Journal of Antimicrobial Chemotherapy Advance Access published June 30, 2015
J Antimicrob Chemother doi:10.1093/jac/dkv181
OXA-372, a novel carbapenem-hydrolysing class D b-lactamase from a Citrobacter freundii isolated from a hospital wastewater plant Alberto Antonelli1,2, Marco Maria D’Andrea1, Guendalina Vaggelli3, Jean-Denis Docquier1 and Gian Maria Rossolini1–3* 1
Department of Medical Biotechnology, University of Siena, Siena, Italy; 2Department of Experimental and Clinical Medicine, University of Florence, Florence, Italy; 3Clinical Microbiology and Virology Unit, Florence Careggi University Hospital, Florence, Italy
Received 10 April 2015; returned 15 May 2015; revised 1 June 2015; accepted 3 June 2015 Objectives: The objective of this study was to characterize a novel class D carbapenemase, named OXA-372, identified in a carbapenem-resistant Citrobacter freundii strain (Cfr-FI-07) isolated from a hospital wastewater plant in central Italy. Methods: Cfr-FI-07 was isolated using a selective chromogenic medium for carbapenem-resistant Enterobacteriaceae. Carbapenemase production was confirmed by spectrophotometric assay. WGS was carried out using an Illumina MiSeq platform. The functional profile of OXA-372 was investigated by expression of the cloned gene in Escherichia coli and by analysis of kinetic parameters of the purified enzyme. Results: C. freundii Cfr-FI-07 produced carbapenemase activity, but tested negative for common carbapenemase genes. WGS confirmed the absence of known carbapenemase genes and revealed the presence of a novel class D b-lactamase (DBL) determinant, named blaOXA-372, encoding a protein distantly related to other DBLs. In E. coli, production of OXA-372 conferred resistance to penicillins, including temocillin, and reduced susceptibility to carbapenems, while susceptibility to expanded-spectrum cephalosporins was virtually unaffected. This substrate specificity was confirmed by kinetic characterization of the purified enzyme, which exhibited high catalytic efficiencies for carbapenems (kcat/KM values ≥0.22 s21.mM21). The blaOXA-372 gene was associated with a genetic platform of original structure consisting of a Tn402/Tn5053 hybrid transposon derivative, named Tn6255, inserted into a TnPa38-like transposon, named Tn6256, located on an IncA/C-IncN plasmid of approximately 140 kb. Conclusions: OXA-372 is a novel class D carbapenemase, belonging to a new lineage of DBLs, encoded by a gene associated with mobile elements. Functional properties revealed similarities, but also some differences, compared with other class D carbapenemases.
Introduction The emergence of carbapenem-resistant Enterobacteriaceae (CRE) is one of the most challenging developments of microbial drug resistance, given the very limited repertoire of treatment options available for CRE strains and their potential clinical impact.1,2 Although the reduced outer-membrane permeability associated with the overproduction of an ESBL or AmpC-type b-lactamase can be responsible for carbapenem resistance, carbapenemase production is the most important carbapenem-resistance mechanism in Enterobacteriaceae.3,4 In some settings, carbapenemaseproducing Enterobacteriaceae have achieved remarkable rates and are now posing a significant clinical challenge.3 – 8 Currently, several types of carbapenemase genes, associated with mobile DNA elements, are spreading among Enterobacteriaceae, namely those encoding class A KPC-type b-lactamases, class B metallo b-lactamases of the VIM, IMP and NDM types, and
class D b-lactamases of the OXA-48 lineage.3,4,6,8 The latter enzymes are the most common carbapenem-hydrolysing class D b-lactamases (CHDLs) found in Enterobacteriaceae and, in several countries, have become also the most common type of acquired carbapenemases among CRE isolates.9 – 13 In this study, we have identified and characterized a novel acquired CHDL, named OXA-372, from Citrobacter freundii isolated from a hospital wastewater plant in central Italy. OXA-372 belongs to a new CHDL lineage and exhibits a strong hydrolytic activity against carbapenems and penicillins. The OXA-372-encoding gene is associated with a mobile genetic element of original structure, carried on a plasmid, underscoring its potential for dissemination.
Materials and methods Bacterial strains C. freundii Cfr-FI-07 was isolated in September 2013, following a screening for CRE of hospital wastewaters from Florence Careggi University Hospital
# The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: [email protected]
1 of 8
Downloaded from http://jac.oxfordjournals.org/ at University of Alabama at Birmingham on July 24, 2015
*Corresponding author. Department of Experimental and Clinical Medicine, University of Florence, Policlinico Careggi, I-50134 Florence, Italy. Tel: +39-055-7949239; Fax: +39-055-7949289; E-mail: [email protected]
Antonelli et al.
(central Italy). Escherichia coli DH5a14 was used as a host for recombinant plasmids. E. coli DH10B15 and J53aziR16 were used as hosts for electrotransformation and conjugation experiments, respectively.
Antimicrobial susceptibility testing MICs were determined by the broth microdilution method according to CLSI guidelines17 and interpreted following EUCAST clinical breakpoints.18
Screening for CRE in hospital wastewaters and characterization of CRE isolates
DNA sequencing and sequence analysis WGS of Cfr-FI-07 was performed using an Illumina MiSeq system (Illumina Inc., San Diego, CA, USA) and a paired-end approach (2×250 bp) with an average insert size of 500 bp. De novo assembly was performed using ABySS software.22 Contigs obtained with ABySS were annotated by the RAST web-server.23 The structure of the genetic context of blaOXA-372, obtained by results of draft genomic sequencing, was confirmed by PCR mapping and Sanger sequencing of the regions unresolved by the ABySS assembler. Sanger sequencing was carried out at an external sequencing facility (Macrogen Inc., Seoul, Korea). Sequence comparisons were performed using the BLAST web server at the NCBI web site (http://blast. ncbi.nlm.nih.gov/). Diagrams showing structural comparisons of transposon structures were obtained using EasyFig.24 Amino acid sequence alignment was performed using AlignX (Invitrogen, Carlsbad, CA, USA) and a tree diagram was constructed using the TREEVIEW program.25
Conjugation experiments were performed in solid medium as previously described,26 using E. coli J53aziR as the recipient strain. Temocillin (75 mg/L) was used for the selection of transconjugants and sodium azide (150 mg/L) for counterselection of the donor. Electroporation experiments were performed with electrocompetent E. coli DH10B using a plasmid DNA preparation from Cfr-FI-07, as described previously.26 Transformants were selected on LB agar containing temocillin (50 mg/L). S1 nuclease mapping and plasmid rep typing were performed as previously described.27 – 30
Cloning of the blaOXA-372 gene and purification of OXA-372 produced in E. coli The gene encoding OXA-372 was amplified by PCR using primers OXA-372-cf-fwd and OXA-372-cf-rev (Table 1), carrying an NdeI and a BamHI linker, respectively, and cloned into the pLBII expression vector (a derivative of pBC-SK)31 digested with the same enzymes to obtain recombinant plasmid pLBII-OXA-372, to be used for expression experiments in E. coli. For protein purification, OXA-372 was produced as a glutathioneS-transferase (GST) fusion protein. The nucleotide sequence encoding the deduced mature protein (starting at amino acid 19) was amplified using primers OXA-372_GST_EXP/f and OXA-372_GST_EXP/r (Table 1) carrying a BamHI and an EcoRI linker, respectively, and cloned in plasmid vector pGEX-2T,32 to yield pGEX-OXA-372, which was used to transform E. coli DH5a. The authenticity of cloned DNA fragments in pLBII-OXA-372 and pGEX-OXA-372 vectors was confirmed by sequencing on both strands. The recombinant OXA-372 b-lactamase was produced by growing E. coli DH5a(pGEX-OXA-372) in 500 mL of ZYP-5052 medium for 24 h at 378C with orbital shaking.33 Bacterial cells were then harvested by centrifugation (10 000 g for 30 min at 48C), resuspended in 50 mL of 10 mM HEPES buffer (pH 7.5) and lysed by sonication (Labsonic L sonicator; B. Braun, Melsungen, Germany). The resulting lysate was then clarified by centrifugation (77 000 g for 60 min at 48C) and loaded onto a GSTrap FF affinity column (bed volume, 5 mL; GE Healthcare, Uppsala, Sweden) equilibrated with 10 mM HEPES buffer (pH 7.5). After washing with the same buffer, bound proteins were eluted using 10 mM HEPES buffer (pH 7.5) containing 10 mM reduced glutathione (Sigma-Aldrich, St Louis, MO, USA). Fractions showing b-lactamase activity were pooled and desalted using a HiPrep 26/10 column (GE Healthcare) in 100 mM Tris/100 mM K2SO4 (pH 7.5). The GST moiety was then cleaved by incubating the protein sample in the presence of 0.008 U/mg thrombin (Sigma-Aldrich) for 48 h at room temperature. The purified b-lactamase was obtained by loading the sample onto the GSTrap FF HiTrap column equilibrated with 50 mM Tris/ 100 mM K2SO4 (pH 7.5) (to remove any uncleaved fusion protein) and then onto a HiTrap Benzamidine FF column (bed volume, 1 mL; GE Healthcare) equilibrated with 50 mM Tris/100 mM K2SO4 (pH 7.5), to remove the thrombin protease. This strategy eventually yielded a recombinant protein including the mature OXA-372 (amino acids 19–257) plus
Table 1. Oligonucleotide primers used in this study Primer name OXA-372-cf-fwd OXA-372-cf-rev OXA-372_GST_EXP/f OXA-372_GST_EXP/r
Sequence (5′ -3′ )
Purpose
GGAATTCCATATGATGCATATTTTTTTGGTCTTTC CGGGATCCCCACTCAGGGAATAATGCGT CGCGGATCCGGCGAGGACAAAGCTATTTCGGC CCGGAATTCTCAGGGAATAATGCGTTCAGC
cloning of blaOXA-372 in pLBII cloning of blaOXA-372 in pLBII cloning of blaOXA-372 in pGEX-2T cloning of blaOXA-372 in pGEX-2T
NdeI, EcoRI and BamHI restriction sites used for cloning are underlined, while the regions targeting the blaOXA-372 gene are in bold.
2 of 8
Downloaded from http://jac.oxfordjournals.org/ at University of Alabama at Birmingham on July 24, 2015
To this purpose, 10 mL of a wastewater sample collected from the outlet of the hospital sewers, and dilutions thereof, were plated onto chromIDw CARBA agar (bioMe´rieux, Marcy-l’E´toile, France) and plates were incubated at 378C for 18 h. All colonies with different morphology grown on the selective and indicator medium were identified by MALDI-TOF MS (Vitek MS; bioMe´rieux) and carbapenem resistance was confirmed by susceptibility testing. In confirmed CRE isolates, genes encoding carbapenemases of the IMP, VIM, NDM, SPM, AIM, DIM, GIM, SIM, KPC, BIC and OXA-48 types were screened by a multiplex-PCR method as previously described.19 In strains yielding negative results with PCR, carbapenemase production was investigated by measuring the imipenem-hydrolysing specific activity in bacterial crude extracts as described previously,20 using a Cary 100 UV – Vis (Varian, Walnut Creek, CA, USA) spectrophotometer. A phenotypic combo-disc test for the differentiation of class A and class B carbapenemases based on differential inhibition by 3-aminophenylboronic acid (PBA) and EDTA was carried out as described previously.21 Protein concentration in solution was determined with the Bio-Rad protein assay (Bio-Rad, Richmond, CA, USA), using BSA (Thermo Scientific, IL, USA) as the standard.
Gene transfer and plasmid analysis experiments
JAC
Novel class D carbapenemase OXA-372
an extra Gly residue at its amino-terminus. The purified protein appeared as a single band (purity .95%) of 27 kDa by SDS-PAGE (data not shown).
Determination of kinetic parameters
Results and discussion Screening for CRE in a hospital wastewater plant: isolation of a C. freundii putatively producing a new carbapenemase A screening for CRE was carried out with a sample collected in September 2013 from the wastewater plant of Florence University Hospital, a large tertiary-care teaching hospital located in central Italy where CREs have been endemic since 2011.35 The screening was carried out by plating the sample onto a selective chromogenic medium and yielded five colonies of confirmed CRE from a 10 mL undiluted sample, including two Klebsiella pneumoniae, one E. coli, one Enterobacter cloacae and one C. freundii. PCR analysis of carbapenemase genes revealed the presence of blaKPC in most CRE isolates (one K. pneumoniae and the E. cloacae and E. coli isolates) and the presence of blaVIM in the other K. pneumoniae isolate, while negative PCR results were obtained with the C. freundii isolate, named Cfr-FI-07.
Analysis of the b-lactamase resistome in C. freundii Cfr-FI-07 and identification of a new class D b-lactamase, OXA-372 Using a WGS approach, the draft genome of C. freundii Cfr-FI-07 was obtained and analysed for the presence of b-lactamase-encoding genes. The analysis revealed the presence of the resident ampCtype gene of C. freundii (accession no. KP981366), encoding an original variant, named CMY-135, with the highest similarity (99% identical) to CMY-48 (accession no. ADP02979.1), plus three additional acquired b-lactamase genes. These included blaOXA-10, an original blaMOX gene variant named blaMOX-9 (accession number KJ746495) and a novel class D b-lactamase gene that was named blaOXA-372 (accession number KJ746496). Amino acid sequence comparison showed that OXA-372 was distantly related to other class D b-lactamases, with a maximum of 56% identity with OXA-198 (Figure 1), a class D b-lactamase with weak carbapenemase activity previously described in a Pseudomonas aeruginosa clinical isolate from Belgium.36 Identity with other lineages of CHDLs was lower (43% with OXA-48; 33% with OXA-58; 31% with OXA-24; and 28% with OXA-23; Figure 1). The conserved Y/F – G – N motif at Ambler
Table 2. Antimicrobial susceptibility of C. freundii Cfr-FI-07, E. coli DH5a(pLBII-OXA-372) (producing the OXA-372 enzyme) and E. coli DH10B(pCfr-FI-07) to different b-lactams; susceptibilities of E. coli DH5a carrying the empty vector (pBC-SK) and of E. coli DH10B are also shown for comparison MIC (mg/L) Antibiotic Penicillin G Ticarcillin Ampicillin Oxacillin Temocillin Cefalotin Aztreonam Imipenem Meropenem Ertapenem Cefotaxime Ceftazidime Cefepime Ceftriaxone
Cfr-FI-07
DH5a(pLBII-OXA-372)
DH5a(pBC-SK)
DH10B(pCfr-FI-07)
DH10B
.256 .256 .256 .256 .256 .256 8 .32 16 16 .32 .32 4 .32
.256 256 128 .256 128 8 0.25 2 0.06 0.03 0.06 0.25 0.125 0.03
64 4 4 256 8 8 0.25 0.125 ≤0.015 ≤0.015 0.06 0.125 0.06 0.03
.256 .256 .256 .256 .256 8 4 2 0.25 1 0.25 4 0.5 0.125
64 4 4 256 8 4 0.5 0.25 0.03 ≤0.015 0.06 0.25 0.125 0.03
3 of 8
Downloaded from http://jac.oxfordjournals.org/ at University of Alabama at Birmingham on July 24, 2015
The kinetic parameters for the hydrolysis of b-lactam substrates by the purified OXA-372 enzyme were determined spectrophotometrically using a Cary 100 UV – Vis instrument in 20 mM Tris/0.3 M K2SO4 buffer (pH 7.5) containing 50 mM Na2CO3 in a final reaction volume of 500 mL. The purified OXA-372 enzyme was diluted in the same buffer supplemented with 20 mg/L BSA to prevent enzyme denaturation. The steady-state kinetic parameters (kcat and KM) were calculated either using the nonlinear fit of the initial reaction rates with the Henri – Michaelis – Menten equation or using the Hanes – Woolf linearization method.34 KM values below 20 mM were measured as inhibition constants using a competitive inhibition model34 and 250 mM benzylpenicillin as the reporter substrate.
In vitro susceptibility testing showed that Cfr-FI-07 was resistant or intermediate to all tested b-lactam antibiotics, including penicillins, narrow- and expanded-spectrum cephalosporins and carbapenems (Table 2). A crude extract of Cfr-FI-07 showed hydrolytic activity against imipenem (specific activity, 8.1+0.7 nmol/min/mg of protein), which was not inhibited by EDTA. Moreover, a phenotypic combo-disc test for differentiation of class A and class B carbapenemases based on differential inhibition by PBA and EDTA21 did not yield significant differences in the growth-inhibition zone diameters around the meropenem, meropenem-PBA and meropenem-EDTA discs. Taken together, these results suggested that Cfr-FI-07 produced a novel type of active site-serine carbapenemase that was resistant to PBA.
Antonelli et al.
(a)
Downloaded from http://jac.oxfordjournals.org/ at University of Alabama at Birmingham on July 24, 2015
(b)
Figure 1. (a) Phylogenetic tree showing the relationship of OXA-372 with other acquired class D b-lactamases (CHDLs are underlined), whose sequences were retrieved from the Lahey Clinic web site (http://www.lahey.org/Studies). (b) Amino acid sequence alignment of OXA-372 with selected CHDLs, in which the conserved motifs (black) and other relevant regions, such as the poorly conserved YGN motif (shaded in grey) and the PxxG motif (boxed) found in all CHDLs, are highlighted; the secondary structure elements of OXA-48 are indicated above the sequences.
positions 144–146,37 characteristic of most class D b-lactamases, was found to be slightly different in OXA-372, which presents a Y – G – V motif (Figure 1b). Moreover, the PxxG motif at positions 217 – 220 in the OXA-48 numbering, which is common to most
4 of 8
class D carbapenemases, but absent in other OXA-type enzymes,38 was present in OXA-372 and its composition (PQIG) was in between that of Acinetobacter class D carbapenemases (PQVG) and that of OXA-48-like enzymes (PKIG) (Figure 1b).
JAC
Novel class D carbapenemase OXA-372
Altogether, these features identified OXA-372 as representative of a new lineage of class D b-lactamases, with some unique structural features.
Genetic context of blaOXA-372
Functional characterization of OXA-372 Expression of OXA-372 in E. coli DH5a(pLBII-OXA-372) conferred high-level resistance to penicillins (MICs ≥128 mg/L) and reduced susceptibility to carbapenems (Table 2), while the MIC values of cephalosporins and aztreonam were not affected. This strain was confirmed to produce carbapenemase activity using a spectrophotometric assay (imipenem-hydrolysing specific activity, 48.8+0.6 nmol/min/mg of protein).
(a)
(b)
Figure 2. Genetic context of the blaOXA-372 gene. Regions showing ≥99% nucleotide sequence identity are connected by dotted areas or lines. (a) Structure of transposon Tn6255 and comparison with homologous transposon Tn6017.41 The IRi (5′ -TGTCGTTTTCAGAAGACGGCTGCAC-3′ ) and IRt (5′ -TGTCGTTTTCAGAAGACGACCGCAC-3′ ) of Tn6255 are indicated by white diamonds and 5 bp direct repeat sequences flanking Tn6255 are indicated. (b) Structure of transposon Tn6256 and comparison with homologous transposon TnPa38 44 and transposons described in plasmids pESA2/ pKPN_CZ.47 Direct repeat sequences (5′ -ATGCA-3′ ) flanking Tn6256 are reported. Uncharacterized ORFs are indicated by the letter O followed by a number (O1, DNA-invertase, pin homologue; O2/O3/O4/O6, hypothetical proteins; O5, cupin 2 conserved barrel domain protein; O7, DNA-polymerase).
5 of 8
Downloaded from http://jac.oxfordjournals.org/ at University of Alabama at Birmingham on July 24, 2015
Conjugation experiments with E. coli J53aziR failed to demonstrate the transferability of the blaOXA-372 gene (detection limit 1029 transconjugant/recipient). On the other hand, plasmid DNA could be transferred from Cfr-FI-07 into E. coli DH10B by electroporation, using a plasmid DNA preparation from the former strain, and yielded transformants exhibiting reduced susceptibility to both penicillins and carbapenems (Table 2). S1 nuclease analysis followed by hybridization with a blaOXA-372-specific probe revealed that, both in Cfr-FI-07 and in a randomly selected transformant [DH10B(pCfr-FI-07)], the gene was harboured on a plasmid of approximately 140 kb (data not shown). Replicon typing, carried out with a plasmid preparation purified from the DH10B(pCfr-FI-07) transformant, yielded a positive result for IncA/C and IncN, suggesting a multireplicon nature of the plasmid. Analysis of the genetic context of blaOXA-372 revealed that the gene was carried on a defective transposon of original structure, named Tn6255, belonging to the Tn402/Tn5053 lineage. Tn6255 contains remnants of the tniR 99% identical to that of Tn402/ Tn5090 39 and remnants of the tniA gene identical to that of Tn5053 40 separated by an IS26. The blaOXA372 gene was located between DtniR and the IRi terminal inverted repeat. Transposons of this lineage, with a hybrid tni module similar to that of Tn6255, were previously described in plasmids from Citrobacter youngae (Tn6017), 41 Pseudomonas putida 42 and Enterobacter cloacae (Tn6007).43 Interestingly, those elements carried a complete tni module and also an integron platform, which is absent in Tn6255
(Figure 2a), suggesting that the latter transposon was likely derived from a Tn6017-like precursor by extensive deletion and recombination events. Analysis of the sequences flanking blaOXA-372, however, did not reveal any clues to the recombination mechanism involved in the mobilization of the b-lactamase gene. Tn6255, in turn, was inserted into a Tn3-family transposon of original structure, named Tn6256 (accession no. KP851978), and was flanked by 5 bp direct repeats (Figure 2b), revealing a history of insertion by transposition. Tn6256 is related to TnPa38, a Tn3-family transposon originally described in a genomic island (GI7) of clinical isolates of a P. aeruginosa clone from Denmark (Figure 2b),44 and with similar elements detected in the genomes of other strains of P. aeruginosa (strain PA38182, accession no. HG530068) and P. putida 45 as well as on plasmids pFBAOT6 from Aeromonas punctata,46 pKPN_CZ from K. pneumoniae 47 and pESA2 from Cronobacter sakazakii (accession no. CP000784). The major differences between Tn6256 and those elements consisted of the presence of two IS5075-like elements inserted in the opposite direction into the terminal IRs and the presence of Tn6255 (Figure 2b). Tn6256 was flanked by 5 bp direct repeats, revealing a transposition history (Figure 2b).
Antonelli et al.
Table 3. Kinetic parameters measured for the purified OXA-372 b-lactamase kcat (s21) Substrate
OXA-372
OXA-48a
OXA-198b
OXA-372
OXA-48a
OXA-198b
OXA-372
OXA-48a
OXA-198b
40 145 85 110 3 0.17 NHd NH NH NH 5.8 0.13 0.49 NH
446 130 955 45 0.3 44 .9 — NH .0.6 4.8 0.07 0.13 NH
15 25 37 —c — 0.19 NH — NH NH 0.1 0.01 — NH
110 125 85 190 35 57 — — — — 26 0.7e 0.25e —
79 95 395 55 45 195 .900 — — .550 13 11 100 —
14 30 216 — — 12 — — — — 0.15 0.006 — —
2.8 1.2 1.0 0.58 0.086 0.003 — — — — 0.22 0.52 0.7 —
5.6 1.4 2.4 0.82 0.0066 0.23 0.01 — — 0.0011 0.37 0.0062 0.0013 —
1.1 0.83 0.17 — — 0.016 — — — — 0.67 1.7 — —
Data are the means of three independent measurements. Standard deviations were always within 10% of the mean values. Kinetic parameters for OXA-48 and OXA-198 are also shown for comparison. a Kinetic parameters for all antibiotics, except benzylpenicillin (determined in this study) and ticarcillin and aztreonam,49 are from Docquier et al.48 b Kinetic parameters for all antibiotics are from El Garch et al.36 c —, No data available. d NH, no hydrolysis could be detected with concentrations of enzyme up to 340 nM. e Determined as Ki with benzylpenicillin as the substrate.
To further characterize the functional properties of OXA-372, the protein was produced in E. coli and purified. Initial attempts to produce OXA-372 in its native form, using a T7 promoter-based expression system, yielded only low protein amounts (data not shown). For this reason, OXA-372 lacking the putative leader peptide (amino acids 19–257) was produced as a GST fusion protein and the GST moiety was enzymatically removed after the first step of affinity purification. This approach eventually yielded approximately 1 mg of purified OXA-372 per litre of culture. The kinetic parameters for the hydrolysis of b-lactam substrates (Table 3) were in overall agreement with the substrate profile deduced from the in vitro susceptibility data. OXA-372 showed high hydrolytic efficiencies with penicillins, including temocillin. Among cephalosporins, cefalotin was very poorly hydrolysed, while none of the tested oxyiminocephalosporins was hydrolysed at measurable rates. All tested carbapenems were good substrates of OXA-372, with high catalytic efficiencies (kcat/KM values, ≥0.22 s21.mM21). However, important differences were observed in the individual kinetic parameters for the hydrolysis of these substrates. Indeed, the turnover rate for imipenem was 12- and 45-fold higher than that observed with ertapenem and meropenem, respectively, while the KM values were significantly lower for the latter substrates. When compared with other class D carbapenemases, OXA-372 exhibited some similarities with OXA-198, especially regarding the low activity against cefalotin. Altogether, these findings confirmed the carbapenemase nature of OXA-372 and its potential for conferring carbapenem resistance to enterobacterial hosts. Interestingly, among the naturally occurring class D carbapenemases, OXA-372 exhibits one of the highest turnover rates for imipenem, being comparable to that of OXA-48,48,49 but 7-, 28- and 58-fold higher than those
6 of 8
of OXA-24, OXA-23 and OXA-58, respectively.50,51 However, and despite the fact that OXA-48 and OXA-372 show overall similar kinetic parameters for the hydrolysis of imipenem, these enzymes exhibit significant functional differences, in particular regarding their ability to hydrolyse cephalosporins. In fact, OXA-48 exhibited a higher catalytic efficiency for the hydrolysis of cefalotin (75-fold higher than OXA-372), while cefotaxime and cefepime were not hydrolysed at detectable levels by OXA-372, unlike OXA-48.48
Conclusions Several acquired carbapenem-hydrolysing b-lactamases have been identified in carbapenem-resistant clinical isolates of C. freundii, including class B metallo-enzymes of the VIM, IMP and NDM types,52 – 54 and some class A carbapenemases (i.e. KPC-2 and KPC-3)55,56 and class D carbapenemases (i.e. OXA-48 and OXA-181).10 In this study, we have characterized a new class D carbapenemhydrolysing b-lactamase, named OXA-372, from a C. freundii isolated from a nosocomial wastewater plant. The new OXA-372 enzyme belongs to a new lineage of class D carbapenemases, underscoring that additional enzymes with carbapenemase activity can be present in this growing b-lactamase class. Comparison of the functional features of OXA-372 with those of other CHDLs, including OXA-48 and OXA-198, revealed interesting similarities, but also significant differences. For this reason, OXA-372 could be an additional interesting model for studying the structure/function relationships of class D carbapenemases. Following identification of this new class D carbapenemase determinant, we have screened (since 2014) for its presence all
Downloaded from http://jac.oxfordjournals.org/ at University of Alabama at Birmingham on July 24, 2015
Penicillin G Oxacillin Ampicillin Ticarcillin Temocillin Cefalotin Cefotaxime Ceftriaxone Ceftazidime Cefepime Imipenem Meropenem Ertapenem Aztreonam
kcat/KM (mM21.s21)
KM (mM)
Novel class D carbapenemase OXA-372
Acknowledgements Part of this study was presented at the Twelfth b-Lactamase Meeting, Canary Islands, Spain, 2014 (A. Antonelli, M. M. D’Andrea, G. Vaggelli, G. Seri, J.-D. Docquier and G. M. Rossolini, oral communication).
Funding This work was supported by EvoTAR (no. HEALTH-F3-2011-2011-123 282004) to G. M. R.
Transparency declarations None to declare.
References 1 Rossolini GM, Arena F, Pecile P et al. Update on the antibiotic resistance crisis. Curr Opin Pharmacol 2014; 18: 56 –60. 2 Temkin E, Adler A, Lerner A et al. Carbapenem-resistant Enterobacteriaceae: biology, epidemiology, and management. Ann NY Acad Sci 2014; 1323: 22 –42. 3 Canton R, Akova M, Carmeli Y et al. Rapid evolution and spread of carbapenemases among Enterobacteriaceae in Europe. Clin Microbiol Infect 2012; 18: 413–31. 4 Glasner C, Albiger B, Buist G et al. Carbapenemase-producing Enterobacteriaceae in Europe: a survey among national experts from 39 countries, February 2013. Euro Surveill 2013; 18: pii¼20525. 5 Munoz-Price LS, Poirel L, Bonomo RA et al. Clinical epidemiology of the global expansion of Klebsiella pneumoniae carbapenemases. Lancet Infect Dis 2013; 13: 785–96. 6 Nordmann P, Poirel L. The difficult-to-control spread of carbapenemase producers among Enterobacteriaceae worldwide. Clin Microbiol Infect 2014; 20: 821–30. 7 Rossolini GM. Extensively drug-resistant carbapenemase-producing Enterobacteriaceae: an emerging challenge for clinicians and healthcare systems. J Intern Med 2015; 277: 528– 31.
10 Carrer A, Poirel L, Yilmaz M et al. Spread of OXA-48-encoding plasmid in Turkey and beyond. Antimicrob Agents Chemother 2010; 54: 1369 –73. 11 Poirel L, Potron A, Nordmann P. OXA-48-like carbapenemases: the phantom menace. J Antimicrob Chemother 2012; 67: 1597 –606. 12 Djahmi N, Dunyach-Remy C, Pantel A et al. Epidemiology of carbapenemase-producing Enterobacteriaceae and Acinetobacter baumannii in Mediterranean countries. Biomed Res Int 2014; 2014: 305784. 13 Potron A, Poirel L, Rondinaud E et al. Intercontinental spread of OXA-48 b-lactamase-producing Enterobacteriaceae over a 11-year period, 2001 to 2011. Euro Surveill 2013; 18: pii¼20549. 14 Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual. 3rd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 2001. 15 Grant SG, Jessee J, Bloom FR et al. Differential plasmid rescue from transgenic mouse DNAs into Escherichia coli methylation-restriction mutants. Proc Natl Acad Sci USA 1990; 87: 4645– 9. 16 Jacoby GA, Han P. Detection of extended-spectrum b-lactamases in clinical isolates of Klebsiella pneumoniae and Escherichia coli. J Clin Microbiol 1996; 34: 908–11. 17 Clinical and Laboratory Standards Institute. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically— Tenth Edition: Approved Standard M07-A10. CLSI, Wayne, PA, USA, 2015. 18 EUCAST. Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 5.0, 2015. http://www.eucast.org/clinical_breakpoints/. 19 Poirel L, Walsh TR, Cuvillier V et al. Multiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis 2011; 70: 119–23. 20 Lauretti L, Riccio ML, Mazzariol A et al. Cloning and characterization of blaVIM, a new integron-borne metallo-b-lactamase gene from a Pseudomonas aeruginosa clinical isolate. Antimicrob Agents Chemother 1999; 43: 1584– 90. 21 Tsakris A, Poulou A, Pournaras S et al. A simple phenotypic method for the differentiation of metallo-b-lactamases and class A KPC carbapenemases in Enterobacteriaceae clinical isolates. J Antimicrob Chemother 2010; 65: 1664– 71. 22 Simpson JT, Wong K, Jackman SD et al. ABySS: a parallel assembler for short read sequence data. Genome Res 2009; 19: 1117– 23. 23 Aziz RK, Bartels D, Best AA et al. The RAST Server: rapid annotations using subsystems technology. BMC Genomics 2008; 9: 75. 24 Sullivan MJ, Petty NK, Beatson SA. Easyfig: a genome comparison visualizer. Bioinformatics 2011; 27: 1009 –10. 25 Page RD. TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 1996; 12: 357– 8. 26 Docquier JD, Riccio ML, Mugnaioli C et al. IMP-12, a new plasmidencoded metallo-b-lactamase from a Pseudomonas putida clinical isolate. Antimicrob Agents Chemother 2003; 47: 1522– 8. 27 Johnson TJ, Bielak EM, Fortini D et al. Expansion of the IncX plasmid family for improved identification and typing of novel plasmids in drug-resistant Enterobacteriaceae. Plasmid 2012; 68: 43– 50. 28 Garcia-Fernandez A, Fortini D, Veldman K et al. Characterization of plasmids harbouring qnrS1, qnrB2 and qnrB19 genes in Salmonella. J Antimicrob Chemother 2009; 63: 274–81. 29 Carattoli A, Bertini A, Villa L et al. Identification of plasmids by PCR-based replicon typing. J Microbiol Meth 2005; 63: 219–28.
8 Tzouvelekis LS, Markogiannakis A, Psichogiou M et al. Carbapenemases in Klebsiella pneumoniae and other Enterobacteriaceae: an evolving crisis of global dimensions. Clin Microbiol Rev 2012; 25: 682–707.
30 Barton BM, Harding GP, Zuccarelli AJ. A general method for detecting and sizing large plasmids. Anal Biochem 1995; 226: 235–40.
9 Huang TD, Berhin C, Bogaerts P et al. Prevalence and mechanisms of resistance to carbapenems in Enterobacteriaceae isolates from 24 hospitals in Belgium. J Antimicrob Chemother 2013; 68: 1832 –7.
31 Borgianni L, Vandenameele J, Matagne A et al. Mutational analysis of VIM-2 reveals an essential determinant for metallo-b-lactamase stability and folding. Antimicrob Agents Chemother 2010; 54: 3197– 204.
7 of 8
Downloaded from http://jac.oxfordjournals.org/ at University of Alabama at Birmingham on July 24, 2015
the CRE isolates growing on the OXA sector of the chromIDw CARBA SMART selective and indicator medium (bioMe´rieux), where OXA-48-producing isolates, but also Cfr-FI-07 and the E. coli transformants producing OXA-372, are able to grow. Overall, such isolates have remained very uncommon in our setting and none of them was found to be blaOXA-372-positive (all were blaOXA-48-positive). However, since the blaOXA-372 gene is associated with mobile genetic elements, the possibility of its eventual dissemination in the clinical setting exists. Moreover, this study further underscored that hospital wastewaters could be an important reservoir of novel clinically significant b-lactamases, which can be mobilized and acquired by different Enterobacteriaceae that could be part of the heterogeneous and complex microbial community found in wastewater plants.
JAC
Antonelli et al.
32 Smith DB, Johnson KS. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 1988; 67: 31–40.
45 Molina L, Bernal P, Udaondo Z et al. Complete genome sequence of a Pseudomonas putida clinical isolate, strain H8234. Genome Announc 2013; 1: e00496-13.
33 Studier FW. Protein production by auto-induction in high density shaking cultures. Protein Expr Purif 2005; 41: 207–34.
46 Rhodes G, Parkhill J, Bird C et al. Complete nucleotide sequence of the conjugative tetracycline resistance plasmid pFBAOT6, a member of a group of IncU plasmids with global ubiquity. Appl Environ Microbiol 2004; 70: 7497– 510.
34 Docquier JD, Lamotte-Brasseur J, Galleni M et al. On functional and structural heterogeneity of VIM-type metallo-b-lactamases. J Antimicrob Chemother 2003; 51: 257–66. 35 Giani T, Pini B, Arena F et al. Epidemic diffusion of KPC carbapenemaseproducing Klebsiella pneumoniae in Italy: results of the first countrywide survey, 15 May to 30 June 2011. Euro Surveill 2013; 18: pii¼20489.
48 Docquier JD, Calderone V, De LF et al. Crystal structure of the OXA-48 b-lactamase reveals mechanistic diversity among class D carbapenemases. Chem Biol 2009; 16: 540– 7.
37 Couture F, Lachapelle J, Levesque RC. Phylogeny of LCR-1 and OXA-5 with class A and class D b-lactamases. Mol Microbiol 1992; 6: 1693– 705.
49 Poirel L, He´ritier C, Tolu¨n C et al. Emergence of oxacillinase-mediated resistance to imipenem in Klebsiella pneumoniae. Antimicrob Agents Chemother 2004; 48: 15–22.
38 De LF, Benvenuti M, Carboni F et al. Evolution to carbapenemhydrolyzing activity in noncarbapenemase class D b-lactamase OXA-10 by rational protein design. Proc Natl Acad Sci USA 2011; 108: 18424–9.
50 Poirel L, Marque S, Heritier C et al. OXA-58, a novel class D b-lactamase involved in resistance to carbapenems in Acinetobacter baumannii. Antimicrob Agents Chemother 2005; 49: 202–8.
39 Radstrom P, Skold O, Swedberg G et al. Transposon Tn5090 of plasmid R751, which carries an integron, is related to Tn7, Mu, and the retroelements. J Bacteriol 1994; 176: 3257– 68.
51 Kaitany KC, Klinger NV, June CM et al. Structures of the class D Carbapenemases OXA-23 and OXA-146: mechanistic basis of activity against carbapenems, extended-spectrum cephalosporins, and aztreonam. Antimicrob Agents Chemother 2013; 57: 4848– 55.
40 Kholodii GY, Yurieva OV, Lomovskaya OL et al. Tn5053, a mercury resistance transposon with integron’s ends. J Mol Biol 1993; 230: 1103–7. 41 Hawkey PM, Xiong J, Ye H et al. Occurrence of a new metallob-lactamase IMP-4 carried on a conjugative plasmid in Citrobacter youngae from the People’s Republic of China. FEMS Microbiol Lett 2001; 194: 53– 7. 42 Juan C, Zamorano L, Mena A et al. Metallo-b-lactamase-producing Pseudomonas putida as a reservoir of multidrug resistance elements that can be transferred to successful Pseudomonas aeruginosa clones. J Antimicrob Chemother 2010; 65: 474–8.
52 Poirel L, Ros A, Carricajo A et al. Extremely drug-resistant Citrobacter freundii isolate producing NDM-1 and other carbapenemases identified in a patient returning from India. Antimicrob Agents Chemother 2011; 55: 447–8. 53 Peter S, Wolz C, Kaase M et al. Emergence of Citrobacter freundii carrying IMP-8 metallo-b-lactamase in Germany. New Microbes New Infect 2014; 2: 42– 5. 54 Gaibani P, Ambretti S, Farruggia P et al. Outbreak of Citrobacter freundii carrying VIM-1 in an Italian Hospital, identified during the carbapenemases screening actions, June 2012. Int J Infect Dis 2013; 17: e714– 7.
43 Labbate M, Roy CP, Stokes HW. A class 1 integron present in a human commensal has a hybrid transposition module compared to Tn402: evidence of interaction with mobile DNA from natural environments. J Bacteriol 2008; 190: 5318– 27.
55 Li G, Wei Q, Wang Y et al. Novel genetic environment of the plasmidmediated KPC-3 gene detected in Escherichia coli and Citrobacter freundii isolates from China. Eur J Clin Microbiol Infect Dis 2011; 30: 575– 80.
44 Rau MH, Marvig RL, Ehrlich GD et al. Deletion and acquisition of genomic content during early stage adaptation of Pseudomonas aeruginosa to a human host environment. Environ Microbiol 2012; 14: 2200– 11.
56 Gomez-Gil MR, Pano-Pardo JR, Romero-Gomez MP et al. Detection of KPC-2-producing Citrobacter freundii isolates in Spain. J Antimicrob Chemother 2010; 65: 2695– 7.
8 of 8
Downloaded from http://jac.oxfordjournals.org/ at University of Alabama at Birmingham on July 24, 2015
36 El Garch F, Bogaerts P, Bebrone C et al. OXA-198, an acquired carbapenem-hydrolyzing class D b-lactamase from Pseudomonas aeruginosa. Antimicrob Agents Chemother 2011; 55: 4828– 33.
47 Dolejska M, Villa L, Dobiasova H et al. Plasmid content of a clinically relevant Klebsiella pneumoniae clone from the Czech Republic producing CTX-M-15 and QnrB1. Antimicrob Agents Chemother 2013; 57: 1073 –6.
J Antimicrob Chemother doi:10.1093/jac/dkv181
OXA-372, a novel carbapenem-hydrolysing class D b-lactamase from a Citrobacter freundii isolated from a hospital wastewater plant Alberto Antonelli1,2, Marco Maria D’Andrea1, Guendalina Vaggelli3, Jean-Denis Docquier1 and Gian Maria Rossolini1–3* 1
Department of Medical Biotechnology, University of Siena, Siena, Italy; 2Department of Experimental and Clinical Medicine, University of Florence, Florence, Italy; 3Clinical Microbiology and Virology Unit, Florence Careggi University Hospital, Florence, Italy
Received 10 April 2015; returned 15 May 2015; revised 1 June 2015; accepted 3 June 2015 Objectives: The objective of this study was to characterize a novel class D carbapenemase, named OXA-372, identified in a carbapenem-resistant Citrobacter freundii strain (Cfr-FI-07) isolated from a hospital wastewater plant in central Italy. Methods: Cfr-FI-07 was isolated using a selective chromogenic medium for carbapenem-resistant Enterobacteriaceae. Carbapenemase production was confirmed by spectrophotometric assay. WGS was carried out using an Illumina MiSeq platform. The functional profile of OXA-372 was investigated by expression of the cloned gene in Escherichia coli and by analysis of kinetic parameters of the purified enzyme. Results: C. freundii Cfr-FI-07 produced carbapenemase activity, but tested negative for common carbapenemase genes. WGS confirmed the absence of known carbapenemase genes and revealed the presence of a novel class D b-lactamase (DBL) determinant, named blaOXA-372, encoding a protein distantly related to other DBLs. In E. coli, production of OXA-372 conferred resistance to penicillins, including temocillin, and reduced susceptibility to carbapenems, while susceptibility to expanded-spectrum cephalosporins was virtually unaffected. This substrate specificity was confirmed by kinetic characterization of the purified enzyme, which exhibited high catalytic efficiencies for carbapenems (kcat/KM values ≥0.22 s21.mM21). The blaOXA-372 gene was associated with a genetic platform of original structure consisting of a Tn402/Tn5053 hybrid transposon derivative, named Tn6255, inserted into a TnPa38-like transposon, named Tn6256, located on an IncA/C-IncN plasmid of approximately 140 kb. Conclusions: OXA-372 is a novel class D carbapenemase, belonging to a new lineage of DBLs, encoded by a gene associated with mobile elements. Functional properties revealed similarities, but also some differences, compared with other class D carbapenemases.
Introduction The emergence of carbapenem-resistant Enterobacteriaceae (CRE) is one of the most challenging developments of microbial drug resistance, given the very limited repertoire of treatment options available for CRE strains and their potential clinical impact.1,2 Although the reduced outer-membrane permeability associated with the overproduction of an ESBL or AmpC-type b-lactamase can be responsible for carbapenem resistance, carbapenemase production is the most important carbapenem-resistance mechanism in Enterobacteriaceae.3,4 In some settings, carbapenemaseproducing Enterobacteriaceae have achieved remarkable rates and are now posing a significant clinical challenge.3 – 8 Currently, several types of carbapenemase genes, associated with mobile DNA elements, are spreading among Enterobacteriaceae, namely those encoding class A KPC-type b-lactamases, class B metallo b-lactamases of the VIM, IMP and NDM types, and
class D b-lactamases of the OXA-48 lineage.3,4,6,8 The latter enzymes are the most common carbapenem-hydrolysing class D b-lactamases (CHDLs) found in Enterobacteriaceae and, in several countries, have become also the most common type of acquired carbapenemases among CRE isolates.9 – 13 In this study, we have identified and characterized a novel acquired CHDL, named OXA-372, from Citrobacter freundii isolated from a hospital wastewater plant in central Italy. OXA-372 belongs to a new CHDL lineage and exhibits a strong hydrolytic activity against carbapenems and penicillins. The OXA-372-encoding gene is associated with a mobile genetic element of original structure, carried on a plasmid, underscoring its potential for dissemination.
Materials and methods Bacterial strains C. freundii Cfr-FI-07 was isolated in September 2013, following a screening for CRE of hospital wastewaters from Florence Careggi University Hospital
# The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: [email protected]
1 of 8
Downloaded from http://jac.oxfordjournals.org/ at University of Alabama at Birmingham on July 24, 2015
*Corresponding author. Department of Experimental and Clinical Medicine, University of Florence, Policlinico Careggi, I-50134 Florence, Italy. Tel: +39-055-7949239; Fax: +39-055-7949289; E-mail: [email protected]
Antonelli et al.
(central Italy). Escherichia coli DH5a14 was used as a host for recombinant plasmids. E. coli DH10B15 and J53aziR16 were used as hosts for electrotransformation and conjugation experiments, respectively.
Antimicrobial susceptibility testing MICs were determined by the broth microdilution method according to CLSI guidelines17 and interpreted following EUCAST clinical breakpoints.18
Screening for CRE in hospital wastewaters and characterization of CRE isolates
DNA sequencing and sequence analysis WGS of Cfr-FI-07 was performed using an Illumina MiSeq system (Illumina Inc., San Diego, CA, USA) and a paired-end approach (2×250 bp) with an average insert size of 500 bp. De novo assembly was performed using ABySS software.22 Contigs obtained with ABySS were annotated by the RAST web-server.23 The structure of the genetic context of blaOXA-372, obtained by results of draft genomic sequencing, was confirmed by PCR mapping and Sanger sequencing of the regions unresolved by the ABySS assembler. Sanger sequencing was carried out at an external sequencing facility (Macrogen Inc., Seoul, Korea). Sequence comparisons were performed using the BLAST web server at the NCBI web site (http://blast. ncbi.nlm.nih.gov/). Diagrams showing structural comparisons of transposon structures were obtained using EasyFig.24 Amino acid sequence alignment was performed using AlignX (Invitrogen, Carlsbad, CA, USA) and a tree diagram was constructed using the TREEVIEW program.25
Conjugation experiments were performed in solid medium as previously described,26 using E. coli J53aziR as the recipient strain. Temocillin (75 mg/L) was used for the selection of transconjugants and sodium azide (150 mg/L) for counterselection of the donor. Electroporation experiments were performed with electrocompetent E. coli DH10B using a plasmid DNA preparation from Cfr-FI-07, as described previously.26 Transformants were selected on LB agar containing temocillin (50 mg/L). S1 nuclease mapping and plasmid rep typing were performed as previously described.27 – 30
Cloning of the blaOXA-372 gene and purification of OXA-372 produced in E. coli The gene encoding OXA-372 was amplified by PCR using primers OXA-372-cf-fwd and OXA-372-cf-rev (Table 1), carrying an NdeI and a BamHI linker, respectively, and cloned into the pLBII expression vector (a derivative of pBC-SK)31 digested with the same enzymes to obtain recombinant plasmid pLBII-OXA-372, to be used for expression experiments in E. coli. For protein purification, OXA-372 was produced as a glutathioneS-transferase (GST) fusion protein. The nucleotide sequence encoding the deduced mature protein (starting at amino acid 19) was amplified using primers OXA-372_GST_EXP/f and OXA-372_GST_EXP/r (Table 1) carrying a BamHI and an EcoRI linker, respectively, and cloned in plasmid vector pGEX-2T,32 to yield pGEX-OXA-372, which was used to transform E. coli DH5a. The authenticity of cloned DNA fragments in pLBII-OXA-372 and pGEX-OXA-372 vectors was confirmed by sequencing on both strands. The recombinant OXA-372 b-lactamase was produced by growing E. coli DH5a(pGEX-OXA-372) in 500 mL of ZYP-5052 medium for 24 h at 378C with orbital shaking.33 Bacterial cells were then harvested by centrifugation (10 000 g for 30 min at 48C), resuspended in 50 mL of 10 mM HEPES buffer (pH 7.5) and lysed by sonication (Labsonic L sonicator; B. Braun, Melsungen, Germany). The resulting lysate was then clarified by centrifugation (77 000 g for 60 min at 48C) and loaded onto a GSTrap FF affinity column (bed volume, 5 mL; GE Healthcare, Uppsala, Sweden) equilibrated with 10 mM HEPES buffer (pH 7.5). After washing with the same buffer, bound proteins were eluted using 10 mM HEPES buffer (pH 7.5) containing 10 mM reduced glutathione (Sigma-Aldrich, St Louis, MO, USA). Fractions showing b-lactamase activity were pooled and desalted using a HiPrep 26/10 column (GE Healthcare) in 100 mM Tris/100 mM K2SO4 (pH 7.5). The GST moiety was then cleaved by incubating the protein sample in the presence of 0.008 U/mg thrombin (Sigma-Aldrich) for 48 h at room temperature. The purified b-lactamase was obtained by loading the sample onto the GSTrap FF HiTrap column equilibrated with 50 mM Tris/ 100 mM K2SO4 (pH 7.5) (to remove any uncleaved fusion protein) and then onto a HiTrap Benzamidine FF column (bed volume, 1 mL; GE Healthcare) equilibrated with 50 mM Tris/100 mM K2SO4 (pH 7.5), to remove the thrombin protease. This strategy eventually yielded a recombinant protein including the mature OXA-372 (amino acids 19–257) plus
Table 1. Oligonucleotide primers used in this study Primer name OXA-372-cf-fwd OXA-372-cf-rev OXA-372_GST_EXP/f OXA-372_GST_EXP/r
Sequence (5′ -3′ )
Purpose
GGAATTCCATATGATGCATATTTTTTTGGTCTTTC CGGGATCCCCACTCAGGGAATAATGCGT CGCGGATCCGGCGAGGACAAAGCTATTTCGGC CCGGAATTCTCAGGGAATAATGCGTTCAGC
cloning of blaOXA-372 in pLBII cloning of blaOXA-372 in pLBII cloning of blaOXA-372 in pGEX-2T cloning of blaOXA-372 in pGEX-2T
NdeI, EcoRI and BamHI restriction sites used for cloning are underlined, while the regions targeting the blaOXA-372 gene are in bold.
2 of 8
Downloaded from http://jac.oxfordjournals.org/ at University of Alabama at Birmingham on July 24, 2015
To this purpose, 10 mL of a wastewater sample collected from the outlet of the hospital sewers, and dilutions thereof, were plated onto chromIDw CARBA agar (bioMe´rieux, Marcy-l’E´toile, France) and plates were incubated at 378C for 18 h. All colonies with different morphology grown on the selective and indicator medium were identified by MALDI-TOF MS (Vitek MS; bioMe´rieux) and carbapenem resistance was confirmed by susceptibility testing. In confirmed CRE isolates, genes encoding carbapenemases of the IMP, VIM, NDM, SPM, AIM, DIM, GIM, SIM, KPC, BIC and OXA-48 types were screened by a multiplex-PCR method as previously described.19 In strains yielding negative results with PCR, carbapenemase production was investigated by measuring the imipenem-hydrolysing specific activity in bacterial crude extracts as described previously,20 using a Cary 100 UV – Vis (Varian, Walnut Creek, CA, USA) spectrophotometer. A phenotypic combo-disc test for the differentiation of class A and class B carbapenemases based on differential inhibition by 3-aminophenylboronic acid (PBA) and EDTA was carried out as described previously.21 Protein concentration in solution was determined with the Bio-Rad protein assay (Bio-Rad, Richmond, CA, USA), using BSA (Thermo Scientific, IL, USA) as the standard.
Gene transfer and plasmid analysis experiments
JAC
Novel class D carbapenemase OXA-372
an extra Gly residue at its amino-terminus. The purified protein appeared as a single band (purity .95%) of 27 kDa by SDS-PAGE (data not shown).
Determination of kinetic parameters
Results and discussion Screening for CRE in a hospital wastewater plant: isolation of a C. freundii putatively producing a new carbapenemase A screening for CRE was carried out with a sample collected in September 2013 from the wastewater plant of Florence University Hospital, a large tertiary-care teaching hospital located in central Italy where CREs have been endemic since 2011.35 The screening was carried out by plating the sample onto a selective chromogenic medium and yielded five colonies of confirmed CRE from a 10 mL undiluted sample, including two Klebsiella pneumoniae, one E. coli, one Enterobacter cloacae and one C. freundii. PCR analysis of carbapenemase genes revealed the presence of blaKPC in most CRE isolates (one K. pneumoniae and the E. cloacae and E. coli isolates) and the presence of blaVIM in the other K. pneumoniae isolate, while negative PCR results were obtained with the C. freundii isolate, named Cfr-FI-07.
Analysis of the b-lactamase resistome in C. freundii Cfr-FI-07 and identification of a new class D b-lactamase, OXA-372 Using a WGS approach, the draft genome of C. freundii Cfr-FI-07 was obtained and analysed for the presence of b-lactamase-encoding genes. The analysis revealed the presence of the resident ampCtype gene of C. freundii (accession no. KP981366), encoding an original variant, named CMY-135, with the highest similarity (99% identical) to CMY-48 (accession no. ADP02979.1), plus three additional acquired b-lactamase genes. These included blaOXA-10, an original blaMOX gene variant named blaMOX-9 (accession number KJ746495) and a novel class D b-lactamase gene that was named blaOXA-372 (accession number KJ746496). Amino acid sequence comparison showed that OXA-372 was distantly related to other class D b-lactamases, with a maximum of 56% identity with OXA-198 (Figure 1), a class D b-lactamase with weak carbapenemase activity previously described in a Pseudomonas aeruginosa clinical isolate from Belgium.36 Identity with other lineages of CHDLs was lower (43% with OXA-48; 33% with OXA-58; 31% with OXA-24; and 28% with OXA-23; Figure 1). The conserved Y/F – G – N motif at Ambler
Table 2. Antimicrobial susceptibility of C. freundii Cfr-FI-07, E. coli DH5a(pLBII-OXA-372) (producing the OXA-372 enzyme) and E. coli DH10B(pCfr-FI-07) to different b-lactams; susceptibilities of E. coli DH5a carrying the empty vector (pBC-SK) and of E. coli DH10B are also shown for comparison MIC (mg/L) Antibiotic Penicillin G Ticarcillin Ampicillin Oxacillin Temocillin Cefalotin Aztreonam Imipenem Meropenem Ertapenem Cefotaxime Ceftazidime Cefepime Ceftriaxone
Cfr-FI-07
DH5a(pLBII-OXA-372)
DH5a(pBC-SK)
DH10B(pCfr-FI-07)
DH10B
.256 .256 .256 .256 .256 .256 8 .32 16 16 .32 .32 4 .32
.256 256 128 .256 128 8 0.25 2 0.06 0.03 0.06 0.25 0.125 0.03
64 4 4 256 8 8 0.25 0.125 ≤0.015 ≤0.015 0.06 0.125 0.06 0.03
.256 .256 .256 .256 .256 8 4 2 0.25 1 0.25 4 0.5 0.125
64 4 4 256 8 4 0.5 0.25 0.03 ≤0.015 0.06 0.25 0.125 0.03
3 of 8
Downloaded from http://jac.oxfordjournals.org/ at University of Alabama at Birmingham on July 24, 2015
The kinetic parameters for the hydrolysis of b-lactam substrates by the purified OXA-372 enzyme were determined spectrophotometrically using a Cary 100 UV – Vis instrument in 20 mM Tris/0.3 M K2SO4 buffer (pH 7.5) containing 50 mM Na2CO3 in a final reaction volume of 500 mL. The purified OXA-372 enzyme was diluted in the same buffer supplemented with 20 mg/L BSA to prevent enzyme denaturation. The steady-state kinetic parameters (kcat and KM) were calculated either using the nonlinear fit of the initial reaction rates with the Henri – Michaelis – Menten equation or using the Hanes – Woolf linearization method.34 KM values below 20 mM were measured as inhibition constants using a competitive inhibition model34 and 250 mM benzylpenicillin as the reporter substrate.
In vitro susceptibility testing showed that Cfr-FI-07 was resistant or intermediate to all tested b-lactam antibiotics, including penicillins, narrow- and expanded-spectrum cephalosporins and carbapenems (Table 2). A crude extract of Cfr-FI-07 showed hydrolytic activity against imipenem (specific activity, 8.1+0.7 nmol/min/mg of protein), which was not inhibited by EDTA. Moreover, a phenotypic combo-disc test for differentiation of class A and class B carbapenemases based on differential inhibition by PBA and EDTA21 did not yield significant differences in the growth-inhibition zone diameters around the meropenem, meropenem-PBA and meropenem-EDTA discs. Taken together, these results suggested that Cfr-FI-07 produced a novel type of active site-serine carbapenemase that was resistant to PBA.
Antonelli et al.
(a)
Downloaded from http://jac.oxfordjournals.org/ at University of Alabama at Birmingham on July 24, 2015
(b)
Figure 1. (a) Phylogenetic tree showing the relationship of OXA-372 with other acquired class D b-lactamases (CHDLs are underlined), whose sequences were retrieved from the Lahey Clinic web site (http://www.lahey.org/Studies). (b) Amino acid sequence alignment of OXA-372 with selected CHDLs, in which the conserved motifs (black) and other relevant regions, such as the poorly conserved YGN motif (shaded in grey) and the PxxG motif (boxed) found in all CHDLs, are highlighted; the secondary structure elements of OXA-48 are indicated above the sequences.
positions 144–146,37 characteristic of most class D b-lactamases, was found to be slightly different in OXA-372, which presents a Y – G – V motif (Figure 1b). Moreover, the PxxG motif at positions 217 – 220 in the OXA-48 numbering, which is common to most
4 of 8
class D carbapenemases, but absent in other OXA-type enzymes,38 was present in OXA-372 and its composition (PQIG) was in between that of Acinetobacter class D carbapenemases (PQVG) and that of OXA-48-like enzymes (PKIG) (Figure 1b).
JAC
Novel class D carbapenemase OXA-372
Altogether, these features identified OXA-372 as representative of a new lineage of class D b-lactamases, with some unique structural features.
Genetic context of blaOXA-372
Functional characterization of OXA-372 Expression of OXA-372 in E. coli DH5a(pLBII-OXA-372) conferred high-level resistance to penicillins (MICs ≥128 mg/L) and reduced susceptibility to carbapenems (Table 2), while the MIC values of cephalosporins and aztreonam were not affected. This strain was confirmed to produce carbapenemase activity using a spectrophotometric assay (imipenem-hydrolysing specific activity, 48.8+0.6 nmol/min/mg of protein).
(a)
(b)
Figure 2. Genetic context of the blaOXA-372 gene. Regions showing ≥99% nucleotide sequence identity are connected by dotted areas or lines. (a) Structure of transposon Tn6255 and comparison with homologous transposon Tn6017.41 The IRi (5′ -TGTCGTTTTCAGAAGACGGCTGCAC-3′ ) and IRt (5′ -TGTCGTTTTCAGAAGACGACCGCAC-3′ ) of Tn6255 are indicated by white diamonds and 5 bp direct repeat sequences flanking Tn6255 are indicated. (b) Structure of transposon Tn6256 and comparison with homologous transposon TnPa38 44 and transposons described in plasmids pESA2/ pKPN_CZ.47 Direct repeat sequences (5′ -ATGCA-3′ ) flanking Tn6256 are reported. Uncharacterized ORFs are indicated by the letter O followed by a number (O1, DNA-invertase, pin homologue; O2/O3/O4/O6, hypothetical proteins; O5, cupin 2 conserved barrel domain protein; O7, DNA-polymerase).
5 of 8
Downloaded from http://jac.oxfordjournals.org/ at University of Alabama at Birmingham on July 24, 2015
Conjugation experiments with E. coli J53aziR failed to demonstrate the transferability of the blaOXA-372 gene (detection limit 1029 transconjugant/recipient). On the other hand, plasmid DNA could be transferred from Cfr-FI-07 into E. coli DH10B by electroporation, using a plasmid DNA preparation from the former strain, and yielded transformants exhibiting reduced susceptibility to both penicillins and carbapenems (Table 2). S1 nuclease analysis followed by hybridization with a blaOXA-372-specific probe revealed that, both in Cfr-FI-07 and in a randomly selected transformant [DH10B(pCfr-FI-07)], the gene was harboured on a plasmid of approximately 140 kb (data not shown). Replicon typing, carried out with a plasmid preparation purified from the DH10B(pCfr-FI-07) transformant, yielded a positive result for IncA/C and IncN, suggesting a multireplicon nature of the plasmid. Analysis of the genetic context of blaOXA-372 revealed that the gene was carried on a defective transposon of original structure, named Tn6255, belonging to the Tn402/Tn5053 lineage. Tn6255 contains remnants of the tniR 99% identical to that of Tn402/ Tn5090 39 and remnants of the tniA gene identical to that of Tn5053 40 separated by an IS26. The blaOXA372 gene was located between DtniR and the IRi terminal inverted repeat. Transposons of this lineage, with a hybrid tni module similar to that of Tn6255, were previously described in plasmids from Citrobacter youngae (Tn6017), 41 Pseudomonas putida 42 and Enterobacter cloacae (Tn6007).43 Interestingly, those elements carried a complete tni module and also an integron platform, which is absent in Tn6255
(Figure 2a), suggesting that the latter transposon was likely derived from a Tn6017-like precursor by extensive deletion and recombination events. Analysis of the sequences flanking blaOXA-372, however, did not reveal any clues to the recombination mechanism involved in the mobilization of the b-lactamase gene. Tn6255, in turn, was inserted into a Tn3-family transposon of original structure, named Tn6256 (accession no. KP851978), and was flanked by 5 bp direct repeats (Figure 2b), revealing a history of insertion by transposition. Tn6256 is related to TnPa38, a Tn3-family transposon originally described in a genomic island (GI7) of clinical isolates of a P. aeruginosa clone from Denmark (Figure 2b),44 and with similar elements detected in the genomes of other strains of P. aeruginosa (strain PA38182, accession no. HG530068) and P. putida 45 as well as on plasmids pFBAOT6 from Aeromonas punctata,46 pKPN_CZ from K. pneumoniae 47 and pESA2 from Cronobacter sakazakii (accession no. CP000784). The major differences between Tn6256 and those elements consisted of the presence of two IS5075-like elements inserted in the opposite direction into the terminal IRs and the presence of Tn6255 (Figure 2b). Tn6256 was flanked by 5 bp direct repeats, revealing a transposition history (Figure 2b).
Antonelli et al.
Table 3. Kinetic parameters measured for the purified OXA-372 b-lactamase kcat (s21) Substrate
OXA-372
OXA-48a
OXA-198b
OXA-372
OXA-48a
OXA-198b
OXA-372
OXA-48a
OXA-198b
40 145 85 110 3 0.17 NHd NH NH NH 5.8 0.13 0.49 NH
446 130 955 45 0.3 44 .9 — NH .0.6 4.8 0.07 0.13 NH
15 25 37 —c — 0.19 NH — NH NH 0.1 0.01 — NH
110 125 85 190 35 57 — — — — 26 0.7e 0.25e —
79 95 395 55 45 195 .900 — — .550 13 11 100 —
14 30 216 — — 12 — — — — 0.15 0.006 — —
2.8 1.2 1.0 0.58 0.086 0.003 — — — — 0.22 0.52 0.7 —
5.6 1.4 2.4 0.82 0.0066 0.23 0.01 — — 0.0011 0.37 0.0062 0.0013 —
1.1 0.83 0.17 — — 0.016 — — — — 0.67 1.7 — —
Data are the means of three independent measurements. Standard deviations were always within 10% of the mean values. Kinetic parameters for OXA-48 and OXA-198 are also shown for comparison. a Kinetic parameters for all antibiotics, except benzylpenicillin (determined in this study) and ticarcillin and aztreonam,49 are from Docquier et al.48 b Kinetic parameters for all antibiotics are from El Garch et al.36 c —, No data available. d NH, no hydrolysis could be detected with concentrations of enzyme up to 340 nM. e Determined as Ki with benzylpenicillin as the substrate.
To further characterize the functional properties of OXA-372, the protein was produced in E. coli and purified. Initial attempts to produce OXA-372 in its native form, using a T7 promoter-based expression system, yielded only low protein amounts (data not shown). For this reason, OXA-372 lacking the putative leader peptide (amino acids 19–257) was produced as a GST fusion protein and the GST moiety was enzymatically removed after the first step of affinity purification. This approach eventually yielded approximately 1 mg of purified OXA-372 per litre of culture. The kinetic parameters for the hydrolysis of b-lactam substrates (Table 3) were in overall agreement with the substrate profile deduced from the in vitro susceptibility data. OXA-372 showed high hydrolytic efficiencies with penicillins, including temocillin. Among cephalosporins, cefalotin was very poorly hydrolysed, while none of the tested oxyiminocephalosporins was hydrolysed at measurable rates. All tested carbapenems were good substrates of OXA-372, with high catalytic efficiencies (kcat/KM values, ≥0.22 s21.mM21). However, important differences were observed in the individual kinetic parameters for the hydrolysis of these substrates. Indeed, the turnover rate for imipenem was 12- and 45-fold higher than that observed with ertapenem and meropenem, respectively, while the KM values were significantly lower for the latter substrates. When compared with other class D carbapenemases, OXA-372 exhibited some similarities with OXA-198, especially regarding the low activity against cefalotin. Altogether, these findings confirmed the carbapenemase nature of OXA-372 and its potential for conferring carbapenem resistance to enterobacterial hosts. Interestingly, among the naturally occurring class D carbapenemases, OXA-372 exhibits one of the highest turnover rates for imipenem, being comparable to that of OXA-48,48,49 but 7-, 28- and 58-fold higher than those
6 of 8
of OXA-24, OXA-23 and OXA-58, respectively.50,51 However, and despite the fact that OXA-48 and OXA-372 show overall similar kinetic parameters for the hydrolysis of imipenem, these enzymes exhibit significant functional differences, in particular regarding their ability to hydrolyse cephalosporins. In fact, OXA-48 exhibited a higher catalytic efficiency for the hydrolysis of cefalotin (75-fold higher than OXA-372), while cefotaxime and cefepime were not hydrolysed at detectable levels by OXA-372, unlike OXA-48.48
Conclusions Several acquired carbapenem-hydrolysing b-lactamases have been identified in carbapenem-resistant clinical isolates of C. freundii, including class B metallo-enzymes of the VIM, IMP and NDM types,52 – 54 and some class A carbapenemases (i.e. KPC-2 and KPC-3)55,56 and class D carbapenemases (i.e. OXA-48 and OXA-181).10 In this study, we have characterized a new class D carbapenemhydrolysing b-lactamase, named OXA-372, from a C. freundii isolated from a nosocomial wastewater plant. The new OXA-372 enzyme belongs to a new lineage of class D carbapenemases, underscoring that additional enzymes with carbapenemase activity can be present in this growing b-lactamase class. Comparison of the functional features of OXA-372 with those of other CHDLs, including OXA-48 and OXA-198, revealed interesting similarities, but also significant differences. For this reason, OXA-372 could be an additional interesting model for studying the structure/function relationships of class D carbapenemases. Following identification of this new class D carbapenemase determinant, we have screened (since 2014) for its presence all
Downloaded from http://jac.oxfordjournals.org/ at University of Alabama at Birmingham on July 24, 2015
Penicillin G Oxacillin Ampicillin Ticarcillin Temocillin Cefalotin Cefotaxime Ceftriaxone Ceftazidime Cefepime Imipenem Meropenem Ertapenem Aztreonam
kcat/KM (mM21.s21)
KM (mM)
Novel class D carbapenemase OXA-372
Acknowledgements Part of this study was presented at the Twelfth b-Lactamase Meeting, Canary Islands, Spain, 2014 (A. Antonelli, M. M. D’Andrea, G. Vaggelli, G. Seri, J.-D. Docquier and G. M. Rossolini, oral communication).
Funding This work was supported by EvoTAR (no. HEALTH-F3-2011-2011-123 282004) to G. M. R.
Transparency declarations None to declare.
References 1 Rossolini GM, Arena F, Pecile P et al. Update on the antibiotic resistance crisis. Curr Opin Pharmacol 2014; 18: 56 –60. 2 Temkin E, Adler A, Lerner A et al. Carbapenem-resistant Enterobacteriaceae: biology, epidemiology, and management. Ann NY Acad Sci 2014; 1323: 22 –42. 3 Canton R, Akova M, Carmeli Y et al. Rapid evolution and spread of carbapenemases among Enterobacteriaceae in Europe. Clin Microbiol Infect 2012; 18: 413–31. 4 Glasner C, Albiger B, Buist G et al. Carbapenemase-producing Enterobacteriaceae in Europe: a survey among national experts from 39 countries, February 2013. Euro Surveill 2013; 18: pii¼20525. 5 Munoz-Price LS, Poirel L, Bonomo RA et al. Clinical epidemiology of the global expansion of Klebsiella pneumoniae carbapenemases. Lancet Infect Dis 2013; 13: 785–96. 6 Nordmann P, Poirel L. The difficult-to-control spread of carbapenemase producers among Enterobacteriaceae worldwide. Clin Microbiol Infect 2014; 20: 821–30. 7 Rossolini GM. Extensively drug-resistant carbapenemase-producing Enterobacteriaceae: an emerging challenge for clinicians and healthcare systems. J Intern Med 2015; 277: 528– 31.
10 Carrer A, Poirel L, Yilmaz M et al. Spread of OXA-48-encoding plasmid in Turkey and beyond. Antimicrob Agents Chemother 2010; 54: 1369 –73. 11 Poirel L, Potron A, Nordmann P. OXA-48-like carbapenemases: the phantom menace. J Antimicrob Chemother 2012; 67: 1597 –606. 12 Djahmi N, Dunyach-Remy C, Pantel A et al. Epidemiology of carbapenemase-producing Enterobacteriaceae and Acinetobacter baumannii in Mediterranean countries. Biomed Res Int 2014; 2014: 305784. 13 Potron A, Poirel L, Rondinaud E et al. Intercontinental spread of OXA-48 b-lactamase-producing Enterobacteriaceae over a 11-year period, 2001 to 2011. Euro Surveill 2013; 18: pii¼20549. 14 Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual. 3rd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 2001. 15 Grant SG, Jessee J, Bloom FR et al. Differential plasmid rescue from transgenic mouse DNAs into Escherichia coli methylation-restriction mutants. Proc Natl Acad Sci USA 1990; 87: 4645– 9. 16 Jacoby GA, Han P. Detection of extended-spectrum b-lactamases in clinical isolates of Klebsiella pneumoniae and Escherichia coli. J Clin Microbiol 1996; 34: 908–11. 17 Clinical and Laboratory Standards Institute. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically— Tenth Edition: Approved Standard M07-A10. CLSI, Wayne, PA, USA, 2015. 18 EUCAST. Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 5.0, 2015. http://www.eucast.org/clinical_breakpoints/. 19 Poirel L, Walsh TR, Cuvillier V et al. Multiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis 2011; 70: 119–23. 20 Lauretti L, Riccio ML, Mazzariol A et al. Cloning and characterization of blaVIM, a new integron-borne metallo-b-lactamase gene from a Pseudomonas aeruginosa clinical isolate. Antimicrob Agents Chemother 1999; 43: 1584– 90. 21 Tsakris A, Poulou A, Pournaras S et al. A simple phenotypic method for the differentiation of metallo-b-lactamases and class A KPC carbapenemases in Enterobacteriaceae clinical isolates. J Antimicrob Chemother 2010; 65: 1664– 71. 22 Simpson JT, Wong K, Jackman SD et al. ABySS: a parallel assembler for short read sequence data. Genome Res 2009; 19: 1117– 23. 23 Aziz RK, Bartels D, Best AA et al. The RAST Server: rapid annotations using subsystems technology. BMC Genomics 2008; 9: 75. 24 Sullivan MJ, Petty NK, Beatson SA. Easyfig: a genome comparison visualizer. Bioinformatics 2011; 27: 1009 –10. 25 Page RD. TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 1996; 12: 357– 8. 26 Docquier JD, Riccio ML, Mugnaioli C et al. IMP-12, a new plasmidencoded metallo-b-lactamase from a Pseudomonas putida clinical isolate. Antimicrob Agents Chemother 2003; 47: 1522– 8. 27 Johnson TJ, Bielak EM, Fortini D et al. Expansion of the IncX plasmid family for improved identification and typing of novel plasmids in drug-resistant Enterobacteriaceae. Plasmid 2012; 68: 43– 50. 28 Garcia-Fernandez A, Fortini D, Veldman K et al. Characterization of plasmids harbouring qnrS1, qnrB2 and qnrB19 genes in Salmonella. J Antimicrob Chemother 2009; 63: 274–81. 29 Carattoli A, Bertini A, Villa L et al. Identification of plasmids by PCR-based replicon typing. J Microbiol Meth 2005; 63: 219–28.
8 Tzouvelekis LS, Markogiannakis A, Psichogiou M et al. Carbapenemases in Klebsiella pneumoniae and other Enterobacteriaceae: an evolving crisis of global dimensions. Clin Microbiol Rev 2012; 25: 682–707.
30 Barton BM, Harding GP, Zuccarelli AJ. A general method for detecting and sizing large plasmids. Anal Biochem 1995; 226: 235–40.
9 Huang TD, Berhin C, Bogaerts P et al. Prevalence and mechanisms of resistance to carbapenems in Enterobacteriaceae isolates from 24 hospitals in Belgium. J Antimicrob Chemother 2013; 68: 1832 –7.
31 Borgianni L, Vandenameele J, Matagne A et al. Mutational analysis of VIM-2 reveals an essential determinant for metallo-b-lactamase stability and folding. Antimicrob Agents Chemother 2010; 54: 3197– 204.
7 of 8
Downloaded from http://jac.oxfordjournals.org/ at University of Alabama at Birmingham on July 24, 2015
the CRE isolates growing on the OXA sector of the chromIDw CARBA SMART selective and indicator medium (bioMe´rieux), where OXA-48-producing isolates, but also Cfr-FI-07 and the E. coli transformants producing OXA-372, are able to grow. Overall, such isolates have remained very uncommon in our setting and none of them was found to be blaOXA-372-positive (all were blaOXA-48-positive). However, since the blaOXA-372 gene is associated with mobile genetic elements, the possibility of its eventual dissemination in the clinical setting exists. Moreover, this study further underscored that hospital wastewaters could be an important reservoir of novel clinically significant b-lactamases, which can be mobilized and acquired by different Enterobacteriaceae that could be part of the heterogeneous and complex microbial community found in wastewater plants.
JAC
Antonelli et al.
32 Smith DB, Johnson KS. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 1988; 67: 31–40.
45 Molina L, Bernal P, Udaondo Z et al. Complete genome sequence of a Pseudomonas putida clinical isolate, strain H8234. Genome Announc 2013; 1: e00496-13.
33 Studier FW. Protein production by auto-induction in high density shaking cultures. Protein Expr Purif 2005; 41: 207–34.
46 Rhodes G, Parkhill J, Bird C et al. Complete nucleotide sequence of the conjugative tetracycline resistance plasmid pFBAOT6, a member of a group of IncU plasmids with global ubiquity. Appl Environ Microbiol 2004; 70: 7497– 510.
34 Docquier JD, Lamotte-Brasseur J, Galleni M et al. On functional and structural heterogeneity of VIM-type metallo-b-lactamases. J Antimicrob Chemother 2003; 51: 257–66. 35 Giani T, Pini B, Arena F et al. Epidemic diffusion of KPC carbapenemaseproducing Klebsiella pneumoniae in Italy: results of the first countrywide survey, 15 May to 30 June 2011. Euro Surveill 2013; 18: pii¼20489.
48 Docquier JD, Calderone V, De LF et al. Crystal structure of the OXA-48 b-lactamase reveals mechanistic diversity among class D carbapenemases. Chem Biol 2009; 16: 540– 7.
37 Couture F, Lachapelle J, Levesque RC. Phylogeny of LCR-1 and OXA-5 with class A and class D b-lactamases. Mol Microbiol 1992; 6: 1693– 705.
49 Poirel L, He´ritier C, Tolu¨n C et al. Emergence of oxacillinase-mediated resistance to imipenem in Klebsiella pneumoniae. Antimicrob Agents Chemother 2004; 48: 15–22.
38 De LF, Benvenuti M, Carboni F et al. Evolution to carbapenemhydrolyzing activity in noncarbapenemase class D b-lactamase OXA-10 by rational protein design. Proc Natl Acad Sci USA 2011; 108: 18424–9.
50 Poirel L, Marque S, Heritier C et al. OXA-58, a novel class D b-lactamase involved in resistance to carbapenems in Acinetobacter baumannii. Antimicrob Agents Chemother 2005; 49: 202–8.
39 Radstrom P, Skold O, Swedberg G et al. Transposon Tn5090 of plasmid R751, which carries an integron, is related to Tn7, Mu, and the retroelements. J Bacteriol 1994; 176: 3257– 68.
51 Kaitany KC, Klinger NV, June CM et al. Structures of the class D Carbapenemases OXA-23 and OXA-146: mechanistic basis of activity against carbapenems, extended-spectrum cephalosporins, and aztreonam. Antimicrob Agents Chemother 2013; 57: 4848– 55.
40 Kholodii GY, Yurieva OV, Lomovskaya OL et al. Tn5053, a mercury resistance transposon with integron’s ends. J Mol Biol 1993; 230: 1103–7. 41 Hawkey PM, Xiong J, Ye H et al. Occurrence of a new metallob-lactamase IMP-4 carried on a conjugative plasmid in Citrobacter youngae from the People’s Republic of China. FEMS Microbiol Lett 2001; 194: 53– 7. 42 Juan C, Zamorano L, Mena A et al. Metallo-b-lactamase-producing Pseudomonas putida as a reservoir of multidrug resistance elements that can be transferred to successful Pseudomonas aeruginosa clones. J Antimicrob Chemother 2010; 65: 474–8.
52 Poirel L, Ros A, Carricajo A et al. Extremely drug-resistant Citrobacter freundii isolate producing NDM-1 and other carbapenemases identified in a patient returning from India. Antimicrob Agents Chemother 2011; 55: 447–8. 53 Peter S, Wolz C, Kaase M et al. Emergence of Citrobacter freundii carrying IMP-8 metallo-b-lactamase in Germany. New Microbes New Infect 2014; 2: 42– 5. 54 Gaibani P, Ambretti S, Farruggia P et al. Outbreak of Citrobacter freundii carrying VIM-1 in an Italian Hospital, identified during the carbapenemases screening actions, June 2012. Int J Infect Dis 2013; 17: e714– 7.
43 Labbate M, Roy CP, Stokes HW. A class 1 integron present in a human commensal has a hybrid transposition module compared to Tn402: evidence of interaction with mobile DNA from natural environments. J Bacteriol 2008; 190: 5318– 27.
55 Li G, Wei Q, Wang Y et al. Novel genetic environment of the plasmidmediated KPC-3 gene detected in Escherichia coli and Citrobacter freundii isolates from China. Eur J Clin Microbiol Infect Dis 2011; 30: 575– 80.
44 Rau MH, Marvig RL, Ehrlich GD et al. Deletion and acquisition of genomic content during early stage adaptation of Pseudomonas aeruginosa to a human host environment. Environ Microbiol 2012; 14: 2200– 11.
56 Gomez-Gil MR, Pano-Pardo JR, Romero-Gomez MP et al. Detection of KPC-2-producing Citrobacter freundii isolates in Spain. J Antimicrob Chemother 2010; 65: 2695– 7.
8 of 8
Downloaded from http://jac.oxfordjournals.org/ at University of Alabama at Birmingham on July 24, 2015
36 El Garch F, Bogaerts P, Bebrone C et al. OXA-198, an acquired carbapenem-hydrolyzing class D b-lactamase from Pseudomonas aeruginosa. Antimicrob Agents Chemother 2011; 55: 4828– 33.
47 Dolejska M, Villa L, Dobiasova H et al. Plasmid content of a clinically relevant Klebsiella pneumoniae clone from the Czech Republic producing CTX-M-15 and QnrB1. Antimicrob Agents Chemother 2013; 57: 1073 –6.
