Planta DOI 10.1007/s00425-014-2066-6

Original Article

Overexpression of a wheat phospholipase D gene, TaPLDα, enhances tolerance to drought and osmotic stress in Arabidopsis thaliana Junbin Wang · Bo Ding · Yaolin Guo · Ming Li · Shuaijun Chen · Guozhong Huang · Xiaodong Xie 

Received: 4 January 2014 / Accepted: 12 March 2014 © Springer-Verlag Berlin Heidelberg 2014

Abstract  Phospholipase D (PLD) is crucial for plant responses to stress and signal transduction, however, the regulatory mechanism of PLD in abiotic stress is not completely understood; especially, in crops. In this study, we isolated a gene, TaPLDα, from common wheat (Triticum aestivum L.). Analysis of the amino acid sequence of TaPLDα revealed a highly conserved C2 domain and two characteristic HKD motifs, which is similar to other known PLD family genes. Further characterization revealed that TaPLDα expressed differentially in various organs, such as roots, stems, leaves and spikelets of wheat. After treatment with abscisic acid (ABA), methyl jasmonate, dehydration, polyethylene glycol and NaCl, the expression of TaPLDα was up-regulated in shoots. Subsequently, we generated TaPLDα-overexpressing transgenic Arabidopsis lines under the control of the dexamethasone-inducible 35S promoter. The overexpression of TaPLDα in Arabidopsis resulted in significantly enhanced tolerance to drought, as shown by reduced chlorosis and leaf water loss, higher relative water content and lower relative electrolyte leakage than the wild type. Moreover, the TaPLDα-overexpressing plants exhibited longer roots in response to mannitol treatment. In addition, the seeds of TaPLDα-overexpressing plants showed hypersensitivity to ABA and osmotic stress. Under dehydration, the expression of several stress-related genes, RD29A, RD29B, KIN1

and RAB18, was up-regulated to a higher level in TaPLDαoverexpressing plants than in wild type. Taken together, our results indicated that TaPLDα can enhance tolerance to drought and osmotic stress in Arabidopsis and represents a potential candidate gene to enhance stress tolerance in crops.

J. Wang · B. Ding · Y. Guo · M. Li · S. Chen · G. Huang · X. Xie (*)  Tianjin‑Bristol Research Center for the Effects of the Environment Change on Crops, Tianjin Agricultural University, Tianjin 300384, China e-mail: [email protected]; [email protected]

Introduction

J. Wang  College of Basic Sciences, Tianjin Agricultural University, Tianjin 300384, China

Keywords  Arabidopsis · Inducible overexpression system · Phospholipase D · Stress tolerance · Triticum aestivum Abbreviations ABA Abscisic acid CaMV Cauliflower mosaic virus DEX Dexamethasone GUS  β-Glucuronidase MeJA Methyl jasmonate MS Murashige and Skoog PA Phosphatidic acid PEG Polyethylene glycol PLD Phospholipase D RT-PCR Reverse transcriptase polymerase chain reaction RT-qRCR Real-time quantitative PCR RWC Relative water content WT Wild type

Plants are frequently subjected to biotic and abiotic stresses during growth and development, with drought being one of the major environmental factors that affects the productivity of crops (Wang et al. 2003). Upon exposure to drought stress, numerous molecular and physiological processes are altered in plants (Zhu 2002).

13

Planta

Phospholipase D (PLD, EC 3.1.4.4) is a major lipiddegrading enzyme that hydrolyzes phospholipids to produce phosphatidic acid (PA) and free polar head groups (Wang et al. 2006). It affects not only cellular membrane structure and stability, but also regulates many cellular functions. PLD genes have been found in many organisms, including mammals, yeast and plants, with twelve PLD genes identified in Arabidopsis thaliana (Qin and Wang 2002; Wang et al. 2006). Based on the structure, sequence and functional domains, the Arabidopsis PLDs have been subdivided into six classes, three αs, two βs, three γs, one δ, one ε, and two ζs (Wang 2005; Wang et al. 2006). Increasing evidence shows that PLDs and PA play pivotal roles in signaling plant responses to various stress cues, such as water deficit (Frank et al. 2000; Munnik et al. 2000; Katagiri et al. 2001; Sang et al. 2001; Bargmann et al. 2009), freezing (Welti et al. 2002; Li et al. 2004) and high salinity (Hong et al. 2008a; Bargmann et al. 2009; Darwish et al. 2009; Yu et al. 2010), as well as the stress hormone abscisic acid (ABA) (Fan et al. 1997; Ritchie and Gilroy 1998; Guo et al. 2012a). PLDs have both unique and redundant functions in these responses. PLDα1 promotes stomatal closure and reduces water loss (Sang et al. 2001; Zhang et al. 2004; Mishra et al. 2006), while PLDδ is involved in stomatal responses to H2O2 and nitric oxide (Distéfano et al. 2012; Guo et al. 2012b). PLDα1 and PLDδ are both involved in seedling tolerance to salt stress (Zhang et al. 2003, 2012 Bargmann et al. 2009; Yu et al. 2010) and PLDα3 enhances tolerance to hyperosmotic stress (Hong et al. 2008a). PLDα is the predominant PLD form found in plants (Hong et al. 2010). Transcription levels and activity are increased upon exposure to various stresses, and the regulation of PLDα leads to altered stress tolerance (Zhang et al. 2010). AtPLDα1-deficient Arabidopsis plants have been found to exhibit excessive transpirational water loss in detached leaves, as well as reduced ABA induction of stomatal closure and rescue after drought treatment (Sang et al. 2001; Zhang et al. 2004). The overexpression of AtPLDα1 in tobacco reduced transpirational water loss by rendering the plants more sensitive to ABA (Sang et al. 2001). Another PLDα, PLDα3, was identified as a positive mediator in regulating plant responses to hyperosmotic stresses (Hong et al. 2008a). Knockout of PLDα3 rendered plants more sensitive to hyperosmotic stress, including salt and water deficiency, whereas increased PLDα3 expression and associated lipid changes promoted root growth, flowering, and stress avoidance (Hong et al. 2008a). Previous results showed that up-regulating the expression of PLDα resulted in less water loss (Sang et al. 2001; Hong et al. 2008a), suggesting that increased PA in crops may aid drought tolerance. Guard cell-specific expression of AtPLDα1 in Brassica napus conferred improved biomass accumulation and seed production, and decreased

13

water loss as compared to wild-type (WT) plants in fields under drought stress (Lu et al. 2013). The overexpression of SiPLDα1 from Setaria italica resulted in significantly enhanced tolerance to drought stress in Arabidopsis (Peng et al. 2010), and high PLD activity has also been associated with drought tolerance in other crops (EI Maarouf et al. 1999; Guo et al. 2006; Darwish et al. 2009). These results showed that PLD is involved in responses to environmental stresses in plants and implicates PA in activation of drought stress-related genes, promotion of stomatal closure and reduction of damage to plants. Therefore, cloning and characterization of PLDα from crops may have potential benefits for genetic improvement. Production of wheat, a global staple crop, is constrained by multiple environmental stress factors, such as drought, salinity and extreme temperature. An understanding of the molecular mechanisms underlying responses to abiotic stress is necessary for genetic improvement of stress tolerance in wheat. However, there are no previous reports on the role of PLD in response to abiotic stress in wheat. In the present study, a novel PLDα, TaPLDα, was isolated based on homologous cloning and RT-PCR from common wheat. We further functionally characterized TaPLDα in response to drought and osmotic stress by generating transgenic Arabidopsis expressing TaPLDα. Our results provide the first physiological and molecular evidence that ectopic expression of TaPLDα can greatly enhance stress tolerance in Arabidopsis, and sheds light on understanding the signal transduction mechanisms of TaPLDα in response to drought and other abiotic stresses.

Materials and methods Plant materials and treatment Common wheat (Triticum aestivum L. cv Yangmai 158, obtained from State Key Laboratory for Agrobiotechnology, Beijing, China) seeds were surface sterilized with 1 % sodium hypochlorite for 5 min and rinsed five times with distilled water. The sterilized seeds were then grown in a growth chamber under a controlled environment of 26/20 °C day/night temperature, relative humidity of 60 % and photoperiods of 12 h d−1. When the seedlings were 3 weeks old, the stress treatments were performed as described by EI Maarouf et al. (1999), with minor modifications. The effect of ABA or methyl jasmonate (MeJA) on the shoots was tested by plunging them into a 100 μM ABA or MeJA solution [0.1 % (v/v) ethanol] for 0, 1, 2, 4 and 8 h. For NaCl or polyethylene glycol (PEG) stress, the shoots were submerged in 250 mM NaCl or 20 % PEG 6000 solution for 0, 1, 2, 4 and 8 h. In addition, a mock treatment was conducted by plunging the wheat shoots into

Planta Table 1  Gene-specific primers used for semiquantitative RT-PCR and RT-qPCR

Gene

Forward primer (from 5′ to 3′)

Reverse primer (from 5′ to 3′)

TaPLDα

TGTGGAGGGGATTGAGGAAACCGT

ACACTCCGGACACCCCTCGC

TaActin

TATGCCAGCGGTCGAACAAC

GGAACAGCACCTCAGGGCAC

AtActin

GGTAACATTGTGCTCAGTGGTGG

AACGACCTTAATCTTCATGCTGC

AtRD29A

ATCACTTGGCTCCACTGTTGTTC

ACAAAACACACATAAACATCCAAAGT

AtRD29B

GAAGAAGACAACGGCTACAAAGGAG

CCGAAAACCCCATAGTCCCAAC

AtRAB18

TCGGTCGTTGTATTGTGCTT

CCAGATGCTCATTACACACTCATG

AtKIN1

ACCAACAAGAATGCCTTCCA

CCGCATCCGATACACTCTTT

water in NaCl and PEG treatments, or 0.1 % ethanol in ABA and MeJA treatments for 0, 1, 2, 4 and 8 h. In dehydration experiments, the 2-week-old whole wheat seedlings were dehydrated on filter paper as described by Ying et al. (2012) at ambient temperature (26 °C) and under light for 0, 1, 2, 4 and 8 h. The shoots were sampled at the indicated times and stored at −80 °C for RNA extraction. The root and leaf of seedlings at three-leaf stage, and the root, stem, leaf and spikelet at flowering stage were used for tissuespecific expression analysis. Isolation and sequence analysis of TaPLDα The corresponding PLDα sequences of Oryza sativa (GenBank accession no. BAA11136) and Arabidopsis thaliana (GenBank accession no. NP_188194) were used for a BLAST search against the Triticeae full-length CDS database (TriFLDB), and then the gene was cloned in silico. Based on the result of in silico cloning, the primers were designed for the start code region and the terminator region (Table 1). TaPLDα gene was cloned by reverse transcriptase polymerase chain reaction (RT-PCR) using total RNA isolated from the leaves of 12 h PEG 6000-treated wheat seedlings. Sequence assembling was performed using DNAMAN (version 5.0). Multiple protein alignment was performed with Clustal X (version 1.83; Thompson et al. 1997) using default parameters. The phylogenetic tree was constructed with the neighbor-joining (NJ) method in MEGA (version 5.0; Saitou and Nei 1987; Tamura et al. 2011) and presented using TreeView. Bootstrap analysis was performed using 1,000 replicates in MEGA to evaluate the reliability. RNA isolation, semiquantitative RT‑PCR and real‑time quantitative PCR Total RNA was extracted from wheat and Arabidopsis (seeds obtained from Nottingham Arabidopsis Stock Center, UK) using Total RNA Isolation System (Tiangen, Beijing, China) according to the manufacturer’s instructions, and cDNAs were synthesized using SuperScript™ III Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA).

The cDNA was used as templates for PCR amplification. Real-time quantitative PCR (RT-qPCR) was performed on an ABI 7500 Fast Real-Time PCR System, using UltraSYBR Mixture (CWBio, Beijing, China). The reaction procedures were as follows: denature at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 60 s. The wheat and Arabidopsis Actin genes were used as internal controls for normalization. The relative expression of the detected genes was calculated using the relative 2−ΔΔCT method (Livak and Schmittgen 2001) and the error bars indicate SD (n = 3). The gene-specific primers used in this study are listed in Table 1. Generation of the 35S::TaPLDα plasmid and Arabidopsis transformation The full-length TaPLDα cDNA was first introduced into GATEWAY™ pDONR 221 donor vector and then inserted into the destination vector pKIGW (GenBank Accession No. FN377812), in which TaPLDα is preceded by the Dexamethasone (DEX)-inducible Cauliflower mosaic virus (CaMV) 35S promoter (Samalova et al. 2005). The DEX-inducible transactivating system contains two transcription units (Craft et al. 2005). The first unit employs a constitutive CaMV 35S promoter to express a Dex-responsive transcription factor (LhGR). The second unit consists of six copies of the LhGRbinding site (artificial promoter “pOp”) linked to truncated CaMV 35S minimal promoters, which forms the bidirectional promoter (pOp6) used to express the target gene and β-glucuronidase gene (GUS). The target gene, TaPLDα, was recombined into the GATEWAY™ cloning site. In response to DEX, LhGR was activated and combined with POP6, results in the transcriptions of both GUS and TaPLDα (Zuo and Chua 2000; Samalova et al. 2005). The 35S::TaPLDα plasmid was transferred into Agrobacterium tumefaciens strain GV3101 and then was used to transform Arabidopsis using the flower-dipping method (Clough and Bent 1998). Arabidopsis thaliana (Col-0) plants were grown on pots filled with a mixture of soil and sand (3:1, w/w) in a greenhouse at 22 °C, with 70 % humidity under a 16 h-light photoperiod. To confirm

13

Planta

transgene integration, the initial transgenic T0 lines were selected by 75 mg/L kanamycin and further confirmed by PCR analysis. The T3 generation was obtained and used in this study. DEX was first dissolved in ethanol at a concentration of 10 mM. Before use, it was diluted to 10 μM with water. The same ratio of ethanol to water was used as control solution (mock). To induce TaPLDα gene expression in transgenic plants, 10 μM DEX or control solution was sprayed on seedlings or added in 1/2 MS medium. Histochemical GUS assay The histochemical GUS assay was performed as described by Jefferson (1987). A 2-week-old WT and transgenic plants growing on 1/2 MS medium plus 10 μM DEX or ethanol were immersed in a GUS staining solution containing 100 mM sodium phosphate buffer (pH 7.2), 0.5 mg/mL 5-bromo-4-chloro-3-indoyl-β-d-glucuronic acid (X-Gluc), 1 mM K3Fe(CN)6, 1 mM K4Fe(CN)6, 0.1 % (w/v) Triton X-100, 10 mM EDTA and incubated at 37 °C in the dark for 12 h. To remove chlorophyll after GUS staining, GUSstained tissues were incubated in 70 % ethanol for several hours. Germination assay For germination analysis, approximately 50 seeds each from the WT and transgenic lines were surface sterilized with 75 % (v/v) ethanol for 1 min, followed by washing three times in distilled water. The seeds were plated on 1/2 MS medium containing 10 μM DEX or 0.1 % ethanol and 1.0  μM ABA, 100 mM NaCl or 250 mM mannitol, incubated at 4 °C for 3 days and then transferred to 22 °C under a 16 h-light photoperiod. The germination rate was scored daily for 7 days (Ying et al. 2012).

Measurement of leaf water loss, relative water content and electrolyte leakage Water loss determinations were carried out according to Liang et al. (2010). Rosettes of overexpressing and control plants were detached and put on filter paper at a constant temperature (22 °C) and humidity (70 %). The weights of the leaves were measured at the indicated time intervals. The percentage loss of weight was calculated based on the initial weight of the plants. The WT and overexpressing lines under drought for 10 days were sampled to detect relative water content (RWC) and relative electrolyte leakage. Non-stressed plants were used as control. The RWC was determined as described by Barrs and Weatherley (1962). When the leaves were excised, fresh weight (FW) was immediately recorded. The leaves were floated on deionized water under 22 °C and a constant light for 4 h to obtain fully turgid weight (TW). Samples were then oven dried at 80 °C to constant weight (DW). RWC (%) = [(FW−DW)/ (TW−DW)] × 100. For electrolyte leakage measurement, the leaves were immersed in 15 mL of deionized water in glass tubes and vacuumed for 30 min. After incubation with gentle agitation for 3 h, the initial conductivity was measured with a conductivity meter (DDBJ-350, Shanghai, China). The samples were then boiled for 15 min, and total conductivity of bathing solution was measured after cooling. Relative electrolyte leakage (%) = (initial conductivity/total conductivity) × 100 (Fan et al. 1997). Statistical analyses All experiments were repeated at least three times and the results from one representative experiment are shown. The numerical data were subjected to statistical analyses using EXCEL 2003 and analyzed by Student’s t test or ANOVA.

Stress tolerance assays of the WT and the transgenic plants Results Stress tolerance assays were performed as described by Zhou et al. (2012) with slight modification. WT and transgenic lines were grown in containers filled with a mixture of soil and sand (3:1) where they were regularly watered for 5 weeks. The plants were then sprayed with 10 μM DEX in 0.01 % Silwet L-77 and subjected to water withdrawal for 10 days before rewatering. The survival rate was determined by scoring the seedlings that failed to grow after recovery from drought treatment. For the mannitol treatment, 2-week-old plants growing in 1/2 MS medium under a 16 h-light/8 h dark cycle at 22 °C were transferred to plates containing 1/2 MS plus 150 mM mannitol and 10  μM DEX or 0.1 % ethanol. Phenotypic analysis was carried out after 7 days. Root lengths were marked at the beginning of treatment, and measured after 7 days.

13

Isolation and sequence analysis of TaPLDα cDNA The assembled results showed that TaPLD has an open reading frame of 2,439 nucleotides, encoding 812 amino acids with a predicted molecular mass of 92.1 kDa and a calculated pI of 5.3 (Fig. 1). Sequence comparison revealed that the putative protein shared higher sequence identity with the known PLDα proteins from Aegilops tauschii (EMT03624, 99 %), Lolium temulentum (ABX83202, 91 %), Oryza sativa (BAA11136, 90 %), Zea mays (NP_001105686, 89 %), Setaria italica (ADK60917, 89 %) and Arabidopsis thaliana (NP_188194, 79 %) (Figs.  1, 2), and accordingly was designated TaPLDα. Alignment of the deduced amino acid sequence with PLDs

Planta

Fig. 1  Amino acid sequence alignment of TaPLDα with PLDα of Lolium temulentum, Zea mays, Setaria italica, Oryza sativa and Arabidopsis thaliana. Alignment was performed using the DNAMAN software. The underlined sequences are the C2 domains, which are Ca2+-dependent substrate binding structure for PLD activity. Boxes

indicate the two conserved HKD (HxKxxxD) motifs, which constitute two active-site regions necessary for PLD catalysis. Asterisks, colons and dots represented completely identical, conservative and semi-conservative amino acid residues, respectively

13

Planta

Fig. 2  Phylogenetic relationship between TaPLDα and other homologous PLD sequences. The multiple alignments were performed by Clustal X 1.83 and the phylogenetic tree was constructed with MEGA 5.0 using NJ method. The GenBank accession numbers of selected PLDs for drawing phylogenetic tree are listed as follows: Arabidopsis thaliana: AtPLDα1, NP_188194; AtPLDα2, NP_175666; AtPLDα3, NP_197919; AtPLDβ1, NP_565963; AtPLDβ2,

NP_567160; AtPLDγ1, NP_192922; AtPLDγ2, NP_192920; AtPLDγ3, NP_192921; AtPLDδ, NP_849501; AtPLDε, NP_175914; AtPLDζ1, AAL06337; AtPLDζ2, AAP68834. Oryza sativa: OsPLDα, BAA11136; OsPLDβ, AAL78821; OsPLDδ, CAD11899; OsPLDλ, BAD33632; AtPLDα, EMT03624; LtPLDα, ABX83202; ZmPLDα, NP_001105686; SiPLDα, ADK60917; RcPLDα, AAB04095; LePLDα, AAG45485;NtPLDα, CAB06620

from other plant species indicated that TaPLDα contains a C2 domain (calcium/lipid-binding domain) and two conserved HKD motifs (Fig. 1), suggesting the cloned TaPLDα is highly conserved. Phylogenetic analysis (Fig. 2) found that TaPLDα shows high identity to the PLDα family from some monocots such as Aegilops tauschii, Lolium temulentum, Setaria italica, Oryza sativa and Zea mays, but lower identity to other PLDs from Oryza sativa and to Arabidopsis thaliana.

of TaPLDα in wheat shoots were up-regulated by ABA (Fig. 3b) and MeJA (Fig. 3c) treatments and reached the highest level at 1 h, then decreased gradually. A rapid accumulation of TaPLDα was observed at 1 h after dehydration stress treatment and peaked at 2 h (Fig. 3d). Under PEG treatment, the expression of TaPLDα was induced 2 h after treatment (Fig. 3e). In the case of salt stress, higher expression compared with untreated controls was detected at all time points tested (Fig. 3f). Considering that wounding may also induce PLD activity, TaPLDα expression of the shoots submerged into water or 0.1 % ethanol solution for 0, 0.5, 1, 2, 4 and 8 h was analyzed (Fig. 3g, h).

Expression profiles of TaPLDα in wheat Spatial expression analysis showed that TaPLDα was expressed in different organs of wheat, including roots, stems, leaves and spikelets, and that the expression level in roots was slightly higher than other organs (Fig. 3a). The mRNA level of TaPLDα in response to ABA and MeJA was analyzed by RT-qRCR as shown in Fig. 3b, c, respectively. The data demonstrated that the expression

13

Characterization of TaPLDα‑overexpressing transgenic Arabidopsis lines To study the function overexpressing construct

of TaPLDα, a TaPLDαwith the DEX-inducible

Planta Fig. 3  RT-qPCR analysis of TaPLDα expression in wheat. a TaPLDα expression in different tissues of wheat. YL young leaves, ML mature leaves, YR young roots, MR mature roots, St stems, Sp spikelets. b–h TaPLDα expression in wheat shoots treated with 100 μM ABA (b), 100 μM MeJA (c), dehydration (d), 20 % PEG 6000 (e), 250 mM NaCl (f), water (g) and 0.1 % ethanol (h), respectively. TaActin was used as an internal control. Data represent mean ± SD (n = 3)

transcription activation system (Fig. 4a), was used to transform Arabidopsis. When compared with control plants, the abundance of TaPLDα transcripts was much higher in the transgenic line pretreated with 10 μM DEX (Fig. 4b). Three independent T3 transgenic lines were used for further physiological studies. When transgenic plants were treated with 10 μM DEX, GUS activity was dramatically enhanced

when compared with controls (Fig. 4c), and GUS signals were detected in the TaPLDα-overexpressing plants. No enhanced GUS activity was detected in Col-0 pretreated by DEX or in transgenic lines pretreated by ethanol (Fig. 4c). Under normal conditions, TaPLDα-overexpressing plants exhibited no evident phenotypical changes as compared to control plants.

13

Planta Fig. 4  Expression efficiency of TaPLDα in transgenic Arabidopsis under DEX treatment. a Schematic diagrams of DEX-inducible pKIGWTaPLDα construct. RB right border, ter terminator, attB attachment B site, pro promoter, POP chimeric bidirectional promoter, GUS β-glucuronidase, LhGR a glucocorticoid-dependent transcription factor, NOS Nopaline synthase promoter, npt II neomycin phosphotransferase II, LB left border. b Analysis of TaPLDα expression levels in WT and transgenic plants (lines 1–6) by semiquantitative RT-PCR. I, TaPLDα without DEX; II, AtActin without DEX; III, TaPLDα with 10 μM DEX; IV, AtActin with 10 μM DEX. c GUS activity in WT and transgenic Arabidopsis plants in response to 10 μM DEX or 0.1 % ethanol (mock). Bars 3.0 mm

Fig. 5  Germination of WT and TaPLDα-overexpressing lines in response to ABA and osmotic stress. Seeds germinated on 1/2 MS medium containing 0.1 μM ABA, 250 mM mannitol, 100 mM NaCl

and 0.1 % ethanol (a, mock) or 10 μM DEX (b). Data represent mean ± SD (n = 3), **P ≤ 0.01

Increased germination sensitivity of TaPLDα‑overexpressing transgenic Arabidopsis to ABA and osmotic stresses

(Fig. 5). Approximately, 83 % of control seeds had germinated at 72 h after 1.0 μM ABA and DEX treatment. In contrast, only about 40 % of TaPLDα-overexpressing lines had germinated (Fig. 5). Further germination rate comparison of transgenic plants and WT grown on medium supplemented with 100 mM NaCl or 250 mM mannitol showed the germination rate of TaPLDα-overexpressing seeds was lower than corresponding WT (Fig. 5), suggesting that TaPLDα-overexpressing transgenic plants were

There was no difference in the rate of seed germination between controls and transgenic plants in the absence of ABA treatment (Fig. 5). In the presence of added ABA, the germination of both control and TaPLDα-overexpressing seeds was inhibited significantly, but TaPLDαoverexpressing seeds were inhibited to a greater extent

13

Planta

Fig. 6  Drought stress tolerance of WT and TaPLDα-overexpressing transgenic plants. a Phenotypic comparison of 2-week-old plants under drought stress. b Quantitative analysis of survival of TaPLDαoverexpressing transgenic plants (lines 1 and 2) and WT after rewatering. Values are the mean ± SD (n  = 15 plants). c and d RWC

and relative electrolyte leakage of WT and TaPLDα-overexpressing transgenic plants under drought stress. e Water loss in WT and overexpressing plants in response to dehydration. Data represent mean ± SD (n = 3), ** P ≤ 0.01

more sensitive to ABA and osmotic stress at seed germination stage than those of WT.

exhibited lower electrolyte leakage and slower water loss in detached rosette leaves, but higher RWC than WT under drought stress as shown in Fig. 6c–e. These results demonstrated that the overexpression of TaPLDα in transgenic Arabidopsis can significantly increase drought tolerance.

Overexpression of TaPLDα enhanced the tolerance of transgenic Arabidopsis to drought stress The phenotypes of transgenic lines and WT treated with DEX under drought stress were monitored. When subjected to drought stress for 10 days, leaf wilting was more evident in 2-week-old control groups than age-matched TaPLDα-overexpressing lines (Fig. 6a). The transgenic plants showed a stronger growth recovery and higher survival rate than those of WT plants after watering resumed (Fig.  6b). Furthermore, TaPLDα-overexpressing plants

Growth changes in TaPLDα‑overexpressing and WT seedlings under osmotic stress Under mannitol treatment, TaPLDα-overexpressing lines showed enhanced responses to stress as compared to control lines (Fig. 7). The analysis of primary root length showed that there was no significant difference between

13

Planta

Fig. 7  Analysis of osmotic stress responses of WT and TaPLDαoverexpressing plants. 7-day-old WT and TaPLDα-overexpressing plants growing on 1/2 MS medium were transferred to 1/2 MS medium containing 150 mM mannitol and 0.1 % ethanol (a, mock) or

10 μM DEX (b). The photos were taken after 7 days. c Root length of WT and TaPLDα-overexpressing transgenic plants with 150 mM mannitol. Data represent mean ± SD (n = 3), *P ≤ 0.05, **P ≤ 0.01

WT and transgenic lines under non-stress conditions (Fig. 7c). With 150 mM mannitol, however, root length of all TaPLDα-overexpressing lines was longer than that of control, although generally the root length for both control and transgenic lines decreased significantly when compared with counterparts under control conditions (Fig. 7c).

However, cloning and molecular characterization of PLD has not been reported in wheat. In the present study, we cloned and characterized a PLD gene from wheat, designated TaPLDα, and evaluated the role of TaPLDα in response to drought and osmotic stress by generating transgenic Arabidopsis plants overexpressing TaPLDα. TaPLDα contains one C2 domain and two characteristic HKD motifs (Fig. 1), which consist of active sites essential for PLD catalytic activity in vitro and in vivo (Wang 2000; Qin and Wang 2002). Multiple sequence alignments revealed that TaPLDα shares a high degree of sequence similarity to many other PLDα from higher plants at the amino acid level, indicating that TaPLDα belongs to the PLD superfamily (Fig. 2). As reported previously, PLDα was expressed in all examined plant organs under normal growth conditions (Fan et al. 1999; Wang 2000; Wang et al. 2002). This constitutive expression of PLDα allows it to be activated rapidly in cellular responses (Wang et al. 2002). In our study, as shown in Fig. 3a, TaPLDα was expressed constitutively in all tested organs. The expression of PLD was up-regulated in response to various hyperosmotic stresses and phytohormones in several independent studies (Frank et al. 2000; Laxalt et al. 2001; Katagiri et al. 2001; Bargmann et al. 2009; Peng et al. 2010; Singh et al. 2012). Here, we demonstrated that the expression of TaPLDα in wheat was significantly induced by ABA, MeJA, dehydration, PEG and NaCl stress (Fig. 3b–f), which is consistent with previous reports in other species (Ryu and Wang 1995; EI Maarouf et al. 1999; Darwish et al. 2009; Peng et al. 2010). The expression of stress-induced genes has previously been associated with stress tolerance (Hong et al. 2010). The fact

Overexpression of TaPLDα affects the expression of stress‑responsive genes To elucidate the molecular mechanism of TaPLDα in stress tolerance, RT-qPCR experiments were performed to compare the transcript levels of four related stress-responsive genes between controls and TaPLDα-overexpressing lines with gene-specific primers (Table 1). Under normal conditions, RD29A, RD29B, RAB18 and KIN1 showed no significant difference between controls and overexpressing lines. However, four genes all showed higher expression levels in both WT and transgenic plants under dehydration treatment for 4 h, and the mRNA levels of these genes in the overexpressing seedlings were significantly higher than those in controls (Fig. 8).

Discussion Production of wheat is affected by multiple environmental stresses, including drought, salinity and extreme temperatures. Increasing evidence indicates that PLD and PA play important and complex roles in plant stress tolerance (Testerink and Munnik 2005; Bargmann and Munnik 2006; Wang et al. 2006; Hong et al. 2010; Zhang et al. 2010).

13

Planta

Fig. 8  Expression of stress-responsive genes in WT and TaPLDαoverexpressing plants in response to dehydration. The plants grew on 1/2 MS medium containing 0.1 % ethanol (mock) or 10 μM DEX for 2 weeks and followed by dehydration treatment for 0 (normal) and

4 h. The expression of RD29A (a), RD29B (b), KIN1 (c), and RAB18 (d) was analyzed by RT-qPCR. AtActin was used as an internal control. Data represent mean ± SD (n = 3), **P ≤ 0.01

that TaPLDα responds to a broad range of environmental stresses implies that it might be involved in several different stress signaling pathways. To further understand the function of TaPLDα under stress, we employed transgenic Arabidopsis plants overexpressing TaPLDα under the control of the DEX-inducible 35S promoter. The TaPLDα gene will not be expressed until DEX is applied and such system offers the possibility of genes of interest expression to a particular developmental stage (Samalova et al. 2005; Moore et al. 2006). An evident advantage of this system is that we can apply the induction of gene expression in any stages we are interested in without much worrying about ectopic effects (Zuo and Chua 2000; Moore et al. 2006). When transgenic plants were treated with DEX, GUS activity was dramatically enhanced when compared with control treatments. Moreover, the overexpression of TaPLDα was detected only in Arabidopsis plants treated with DEX (Fig. 4). These results indicated that DEX was the main regulator involved

in the expression of TaPLDα. In addition, TaPLDαoverexpressing transgenic Arabidopsis exhibited increased sensitivity to ABA and osmotic stress at the seed germination stage (Fig. 5), suggesting that the TaPLDα might be involved in responses to drought and osmotic stress in an ABA-dependent manner. Under drought stress conditions, TaPLDαoverexpressing plants grew better than control plants (Fig.  6a, b), suggesting that Arabidopsis plants with increased levels of TaPLDα have higher tolerance and are more resistant to drought stress. In addition, our results revealed that TaPLDα-overexpressing plants have higher RWC and lower relative electrolyte leakage (Fig. 6c, d). RWC is a typical phenotypic and physiological parameter used for evaluating plant water status under drought tolerance. Membrane integrity and stability is essential for plant survival and resistance to stress, and can be assessed by measuring electrolyte leakage from cells under environmental stress. These results indicated that

13

Planta

TaPLDα-overexpressing transgenic Arabidopsis had higher water retention and osmotic adjustment abilities, and thus increased tolerance to abiotic stresses. The observation that transgenic plants had a lower rate of water loss from leaves than those of WT plants (Fig. 6e) is consistent with this hypothesis. Our findings agree with previous results reporting that PLDα conferred enhanced stress tolerance, in transgenic plants (EI Maarouf et al. 1999; Sang et al. 2001; Guo et al. 2006; Zhang et al. 2008; Peng et al. 2010; Lu et al. 2013). Interestingly, it was shown in tobacco that PLDα1 exhibits a dual function under drought conditions, whereby PLDα1 overexpressing plants show reduced water loss due to efficient stomatal closure in the early stages of drought, while at the later stages these plants exhibited more susceptibility due to enhanced membrane degradation (Hong et al. 2008b). Furthermore, we investigated the effect of mannitol treatment on the performance of TaPLDα-overexpressing transgenic plants and found that the overexpression of TaPLDα in Arabidopsis significantly improved stress tolerance (Fig. 7). To identify whether TaPLDα affects the expression of stress-related genes, four related genes involved in the stress response, RD29A, RD29B, KIN1 and RAB18, were analyzed by RT-qPCR (Fig. 8). It has previously been found that these genes are induced by different stresses through an ABA-dependent pathway, and that higher expression levels of these genes improves plant tolerance to stress (Shinozaki and Yamaguchi-Shinozaki 1997; Zhu 2002). Higher levels of RD29A, RD29B, KIN1, and RAB18 transcripts in TaPLDα-overexpressing plants suggests that TaPLDα may regulate upstream genes in stress tolerance and could be involved in cross-talk between the complex networks of stress-responsive genes, which accounts for the enhanced tolerance of TaPLDα-overexpressing plants to drought and osmotic stresses. In conclusion, our results demonstrated that TaPLDα is a member of the PLDα family from common wheat. Furthermore, we investigated the function of TaPLDα under drought and osmotic stress, and obtained new transgenic Arabidopsis lines with enhanced tolerance. Our data indicate that regulation of TaPLDα has the potential to improve wheat growth under drought. Although the detailed mechanism of TaPLDα function in response to abiotic stress is not completely understood, our current data provides valuable information for molecular breeding that could lead to improved stress tolerance in crops. Acknowledgments  We would like to thank Dr. Deirdre H. McLachlan (the Sainsbury Laboratory, Norwich Research Park, UK) for her critical reading of the manuscript and Dr. Xiaobin Ou (College of Life Sciences, Zhejiang University, China) for his helpful advice on the manuscript. This work was supported by Natural Science Foundation of Tianjin (11JCYBJC09100); Higher School Science and Technology Program of Tianjin (20130606); National Natural Science

13

Foundation of China (31240024) and National High-tech R&D Program of China (2012AA10A309).

References Bargmann BO, Munnik T (2006) The role of phospholipase D in plant stress responses. Curr Opin Plant Biol 9:515–522 Bargmann BO, Laxalt AM, ter Riet B, van Schooten B, Merquiol E, Testerink C, Haring MA, Bartels D, Munnik T (2009) Multiple PLDs required for high salinity and water deficit tolerance in plants. Plant Cell Physiol 50:78–89 Barrs HD, Weatherley PE (1962) A re-examination of the relative turgidity technique for estimating water deficit in leaves. Aust J Biol Sci 15:413–428 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16:735–743 Craft J, Samalova M, Baroux C, Townley H, Martinez A, Jepson I, Tsiantis M, Moore I (2005) New pOp/LhG4 vectors for stringent glucocorticoid-dependent transgene expression in Arabidopsis. Plant J 41:899–918 Darwish E, Testerink C, Khalil M, El-Shihy O, Munnik T (2009) Phospholipid signaling responses in salt-stressed rice leaves. Plant Cell Physiol 50:986–997 Distéfano AM, Scuffi D, García-Mata C, Lamattina L, Laxalt AM (2012) Phospholipase Dδ is involved in nitric oxide-induced stomatal closure. Planta 236:1899–1907 EI Maarouf H, Zuily-Fodil Y, Gareil M, d’Arcy-Lameta A, Pham-Thi AT (1999) Enzymatic activity and gene expression under water stress of phospholipase D in two cultivars of Vigna unguiculata L. Walp. differing in drought tolerance. Plant Mol Biol 39:1257–1265 Fan L, Zheng S, Wang X (1997) Antisense suppression of phospholipase D alpha retards abscisic acid- and ethylene-promoted senescence of postharvest Arabidopsis leaves. Plant Cell 9:2183–2196 Fan L, Cui D, Wang X (1999) Subcellular distribution and tissue expression of phospholipase Dα, β, and δ, in Arabidopsis. Plant Physiol 119:1371–1378 Frank W, Munnik T, Kerkmann K, Salamini F, Bartels D (2000) Water deficit triggers phospholipase D activity in the resurrection plant Craterostigma plantagineum. Plant Cell 12:111–123 Guo B, Xu G, Cao Y, Holbrook C, Lynch R (2006) Identification and characterization of phospholipase D and its association with drought susceptibilities in peanut (Arachis hypogaea). Planta 223:512–520 Guo L, Mishra G, Markham JE, Li M, Tawfall A, Welti R, Wang X (2012a) Connections between sphingosine kinase and phospholipase D in the abscisic acid signaling pathway in Arabidopsis. J Biol Chem 287:8286–8296 Guo L, Devaiah SP, Narasimhan R, Pan X, Zhang Y, Zhang W, Wang X (2012b) Cytosolic glyceraldehyde-3-phosphate dehydrogenases interact with phospholipase Dδ to transduce hydrogen peroxide signals in the Arabidopsis response to stress. Plant Cell 24:2200–2212 Hong Y, Pan X, Welti R, Wang X (2008a) Phospholipase Dα3 is involved in the hyperosmotic response in Arabidopsis. Plant Cell 20:803–816 Hong Y, Zheng S, Wang X (2008b) Dual functions of phospholipase Dα1 in plant response to drought. Mol Plant 1:262–269 Hong Y, Zhang W, Wang X (2010) Phospholipase D and phosphatidic acid signalling in plant response to drought and salinity. Plant, Cell Environ 33:627–635 Jefferson RA (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol Biol Rep 5:387–405

Planta Katagiri T, Takahashi S, Shinozaki K (2001) Involvement of a novel Arabidopsis phospholipase D, AtPLDδ, in dehydration inducible accumulation of phosphatidic acid in stress signalling. Plant J 26:595–605 Laxalt AM, ter Riet B, Verdonk JC, Parigi L, Tameling WI, Vossen J, Haring M, Musgrave A, Munnik T (2001) Characterization of five tomato phospholipase D cDNAs: rapid and specific expression of LePLDbeta1 on elicitation with xylanase. Plant J 26:237–247 Li W, Li M, Zhang W, Welti R, Wang X (2004) The plasma membrane-bound phospholipase Dδ enhances freezing tolerance in Arabidopsis thaliana. Nat Biotechnol 22:427–433 Liang YK, Xie X, Lindsay SE, Wang YB, Masle J, Williamson L, Leyser O, Hetherington AM (2010) Cell wall composition contributes to the control of transpiration efficiency in Arabidopsis thaliana. Plant J 64:679–686 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25:402–408 Lu S, Bahn SC, Qu G, Qin H, Hong Y, Xu Q, Zhou Y, Hong Y, Wang X (2013) Increased expression of phospholipase Dα1 in guard cells decreases water loss with improved seed production in Brassica napus. Plant Biotechnol J 11:380–389 Mishra G, Zhang W, Deng F, Wang X (2006) A bifurcating pathway directs abscisic acid effects on stomatal closure and opening in Arabidopsis. Science 312:264–266 Moore I, Samalova M, Kurup S (2006) Transactivated and chemically inducible gene expression in plants. Plant J 45:651–683 Munnik T, Meijer HJ, Ter Riet B, Hirt H, Frank W, Bartels D, Musgrave A (2000) Hyperosmotic stress stimulates phospholipase D activity and elevates the levels of phosphatidic acid and diacylglycerol pyrophosphate. Plant J 22:147–154 Peng Y, Zhang J, Cao G, Xie Y, Liu X, Lu M, Wang G (2010) Overexpression of a PLDα1 gene from Setaria italica enhances the sensitivity of Arabidopsis to abscisic acid and improves its drought tolerance. Plant Cell Rep 29:793–802 Qin C, Wang X (2002) The Arabidopsis phospholipase D family. Characterization of a calcium-independent and phosphatidylcholine-selective PLDζ1 with distinct regulatory domains. Plant Physiol 128:1057–1068 Ritchie S, Gilroy S (1998) Abscisic acid signal transduction in the barley aleurone is mediated by phospholipase D activity. Proc Natl Acad Sci USA 95:2697–2702 Ryu BS, Wang X (1995) Expression of phospholipase D during castor bean leaf senescence. Plant Physiol 108:713–719 Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425 Samalova M, Brzobohaty B, Moore I (2005) pOp6/LhGR: a stringently regulated and highly responsive dexamethasone-inducible gene expression system for tobacco. Plant J 41:919–935 Sang Y, Zheng S, Li W, Huang B, Wang X (2001) Regulation of plant water loss by manipulating the expression of phospholipase Dα. Plant J 28:135–144 Shinozaki K, Yamaguchi-Shinozaki K (1997) Gene expression and signal transduction in water-stress response. Plant Physiol 115:327–334 Singh A, Pandey A, Baranwal V, Kapoor S, Pandey GK (2012) Comprehensive expression analysis of rice phospholipase D gene family during abiotic stresses and development. Plant Signal Behav 7:847–855 Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using

maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28:2731–2739 Testerink C, Munnik T (2005) Phosphatidic acid: a multifunctional stress signaling lipid in plants. Trends Plant Sci 10:368–375 Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25:4876–4882 Wang X (2000) Multiple forms of phospholipase D in plants: the gene family, catalytic and regulatory properties, and cellular functions. Prog Lipid Res 39:109–149 Wang X (2005) Regulatory functions of phospholipase D and phosphatidic acid in plant growth, development, and stress responses. Plant Physiol 139:566–573 Wang X, Wang C, Sang Y, Qin C, Welti R (2002) Networking of phospholipases in plant signal transduction. Physiol Plant 115:331–335 Wang W, Vinocur B, Altman A (2003) Plant responses to drought, salinity and extreme temperatures: towards genetic engineering for stress tolerance. Planta 218:1–14 Wang X, Devaiah SP, Zhang W, Welti R (2006) Signaling functions of phosphatidic acid. Prog Lipid Res 45:250–278 Welti R, Li W, Li M, Sang Y, Biesiada H, Zhou H, Rajashekar CB, Williams TD, Wang X (2002) Profiling membrane lipids in plant stress responses. J Biol Chem 277:31994–32002 Ying S, Zhang DF, Fu J, Shi YS, Song YC, Wang TY, Li Y (2012) Cloning and characterization of a maize bZIP transcription factor, ZmbZIP72, confers drought and salt tolerance in transgenic Arabidopsis. Planta 235:253–266 Yu L, Nie J, Cao C, Jin Y, Yan M, Wang F, Liu J, Xiao Y, Liang Y, Zhang W (2010) Phosphatidic acid mediates salt stress response by regulation of MPK6 in Arabidopsis thaliana. New Phytol 188:762–773 Zhang W, Wang C, Qin C, Wood T, Olafsdottir G, Welti R, Wang X (2003) The oleate-stimulated phospholipase D, PLDδ, and phosphatidic acid decrease H2O2-induced cell death in Arabidopsis. Plant Cell 15:2285–2295 Zhang W, Qin C, Zhao J, Wang X (2004) Phospholipase Dα1derived phosphatidic acid interacts with ABI1 phophatase 2C and regulates abscisic acid signaling. Proc Natl Acad Sci USA 101:9508–9513 Zhang T, Song Y, Liu Y, Guo X, Zhu C, Wen F (2008) Overexpression of phospholipase Dα gene enhances drought and salt tolerance of Populus tomentosa. Chin Sci Bull 53:3656–3665 Zhang W, Wan X, Hong Y, Li W, Wang X (2010) Plant phospholipase D. In: Munnik T (ed) Lipid signaling in plants (plant cell monographs). Springer publishing company, Berlin, pp 39–62 Zhang Q, Lin F, Mao T, Nie J, Yan M, Yuan M, Zhang W (2012) Phosphatidic acid regulates microtubule organization by interacting with MAP65-1 in response to salt stress in Arabidopsis. Plant Cell 24:4555–4576 Zhou S, Hu W, Deng X, Ma Z, Chen L, Huang C, Wang C, Wang J, He Y, Yang G, He G (2012) Overexpression of the wheat aquaporin gene, TaAQP7, enhances drought tolerance in transgenic tobacco. PLoS One 7:e52439 Zhu JK (2002) Salt and drought stress signal transduction in plants. Annu Rev Plant Biol 53:247–273 Zuo J, Chua NH (2000) Chemical-inducible systems for regulated expression of plant genes. Curr Opin Biotechnol 11:146–151

13