Murphy TF, Faden H, Bakaletz LO, et al. Nontypeable Haemophilus influenzae as a pathogen in children. Pediatr Infect Dis J 2009; 28:43–48. 8. Peerbooms PG, Engelen MN, Stokman DA, et al. Nasopharyngeal carriage of potential bacterial pathogens related to day care attendance, with special reference to the molecular epidemiology of Haemophilus influenzae. J Clin Microbiol 2002; 40:2832–2836. 9. Van Eldere J, Slack MP, Ladhani S, et al. Non-typeable Haemophilus influenzae, an under-recognised pathogen. Lancet Infect Dis 2014; 14: 1281–1292. 10. van Krieken JH, Langerak AW, Macintyre EA, et al. Improved reliability of lymphoma diagnostics via PCR-based clonality testing: report of the BIOMED-2 Concerted Action BHM4-CT98-3936. Leukemia 2007; 21:201–206. 11. Langerak AW, Groenen PJ, Bruggemann M, et al. EuroClonality/BIOMED-2 guidelines for interpretation and reporting of Ig/TCR clonality testing in suspected lymphoproliferations. Leukemia 2012; 26:2159–2171. 12. Frickmann H, Podbielski A, Essig A, et al. Difficulties in species identification within the genus Haemophilus – a pilot study addressing a significant problem for routine diagnostics. Eur J Microbiol Immunol (Bp) 2014; 4:99–105. 13. Rizzo KA, Streubel B, Pittaluga S, et al. Marginal zone lymphomas in children and the young adult population; characterization of genetic aberrations by FISH and RT-PCR. Mod Pathol 2010; 23:866–873. 14. Taddesse-Heath L, Pittaluga S, Sorbara L, et al. Marginal zone B-cell lymphoma in children and young adults. Am J Surg Pathol 2003; 27:522–531. 15. Elenitoba-Johnson KS, Kumar S, Lim MS, et al. Marginal zone B-cell lymphoma with monocytoid B-cell lymphocytes in pediatric patients without immunodeficiency. A report of two cases. Am J Clin Pathol 1997;107:92–98. 16. LaCross NC, Marrs CF, Gilsdorf JR. Population structure in nontypeable Haemophilus influenzae. Infect Genet Evol 2013; 14:125–136. 17. Erwin AL, Smith AL. Nontypeable Haemophilus influenzae: understanding virulence and commensal behavior. Trends Microbiol 2007; 15:355–362. 18. Deknuydt F, Nordstrom T, Riesbeck K. Diversion of the host humoral response: a novel virulence mechanism of Haemophilus influenzae mediated via outer membrane vesicles. J Leukoc Biol 2014; 95:983–991. 19. Vidakovics ML, Jendholm J, Morgelin M, et al. B cell activation by outer membrane vesicles – a novel virulence mechanism. PLoS Pathog 2010; 6:e1000724. 20. Geme JW III. Molecular determinants of the interaction between Haemophilus influenzae and human cells. Am J Respir Crit Care Med 1996; 154:S192-S196. J Pathol 2015; 236: 302–314 www.thejournalofpathology.com

314

21. Ruan MR, Akkoyunlu M, Grubb A, et al. Protein D of Haemophilus influenzae. A novel bacterial surface protein with affinity for human IgD. J Immunol 1990; 145:3379–3384. 22. Forsgren A, Penta A, Schlossman SF, et al. Branhamella catarrhalis activates human B lymphocytes following interactions with surface IgD and class I major histocompatibility complex antigens. Cell Immunol 1988; 112:78–88. 23. Chen K, Xu W, Wilson M, et al. Immunoglobulin D enhances immune surveillance by activating antimicrobial, proinflammatory and B cell-stimulating programs in basophils. Nature Immunol 2009; 10:889–898. 24. Samuelsson M, Hallstrom T, Forsgren A, et al. Characterization of the IgD binding site of encapsulated Haemophilus influenzae serotype b. J Immunol 2007; 178:6316–6319. 25. Jendholm J, Morgelin M, Perez Vidakovics ML, et al. Superantigen- and TLR-dependent activation of tonsillar B cells after receptor-mediated endocytosis. J Immunol 2009; 182: 4713–4720. 26. Liadaki K, Petinaki E, Skoulakis C, et al. Toll-like receptor 4 gene (TLR4), but not TLR2, polymorphisms modify the risk of tonsillar disease due to Streptococcus pyogenes and Haemophilus influenzae. Clin Vaccine Immunol 2011; 18:217–222. 27. Attygalle AD, Liu H, Shirali S, et al. Atypical marginal zone hyperplasia of mucosa-associated lymphoid tissue: a reactive condition of

PM Kluin et al

28.

29.

30.

31.

32.

33.

childhood showing immunoglobulin lambda light-chain restriction. Blood 2004; 104:3343–3348. Liu YJ, de Bouteiller O, Arpin C, et al. Normal human IgD + IgM− germinal center B cells can express up to 80 mutations in the variable region of their IgD transcripts. Immunity 1996; 4:603–613. Arpin C, de Bouteiller O, Razanajaona D, et al. The normal counterpart of IgD myeloma cells in germinal center displays extensively mutated IgVH gene, Cmu-Cdelta switch, and lambda light chain expression. J Exp Med 1998; 187:1169–1178. Seifert M, Steimle-Grauer SA, Goossens T, et al. Model for the development of human IgD-only B cells: genotypic analyses suggest their generation in superantigen driven immune responses. Mol Immunol 2009; 46:630–639. Du MQ, Liu H, Diss TC, et al. Kaposi sarcoma-associated herpesvirus infects monotypic (IgM lambda) but polyclonal naive B cells in Castleman disease and associated lymphoproliferative disorders. Blood 2001; 97:2130–2136. Derudder E, Cadera EJ, Vahl JC, et al. Development of immunoglobulin lambda-chain-positive B cells, but not editing of immunoglobulin kappa-chain, depends on NF-kappaB signals. Nature Immunol 2009; 10:647–654. van der Burg M, Bende RJ, Aarts WM, et al. Biased Igλ expression in hypermutated IgD multiple myelomas does not result from receptor revision. Leukemia 2002; 16:1358–1361.

SUPPORTING INFORMATION ON THE INTERNET The following supporting information may be found in the online version of this article: Figure S1. Primer and probes sequences were selected on the basis of available NCBI sequences. Table S1. Antibodies used in the central laboratory. Table S2. Sensitivity of H. influenzae PCR on a control sample with 10–20 × 103 copies/μl (Amplirun Haemophilus influenzae DNA control, Vircell, Granada, Spain). Table S3. Sensitivity of H. influenzae PCR in a clinical control sample. Table S4. Control cervical lymph nodes.

Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. www.pathsoc.org.uk

J Pathol 2015; 236: 302–314 www.thejournalofpathology.com