Journal of Plant Physiology 173 (2015) 62–71

Contents lists available at ScienceDirect

Journal of Plant Physiology journal homepage: www.elsevier.com/locate/jplph

Physiology

Over-expression of TaEXPB23, a wheat expansin gene, improves oxidative stress tolerance in transgenic tobacco plants Yangyang Han a,b,1 , Yanhui Chen a,1 , Suhong Yin a , Meng Zhang a , Wei Wang a,∗ a State Key Laboratory of Crop Biology, Shandong Key Laboratory of Crop Biology, College of Life Sciences, Shandong Agricultural University, Tai’an, Shandong 271018, PR China b Plastic Surgery Institute of Weifang Medical University, Weifang, Shandong 261041, PR China

a r t i c l e

i n f o

Article history: Received 17 October 2013 Received in revised form 14 August 2014 Accepted 3 September 2014 Available online 2 October 2014 Keywords: Abiotic stress Antioxidant enzyme Cell wall peroxidase Expansin Methyl viologen

a b s t r a c t Expansins are cell wall proteins inducing cell wall loosening and participate in all plant growth and development processes which are associated with cell wall modifications. Here, TaEXPB23, a wheat expansin gene, was investigated and the tolerance to oxidative stress was strongly enhanced in over-expression tobacco plants. Our results revealed that over-expressing TaEXPB23 influenced the activity of antioxidant enzymes: in particular, the activity of the cell wall-bound peroxidase. The enhanced tolerance to oxidative stress and increased cell wall-bound peroxidase activity were partly inhibited by an anti-expansin antibody. The Arabidopsis expansin mutant atexpb2 showed reduced cell wall-bound peroxidase activity and decreased oxidative stress tolerance. In addition, atexpb2 exhibited lower chlorophyll contents and the germination rate compared to wild type (WT). Taken together, these results provided a new insight on the role of expansin proteins in plant stress tolerance by cell wall bound peroxidase. © 2014 Elsevier GmbH. All rights reserved.

Introduction Expansins are a group of non-enzymatic cell wall proteins belonging to a superfamily of genes with four families (Cosgrove, 1999, 2000, 2005; Lee et al., 2001). Expansins loosen the cell wall in a pH-dependent manner. It is hypothesized that they break the hydrogen bonds between hemicellulose and cellulose microfibrils, thereby allowing turgor-driven cell enlargement (McQueen-Mason and Cosgrove, 1994). Previous studies have provided evidence that expansins are associated with environmental stress tolerance in plants. Wu et al. (2001) reported that at least two expansin genes are up-regulated in apical regions of the maize root elongation zone at low water potential implying that expansins may play an important role in maintaining root growth under water stress. In Craterostigma plantagineum, the increase of expansin activity was accompanied by the

Abbreviations: APX, ascorbate peroxidase; CAT, catalase; DHAR, dehydroascorbate reductase; GR, glutathione reductase; H2 O2 , hydrogen peroxide; MDA, malondialdehyde; MS, Murashige and Skoog; MV, methyl viologen; POD, peroxidase; ROS, reactive oxygen species; SOD, superoxide dismutase; WT, wild type. ∗ Corresponding author. Tel.: +86 538 8246166; fax: +86 538 8242288. E-mail addresses: [email protected] (Y. Han), [email protected] (Y. Chen), [email protected] (S. Yin), [email protected] (M. Zhang), [email protected], [email protected] (W. Wang). 1 These authors contributed equally to this paper. http://dx.doi.org/10.1016/j.jplph.2014.09.007 0176-1617/© 2014 Elsevier GmbH. All rights reserved.

enhancement of wall extensibility during the processes of dehydration and rehydration, suggesting a role for expansin proteins in increasing wall flexibility and promoting leaf growth under drought stress (Jones and McQueen-Mason, 2004). Over-expression of rose expansin gene RhEXPA4 in Arabidopsis conferred strong tolerance to drought stress, salt stress and ABA (Dai et al., 2012; Lü et al., 2013). Our previous results showed that overexpression of a wheat expansin gene, TaEXPB23, enhanced drought and salt stress tolerance in transgenic tobacco (Han et al., 2012; Li et al., 2011a). However, the regulatory mechanisms that govern the action of expansin proteins are poorly understood. Abiotic stresses, such as drought, cold, and salinity, result in the production and accumulation of reactive oxygen species (ROS), which are highly reactive and toxic to plant cells (Apel and Hirt, 2004). There is ample evidence showing that antioxidative systems are involved in plant stress tolerance like salt stress tolerance (Mittler, 2002) and drought tolerance (Aroca et al., 2003). Among plant antioxidative systems, antioxidant enzymes, such as superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD), play important roles in the stress response (Foyer and Noctor, 2005). In particular, plants possess two classes of heme peroxidases (EC 1.11.1.7), class I and class III, according to the classification scheme proposed by Welinder (1980). Class I peroxidases are intracellular, whereas class III peroxidases are secreted into the cell wall or the surrounding medium (Passardi et al., 2004).

Y. Han et al. / Journal of Plant Physiology 173 (2015) 62–71

In the current study, to understand the mechanisms underlying improved abiotic stress tolerance in transgenic tobacco plants overexpressing TaEXPB23, we focused on the functions of TaEXPB23 in oxidative stress tolerance as oxidative stress is a ubiquitous type of secondary stress. Methyl viologen (1,1 -dimethyl-4,4 bipyridinium dichloride, MV), the active ingredient in the herbicide paraquat, exerts its phototoxic effects on plants by transferring electrons from photosystem I to molecular oxygen (Dodge, 1994). Therefore, MV was used in this study to induce oxidative stress. Our results demonstrated that over-expression of TaEXPB23 influenced the activity of antioxidant enzymes. In particular, the activity of the covalently bound cell wall peroxidase was strongly enhanced after MV treatment, and decreased when expansin activity was specifically inhibited by antibodies. In addition, the oxidative stress tolerance and the cell wall-bound peroxidase activity of the Arabidopsis mutant atexpb2 decreased significantly compared to Col-0, indicating that expansins, at least AtEXPB2, is involved in the oxidative stress response. Our work provides new insight on the role of expansin proteins in plant stress tolerance. Materials and methods Plant materials, growth conditions, and treatments Transgenic tobacco plants carrying the 35S::TaEXPB23 construct were generated as previously described (Xing et al., 2009). The ␤-expansin gene TaEXPB23 was isolated from wheat (Triticum aestivum L.) coleoptiles. Sterilized tobacco (Nicotiana tabacum L. cv. NC89) seeds were germinated on Murashige and Skoog (MS) medium in a growth chamber (25 ◦ C, 16/8 h light/dark, 300–400 ␮mol photons m−2 s−1 ) and their leaves were used for transformation. T3 generation plants of homozygous transgenic tobacco from lines T3-1, T3-8, and T3-10 were used in this study. Tobacco seeds were sown in pots (8 cm × 10 cm) containing vermiculite soaked in 0.5× Hoagland’s nutrient solution in a growth chamber at 25 ◦ C, with a 16/8 h light/dark cycle (300–400 ␮mol photons m−2 s−1 ) at a relative humidity of 75–80%. For methyl viologen (MV) treatment, whole plants were sprayed with MV solution (100 ␮M) containing 0.1% Tween-20, and then transferred to an illuminated incubation chamber (GXZ-500C, Jiangnan, China) with a photon flux density of 100 ␮mol m−2 s−1 for 24 h. For young seedlings, tobacco seeds were germinated and grown under control growth conditions in the presence of 5 or 10 ␮M MV for 2 weeks, or 2-week-old tobacco seedlings were transferred to MV solution (50 or 100 ␮M) for 2 days. All physiological and biochemical measurements were carried out using the youngest, fully expanded leaves. The Arabidopsis atexpb2 mutant was obtained from the ABRC and genotyped by PCR using the genomic primers AtEXPB2LP, AtEXPB2-RP, and the left T-DNA border primer LBb1.3 (http://signal.salk.edu). The original line was SALK-048197. Arabidopsis plants were grown in soil under long-day conditions (16 h light, 8 h dark) at 22 ◦ C. Measurement of chlorophyll content and malondialdehyde (MDA) level Chlorophyll in the leaf disks was extracted using 95% ethanol and quantified by UV spectrophotometer (Kong et al., 2011). The MDA level was assayed according to Quan et al. (2004). Gene expression analysis by qRT-PCR Total RNA was extracted from transgenic tobacco plants with Trizol reagent (TaKaRa, Japan) according to the manufacturer’s protocol, and was then treated with DNase I (RNase-free, Promega).

63

Table 1 The primers sequence. Primer name

Primer sequence (5 –3 )

Length (bp)

Ntactin-F (U60489) Ntactin-R (U60489) NtSOD-F (AB093097) NtSOD-R (AB093097) NtCA-F (AF454759) NtCA-R (AF454759) NtRbohD-F (AJ309006) NtRbohD-R (AJ309006) NtCAT1-F (U93244) NtCAT1-R (U93244) NtGPX-F (AB041518) NtGPX-R (AB041518) NtAPX1-F (AU15933) NtAPX1-R (AU15933) NtAPX2-F (D85912) NtAPX2-R (D85912) AtEXPB2-LP AtEXPB2-RP LBb1.3

CATTGGCGCTGAGAGATTCC GCAGCTTCCATTCCGATCA GACGGACCTTAGCAACAGG CTGTAAGTAGTATGCATGTTC CGCCTGTGGAGGTATCAAA GAGAAGGAGAAAGACCGAACT ACCAGCACTGACCAAAGAA TAGCATCACAACCACAACTA TGGATCTCATACTGGTCTCA TTCCATTGTTTCAGTCATTCA GGTTTGCACTCGCTTCAAG AGTAGTGGCAAAACAGGAAG GAGAAATATGCTGCGGATGA CGTCTAATAACAGCTGCCAA GACAACTCATACTTTACGGA CTTCAGCAAATCCCAACTCA AATTCAAACGGTTGTTTGTGC AACATGCACCACATCCTTTTC ATTTTGCCGATTTCGGAAC

20 19 19 21 19 21 19 20 20 21 19 20 20 20 20 20 21 21 19

Total RNA was subjected to first-strand cDNA synthesis using the RevertAid First Strand cDNA Synthesis Kit (Fermentas, USA) according to the manufacturer’s instructions. qPCR analysis was performed using the Bio-Rad CFX Manager system as described previously (Han et al., 2012). The relative transcript abundance for genes is relative to the actin transcript levels measured in the same sample. The primers used for qPCR are given in Table 1. The GenBank accession numbers for the sequences used in this study are: U60489 (actin), AB093097 (NtSOD), AF454759 (NtCA), AJ309006 (NtRbohD), U93244 (NtCAT1), AB041518 (NtGPX), AU15933 (NtAPX1), and D85912 (NtAPX2). Extraction and assay of antioxidant enzyme activity Tobacco seedlings treated with MV were collected to measure the activities of antioxidant enzymes, including superoxide dismutase (SOD) (EC1.15.1.1), peroxidase (POD) (EC 1.11.1.7), catalase (CAT) (EC 1.11.1.6), and ascorbate peroxidase (APX) (EC 1.11,1.1), as described previously (Hui et al., 2012). The glutathione reductase (GR) and dehydroascorbate reductase (DHAR) activities were determined according to Li et al. (2011b). Enzyme activity assays were carried out in a UV–vis spectrophotometer (UV-2550, Shimadzu, Japan) at 25 ◦ C. The protein concentration of the enzyme extracts was determined according to the method of Bradford (1976). Isolation, extraction and determination of peroxidase The soluble, ionically cell wall-bound, and covalently bound peroxidase fractions were prepared from 100 mg of tobacco seedlings according to the method of Hendriks et al., 1985 with slight modifications. A fraction that was assumed to contain mainly soluble peroxidase was prepared essentially as described previously (Csiszár et al., 2011). The pellet from a crude leaf homogenate was washed twice with an aqueous solution of Triton X-100 (1%), and five times with deionized water. The ionically bound fraction was extracted from the washed pellet by incubation in NaC1 (1 M, 15 h, 6 ◦ C). Thereafter, the pellet was washed twice with NaCl (1 M) and five times with deionized water. A covalently bound fraction was then extracted from the washed and salt-extracted pellet by incubation (2 h, 37 ◦ C) in a solution containing mannitol (0.6 M), 2% Cellulase R-10 (Japan Yakult), and 0.2% Macerozyme R-10 (Japan Yakult). The assay mixture for spectrophotometric determination of peroxidase activity consisted of a Na-acetate buffer (0.05 M,

64

Y. Han et al. / Journal of Plant Physiology 173 (2015) 62–71

Fig. 1. Expression pattern analysis of TaEXPB23 under MV treatment. Wheat seedlings were cultivated in an incubator in the dark for 36 h (h) at 26 ◦ C after seed germination and the treated with 50 ␮M MV for 12 or 24 h. Seedlings grew under normal growth conditions were used as the controls. The expression data correspond to the means of triplicates, normalized to ␣-tubulin. Expression levels are indicated in arbitrary units ± SE.

pH 5), containing guaiacol (4.0 mM) and hydrogen peroxide (H2 O2 ) (2.2 mM). After the addition of 0.01 ml of an enzyme fraction, the linear increase in the absorbance at 470 nm was followed continuously for at least 1 min. Leaf disk assay for MV sensitivity MV damage analysis using leaf disks was performed as described by Lee et al. (2007) with slight modifications. Leaf disks from the third leaf of three individual T3 plants grown in greenhouse for 2 months were transferred to 60 mm Petri dishes containing 10 ml of MV solution at various concentrations (0, 50, 100 ␮M), and then incubated at 25 ◦ C for 24 h under continuous white light (100 ␮mol m−2 s−1 ). The effect of MV on leaf disks was analyzed by monitoring the phenotypic changes and measuring the chlorophyll content as described in “Measurement of chlorophyll content and MDA level” section. Inhibition of expansin activity by antibodies Expansin antibody was obtained from a recombinant expansin protein (TaEXPB23) which was described previously (Gao et al., 2008). The protein was extracted from the host Escherichia coli cell and purified by SDS-PAGE. The band containing expansin protein was cut from the gel, dried, pulverized, and homogenized with Freund’s adjuvants prior to immunization of the rabbit. Seven weeks after the initial injection, serum was harvested. Non-immune serum at the same dilution was used as control. Antibody-mediated suppression of expansin activity was performed according to previous methods with some modifications (Gao et al., 2008; Inouhe and Nevins, 1991). The transgenic tobacco seedlings were rinsed with distilled water, placed in K-citrate phosphate buffer (10 mM, pH 6.5) containing the anti-TaEXPB23 antibody (100 ␮l/ml), maintained under vacuum at −2.5 MPa for 20 min, and then incubated for 1 h. Results Tolerance of transgenic tobacco plants to oxidative stress We first examined the mRNA level of TaEXPB23 in wheat coleoptiles under MV stress. As the results show in Fig. 1, the expression

level of TaEXPB23 was obviously induced at both 12 and 24 h compared to control under MV-induced stress. Then, we observed the phenotypes of both wild type (WT) and transgenic plants overexpressing TaEXPB23 under MV stress. In normal growth conditions without MV, no difference was observed between WT and the three transgenic lines. When 2-week-old seedlings were exposed to MV (5 or 10 ␮M) for 2 days, WT plants showed a severe inhibited phenotype, whereas the transgenic plants displayed a high tolerance to MV (Fig. 2A). Measurements of the fresh weight and primary root length have similar results. As the results show in Fig. 2B and C, the transgenic plants exhibited higher fresh weight and longer primary root than WT under oxidative stress. We further tested the tolerance of leaf disks from 2-month-old plants to exogenously applied MV. As shown in Fig. 2D, the discs incubated in water without MV showed no differences between the transgenic tobacco plants and WT. After incubation in either 50 or 100 ␮M MV for 24 h, symptoms of bleaching or chlorosis appeared on the leaf disks from both WT and transgenic plants, with more severe damage observed in the WT than the transgenic plants. This was further supported by the chlorophyll contents shown in Fig. 2E. In addition, the transgenic plants showed a significantly lower malondialdehyde (MDA) content compared to WT following MV treatment, while no significant difference under control conditions (Fig. 2F). All the results in Fig. 2 suggest that over-expressing TaEXPB23 can improve the tolerance of transgenic tobacco plants to oxidative stress. Changes in mRNA transcription for antioxidant-related genes during oxidative stress To investigate the molecular mechanisms underlying the enhanced oxidative stress tolerance in transgenic tobacco, we performed qPCR analysis on several known antioxidant-related genes in tobacco, including NtSOD, NtCA, NtRbohD, NtCAT1, NtAPX1, NtAPX2, and NtGPX. NtSOD encodes SOD, which has been reported to enhance oxidative stress tolerance (Slooten et al., 1995). NtCA encodes carbonic anhydrase, which displays antioxidant activity and functions in the hypersensitive defense response (Slaymaker et al., 2002). NtRbohD, a tobacco respiratory burst oxidase gene, encodes an enzyme homologous to mammalian NADPH oxidase (Morel et al., 2004; Simon-Plas et al., 2002). NtCAT1, NtAPX1, NtAPX2, and NtGPX encode catalase, cytosolic ascorbate peroxidase, chloroplastic ascorbate peroxidase, and glutathione peroxidase, respectively. The enzymes encoded by these four genes catalyze a number of oxidative reactions with hydrogen peroxide (H2 O2 ) as an electron acceptor (Pasqualini et al., 2007). As shown in Fig. 3, MV treatment up-regulated the expression of some antioxidant-related genes, e.g. NtCA, NtRbohD, NtAPX1 and NtAPX2. However, the relative expression of other three genes (NtSOD, NtCAT1, NtGPX) showed almost no changes after MV treatment. Compared to WT plants, the expression levels of the four up-regulated genes were higher in transgenic plants in response to MV treatment. However, the mRNA levels for NtSOD, NtCA, NtCAT1, and NtAPX2 decreased in transgenic plants relative to WT under control growth conditions. These results indicated that TaEXPB23 may be involved in the response of MV stress and is related to the transcript level of some antioxidant genes. Changes in antioxidant enzyme activity in different tobacco plants under oxidative stress We detected the changes in the activities of antioxidant enzymes in plants exposed to MV-induced stress. The results showed that the activities of POD, CAT, and ascorbate peroxidase (APX) were all significantly increased after MV treatment compared

Y. Han et al. / Journal of Plant Physiology 173 (2015) 62–71

65

Fig. 2. Overexpression of TaEXPB23 confers increased tolerance to oxidative stress. (A) Phenotypes of 2-week-old seedlings in the presence of the indicated MV concentrations. (B and C) The corresponding fresh weight are shown in (B) and their primary root length in (C). (D) Leaf disks from 2-month-old WT and transgenic plants were infiltrated with different concentrations of MV (0, 50 and 100 ␮M). (E) The chlorophyll content of leaf disks after MV treatment. (F) The MDA content of 2-month-old plants treated with indicated MV concentrations. Each column in (B), (C), (E) and (F) is the mean ± standard error from three independent experiment, and the results in (A) and (D) were replicated at least three times. * and ** indicate significant differences in comparison with the WT at P < 0.05 and P < 0.01 according to Duncan’s multiple range test.

to the normal conditions (Fig. 4B–D), but the activities were lower in the transgenic plants than in WT for both the control and MV treatment conditions. With one exception, the SOD activity was higher in transgenic plants than WT under normal conditions, but the difference was not significant after MV treatment (Fig. 4A). However, the glutathione reductase (GR) and dehydroascorbate reductase (DHAR) activities of transgenic plants were significantly greater than in WT under MV-induced stress, although the GR activity of the

transgenic plants was lower than in WT under normal conditions (Fig. 4E and F). As expansins are located in the cell wall (Bae and Choi, 2008; Sampedro and Cosgrove, 2005), we examined the activities of cell wall-bound peroxidase. The ionically bound peroxidase activity in the transgenic plants was lower than in WT under both normal and MV treatment conditions, but almost no change was observed in response to MV treatment (Fig. 5A). However, the activities of

66

Y. Han et al. / Journal of Plant Physiology 173 (2015) 62–71

Fig. 3. Expression of antioxidant related genes in WT and transgenic tobacco plants under MV treatment by qPCR. Transcript levels of these genes in transgenic plants are indicated relative to the level of WT plants taken as 1, referring to the transcript of actin in the same samples. Each column represents the mean ± standard error of five replicates.

covalently bound peroxidase in three transgenic tobacco plants were significantly higher than in WT after MV treatment, although these plants had lower activities under normal conditions (Fig. 5B). Thus, our results suggest that the enhanced tolerance of transgenic plants to oxidative stress may be due to the increased activity of cell wall covalently bound peroxidase.

antibody (Fig. 7A), but the covalently bound cell wall peroxidase in plants incubated with the antibody showed a significant decrease in activity compared to those without antibody (Fig. 7B).

Enhanced tolerance to oxidative stress and increased peroxidase activity is inhibited by an anti-expansin antibody

The Arabidopsis mutant atexpb2 was used to test the hypothesis that cell wall-bound peroxidases are involved in the enhanced oxidative stress tolerance that results from over-expression of TaEXPB23. Sequence comparisons of TaEXPB23 with all of the ␣and ␤-expansins in Arabidopsis showed that TaEXPB23 shares 42% amino acid identity with AtEXPB2 (accession number At1G65680) (Fig. S1), and we used the atexpb2 mutant in our experiments. The phenotype of atexpb2 showed no differences as compared to Col0 (WT) under normal conditions (Fig. 8A). However, the activities of both the ionically bound and covalently bound peroxidases all significantly decreased in the atexpb2 mutant under MV stress compared to WT (Fig. 8B). This result also suggests the involvement of AtEXPB2 in the activity of the cell wall bound peroxidase. Supplementary Fig. S1 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jplph.2014.09.007. We then observed the phenotype of atexpb2 mutant, and no obvious difference was observed between atexpb2 and WT under normal conditions. While under 10 ␮M MV treatment, the growth of atexpb2 mutant was significantly inhibited, and the atexpb2 mutant showed a severe bleaching or chlorosis phenotype than WT

To further verify that the observed oxidative stress tolerance and increased peroxidase activity in transgenic plants were caused by expression of the wheat expansin protein, we used an antiexpansin antibody to inhibit expansin activity. The antibody was produced in our lab as previously described (Gao et al., 2008). There are no known specific inhibitors of expansins, but their location on cell walls makes them accessible to antibodies, which can be used to inhibit expansin activity. Previous reports also suggested that using an antibody to inhibit expansin activity is useful and efficient (Gao et al., 2008; Inouhe and Nevins, 1991). Following incubation with the anti-expansin antibody, the tolerance of tobacco plants to oxidative stress decreased, and severe symptoms of bleaching or chlorosis appeared on transgenic plants compared to WT after MV treatment (Fig. 6A). Accompanying this, the chlorophyll content decreased after incubation with the antibody (Fig. 6B). Also, the ionically bound peroxidase activity in the transgenic plants showed almost no change after incubation with the

Peroxidase activity was inhibited in the atexpb2 mutant

Y. Han et al. / Journal of Plant Physiology 173 (2015) 62–71

67

Fig. 4. The total activities of the antioxidant enzymes in tobacco plants under MV treatment. (A) superoxidase dismutase, SOD; (B) guaiacol peroxidase, POD; (C) catalase, CAT; (D) ascorbate peroxidase, APX. (E) glutathione reductase (GR); (F) dehydroascorbate reductase (DHAR). Each column represents the mean ± standard error of two independent experiment. * and ** indicate significant differences in comparison with the WT at P < 0.05 and P < 0.01 according to Duncan’s multiple range test.

Fig. 5. Cell wall bound peroxidase activities in tobacco plants under MV treatment. (A) ionically bound peroxidase activity; (B) covalently bound peroxidase activity. Each column represents the mean ± standard error of three independent experiment.** indicates significant differences in comparison with the WT at P < 0.01 according to Duncan’s multiple range test.

68

Y. Han et al. / Journal of Plant Physiology 173 (2015) 62–71

Fig. 6. Inhibition of improved phenotype under MV treatment by expansin antibody. (A) Leaf disks of 2-month-old plants were placed in K-citrate phosphate (10 mM, pH 6.5) with expansin antibody (100 ␮l/ml), maintained vacuum at −2.5 MPa for 20 min, and then incubation for 1 h. After that, the leaf disks were soak in 50 ␮M MV for 24 h, and got photographs. K-citrate phosphate buffer without expansin antibody or with nonimmune antiserum were used as controls. (B) Chlorophyll content of the leaf disks in (A). Each column represents the mean ± standard error of three replicates. * and ** indicate significant differences in comparison with the WT at P < 0.05 and P < 0.01 according to Duncan’s multiple range test.

Fig. 7. Cell wall bound peroxidase activities were inhibited by expansin antibody. (A) ionically bound peroxidase activity; (B) covalently bound peroxidase activity. Leaves of 2-month-old plants were separated into two parts from the leaf vein, then, placed in K-citrate phosphate (10 Mm, pH 6.5) with or without expansin antibody (100 ␮l/ml), separately, and maintained vacuum at −2.5 MPa for 20 min, then incubation for 1 h. Each column represents the mean ± standard error of two independent experiment. ** indicates significant differences in comparison with the WT at P < 0.01 according to Duncan’s multiple range test.

Y. Han et al. / Journal of Plant Physiology 173 (2015) 62–71

69

Fig. 8. The decreased peroxidase activity in atexpb2 mutant. (A) Phenotype of atexpb2 and Col-0 under normal condition. (B) Soluble and cell wall bound peroxidase activities were inhibited in atexpb2 mutant. Arabidopsis plants were grown in soil under a long-day condition (16 h light, 8 h dark) at 22 ◦ C, and 7-week-old plants were used in the study. Each column represents the mean ± standard error of two independent experiment. * and ** indicate significant differences in comparison with the Col-0 at P < 0.05 and P < 0.01 according to Duncan’s multiple range test.

(Fig. 9A). The measurement of chorophyll contents (Fig. 9B) further demonstrated the result in Fig. 9A. We also detected the germination rate of atexpb2 mutant and WT under normal and MV-induced stress conditions (Fig. S2). Seeds were germinated on normal condition or with different concentrations of MV. In normal conditions, the atexpb2 mutant and WT did not show any significant difference (Fig. S2A). However, the atexpb2 mutant showed a significantly lower germination rate under different levels of MV treatment (Fig. S2). For example, 5 days after sowing, 5 ␮M MV treatment severely inhibited the germination of atexpb2 mutant seeds with a germination rate of only 52.3%, whereas WT seeds displayed an 86.0% germination rate (Fig. S2D). These data suggest that expansin proteins, at least AtEXPB2, were involved in oxidative stress tolerance. Supplementary Fig. S2 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jplph.2014.09.007. Discussion In our previous studies, we observed that over-expressing TaEXPB23, a ␤-expansin gene from wheat, enhanced drought and salt stress tolerance in transgenic tobacco plants (Li et al., 2011a, 2011b; Han et al., 2012), but the mechanisms underlying these phenomena are unknown. There is ample evidence in the literature showing that anti-oxidative systems are involved in plant stress tolerance (Mittler, 2002; Aroca et al., 2003; Kumar Tewari et al., 2004). In this study, we investigated the oxidative stress tolerance of transgenic tobacco plants over-expressing TaEXPB23 using MV to induce oxidative stress conditions.

From the results shown in Fig. 2, the transgenic tobacco seedlings showed better growth, longer primary root, higher fresh weight and higher chlorophyll content than WT seedlings following exposure to MV, suggesting that over-expression of TaEXPB23 can enhance oxidative stress tolerance. MV-induced damage to leaf disks was also alleviated in transgenic tobacco plants than in WT (Fig. 2D). MDA is the product of lipid peroxidation and the level of MDA is commonly used as an indicator of lipid peroxidation (Sun et al., 2012). The MDA content was lower in transgenic plants than in WT (Fig. 2F). All of these results suggest that overexpression of the wheat expansin gene TaEXPB23 may improve the tolerance to oxidative stress in transgenic tobacco plants. As a secondary stress, oxidative stress is ubiquitous in almost all kinds of stresses (Dinakar et al., 2012). As shown in Fig. 3, the relative expression levels of NtCA, NtRbohD, NtAPX1, and NtAPX2 were higher in transgenic plants in response to MV treatment, while the expression levels of NtSOD, NtCAT1 and NtGPX were similar in WT and transgenic plants and showed no changes after MV treatment. These results indicate the complicated nature of the response of antioxidant-related gene expression to oxidative stress. The antioxidant enzymes included in our study are all encoded by large gene families, and we only examined mRNA accumulation in one member of each family (Fig. 3). We detected the responses of antioxidant defense systems, including both enzymatic and non-enzymatic antioxidant defense systems in the cytoplasm, and cell wall-bound peroxidases. In response to oxidative stress, the SOD activity showed no obvious difference between the WT and transgenic plants, and the POD, CAT, and APX activities were increased, though it was still lower than WT (Fig. 4). It is possible

70

Y. Han et al. / Journal of Plant Physiology 173 (2015) 62–71

Fig. 9. The atexpb2 mutant showed decreased tolerance to MV-induced stress. (A) 4-day-old seedlings grown under normal conditions were then irrigated with the indicated MV concentrations. The seedlings were allowed to grow for 4 days before the photographs were taken. (B) The chlorophyll content of (A). Each column represents the mean ± standard error of two independent experiment. ** indicates significant differences in comparison with the Col-0 at P < 0.01 according to Duncan’s multiple range test.

that these enzymes are not involved in the enhanced tolerance of the transgenic tobacco plants based on the results shown in Fig. 3. Plants possess both enzymatic and non-enzymatic antioxidant defense systems to protect their cell against ROS. The ascorbate-glutathione (ASC-GSH) cycle plays a key role in the non-enzymatic antioxidant defense system. In plant cells, ASC is a major antioxidant that can directly scavenge ROS and acts as an electron donor to APX for scavenging H2 O2 produced in the cycle (Asada, 2000; Hoque et al., 2007). GR and DHAR participate in this cycle (Hoque et al., 2007). As shown in Fig. 4E and F, the activities of DHAR and GR were significantly higher in transgenic tobacco plants than in the WT, suggesting the possible involvement of glutathione cycle in the enhanced tolerance of transgenic tobacco plants to MV-induced stress. By reason of the cell wall location of expansins, we then focused on the activities of the cell wall-bound antioxidant peroxidases, including the soluble, ionically bound, and covalently bound peroxidases. In general, class III peroxidases are secreted into the cell wall or the surrounding medium, where they are the key players during the entire plant life cycle, particularly in cell wall modifications (Passardi et al., 2004). The involvement of peroxidases in physiological and developmental processes has been detected in some plants (Csiszar et al., 2007; Maxwell and Johnson, 2000). One feature of these peroxidases is that they are associated with cell elongation and with reactions that restrict growth (Csiszár et al., 2011). Our results showed that the activity of the covalently bound cell wall peroxidase was significantly higher in the transgenic plants than in WT in response to MV treatment (Fig. 5B), suggesting its

involvement in the enhanced oxidative stress tolerance observed in the transgenic plants. To further investigate the role of TaEXPB23 in stress tolerance, an anti-expansin antibody was used to reduce the expansin activity in vivo, and the activities of the cell wall-bound antioxidant peroxidases were then examined. When leaf disks were incubated with the anti-expansin antibody, tolerance to oxidative stress decreased significantly (Fig. 6), as did the covalently bound cell wall peroxidase activity (Fig. 7). The results in Figs. 6 and 7 suggest that increased activity of the covalently bound cell wall peroxidases may be one of the key elements that results in the increased oxidative stress tolerance in transgenic tobacco plants over-expressing TaEXPB23. Besides, from the results in Fig. 7B, the activity of peroxidase covalently bound to cell wall in WT was inhibited by the antibody against TaEXPB23. However, the chlorophyll contents in WT were almost unchanged (Fig. 6B), indicating that the involvement of cell wall bound peroxidase in WT is limited in chlorosis. The mechanisms underlying this process need to be further studied. Furthermore, we also used the Arabidopsis mutant atexpb2 to test our hypothesis. The phylogenetic tree in Fig. S1 shows that TaEXPB23 shares 42% amino acid identity with AtEXPB2, AtEXPB4, and AtEXPB5. However, the functions of these three expansins have not been studied. A soybean expansin, GmEXPB2, which shares 58% amino acid identity with AtEXPB2, was shown to be intrinsically involved in root architecture responses to abiotic stresses (Guo et al., 2011). Thus, we chose the Arabidopsis expansin mutant atexpb2 for this study. The results in Fig. 8 showed that the

Y. Han et al. / Journal of Plant Physiology 173 (2015) 62–71

activities of all three types of cell wall peroxidases were significantly lower in the atexpb2 mutant than in the WT Col-0. The germination rate of atexpb2 plants to MV-induced stress was also significantly lower than that in Col-0 (Fig. S2), adding further support to our hypothesis. Considering that both expansins and peroxidases are cell wall modification related proteins (Nakano et al., 2013), we speculate that there may be some relationship between class III peroxidases and expansins during plant cell extension and the response to environmental stresses. This needs further study. Conclusion In conclusion, our results strongly suggest that over-expression of the wheat expansin gene TaEXPB23 confers enhanced tolerance to MV-induced oxidative stress in transgenic tobacco plants. This enhanced oxidative stress tolerance may be associated with increased activities of cell wall bound peroxidases. Elucidation of the underlying mechanisms may reveal a convergence between abiotic stress tolerance and expansin proteins in plants. Acknowledgments We thank Alonso et al. and the Arabidopsis Biological Resource Center for kindly providing the Arabidopsis mutant (Alonso et al., 2003). This research was supported by the National Natural Science Foundation of China (31370304). References Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, et al. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 2003;301:653. Apel K, Hirt H. Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu Rev Plant Biol 2004;55:373–99. Aroca R, Irigoyen JJ, Sánchez-Díaz M. Drought enhances maize chilling tolerance. II. Photosynthetic traits and protective mechanisms against oxidative stress. Physiol Plant 2003;117:540–9. Asada K. The water–water cycle as alternative photon and electron sinks. Phil Trans R Soc Lond B: Biol Sci 2000;355:1419–31. Bae G, Choi G. Decoding of light signals by plant phytochromes and their interacting proteins. Annu Rev Plant Biol 2008;59:281–311. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248–54. Cosgrove DJ. Enzymes and other agents that enhance cell wall extensibility. Ann Rev Plant Biol 1999;50:391–417. Cosgrove DJ. New genes and new biological roles for expansins. Curr Opin Plant Biol 2000;3:73–8. Cosgrove DJ. Growth of the plant cell wall. Nat Rev Mol Cell Biol 2005;6:850–61. Csiszár J, Gallé Á, Horváth E, Dancsó P, Gombos M, Váry Z, et al. Different peroxidase activities and expression of abiotic stress-related peroxidases in apical root segments of wheat genotypes with different drought stress tolerance under osmotic stress. Plant Physiol Biochem 2011;52:119–29. Csiszar J, Lantos E, Tari I, Madosa E, Wodala B, Vashegyi A, et al. Antioxidant enzyme activities in Allium species and their cultivars under water stress. Plant Soil Environ 2007;53:517–23. Dai F, Zhang C, Jiang X, Kang M, Yin X, Lü P, et al. RhNAC2 and RhEXPA4 are involved in the regulation of dehydration tolerance during the expansion of rose petals. Plant Physiol 2012;160:2064–82. Dinakar C, Djilianov D, Bartels D. Photosynthesis in desiccation tolerant plants: energy metabolism and antioxidative stress defense. Plant Sci 2012;182:29–41. Dodge AD. Herbicide action and effects on detoxification processes. Causes of photooxidative stress and amelioration of defense systems in plants. Boca Raton, FL: CRC Press; 1994. p. 219–36. Foyer CH, Noctor G. Oxidant and antioxidant signalling in plants: a re-evaluation of the concept of oxidative stress in a physiological context. Plant Cell Environ 2005;28:1056–71. Gao Q, Zhao M, Li F, Guo Q, Xing S, Wang W. Expansins and coleoptile elongation in wheat. Protoplasma 2008;233:73–81. Guo W, Zhao J, Li X, Qin L, Yan X, Liao H. A soybean beta-expansin gene GmEXPB2 intrinsically involved in root system architecture responses to abiotic stresses. Plant J 2011;66:541–52.

71

Han Y, Li A, Li F, Zhao M, Wang W. Characterization of a wheat (Triticum aestivum L.) expansin gene, TaEXPB23, involved in the abiotic stress response and phytohormone regulation. Plant Physiol Biochem 2012;54:49–58. Hendriks T, Berg BM, Schram AW. Cellular location of peroxidase isoenzymes in leaf tissue of Petunia and their affinity for Concanavalin A-Sepharose. Planta 1985;164:89–95. Hoque MA, Banu M, Okuma E, Amako K, Nakamura Y, Shimoishi Y, et al. Exogenous proline and glycinebetaine increase NaCl-induced ascorbate-glutathione cycle enzyme activities, and proline improves salt tolerance more than glycinebetaine in tobacco bright yellow-2 suspension-cultured cells. J Plant Physiol 2007;164:1457–68. Hui Z, Tian FX, Wang G, Wang GP, Wang W. The antioxidative defense system is involved in the delayed senescence in a wheat mutant tasg1. Plant Cell Rep 2012;31:1074–84. Inouhe M, Nevins DJ. Inhibition of auxin-induced cell elongation of maize coleoptiles by antibodies specific for cell wall glucanases. Plant Physiol 1991;96:426–31. Jones L, McQueen-Mason S. A role for expansins in dehydration and rehydration of the resurrection plant Craterostigma plantagineum. FEBS Lett 2004;559:61–5. Kong X, Pan J, Zhang M, Xing X, Zhou Y, Liu Y, et al. ZmMKK4, a novel group C mitogen-activated protein kinase kinase in maize (Zea mays), confers salt and cold tolerance in transgenic Arabidopsis. Plant Cell Environ 2011;34:1291–303. Kumar Tewari R, Kumar P, Tewari N, Srivastava S, Sharma PN. Macronutrient deficiencies and differential antioxidant responses—influence on the activity and expression of superoxide dismutase in maize. Plant Sci 2004;166:687–94. Lü P, Kang M, Jiang X, Dai F, Gao J, Zhang C. RhEXPA4, a rose expansin gene, modulates leaf growth and confers drought and salt tolerance to Arabidopsis. Planta 2013:1–13. Lee Y, Choi D, Kende H. Expansins: ever-expanding numbers and functions. Curr Opin Plant Biol 2001;4:527–32. Lee YP, Kim SH, Bang JW, Lee HS, Kwak SS, Kwon SY. Enhanced tolerance to oxidative stress in transgenic tobacco plants expressing three antioxidant enzymes in chloroplasts. Plant Cell Rep 2007;26:591–8. Li F, Xing S, Guo Q, Zhao M, Zhang J, Gao Q, et al. Drought tolerance through overexpression of the expansin gene TaEXPB23 in transgenic tobacco. J Plant Physiol 2011a;168:960–6. Li Q, Yu B, Gao Y, Dai AH, Bai JG. Cinnamic acid pretreatment mitigates chilling stress of cucumber leaves through altering antioxidant enzyme activity. J Plant Physiol 2011b;168:927–34. Maxwell K, Johnson GN. Chlorophyll fluorescence—a practical guide. J Exp Bot 2000;51:659–68. McQueen-Mason S, Cosgrove DJ. Disruption of hydrogen bonding between plant cell wall polymers by proteins that induce wall extension. Proc Natl Acad Sci U S A 1994;91:6574–8. Mittler R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 2002;7:405–10. Morel J, Fromentin J, Blein JP, Simon-Plas F, Elmayan T. Rac regulation of NtrbohD, the oxidase responsible for the oxidative burst in elicited tobacco cell. Plant J 2004;37:282–93. Nakano T, Fujisawa M, Shima Y, Ito Y. Expression profiling of tomato pre-abscission pedicels provides insights into abscission zone properties including competence to respond to abscission signals. BMC Plant Biol 2013;13:40. Pasqualini S, Paolocci F, Borgogni A, Morettini R, Ederli L. The overexpression of an alternative oxidase gene triggers ozone sensitivity in tobacco plants. Plant Cell Environ 2007;30:1545–56. Passardi F, Penel C, Dunand C. Performing the paradoxical: how plant peroxidases modify the cell wall. Trends Plant Sci 2004;9:534–40. Quan R, Shang M, Zhang H, Zhao Y, Zhang J. Improved chilling tolerance by transformation with betA gene for the enhancement of glycinebetaine synthesis in maize. Plant Sci 2004;166:141–9. Sampedro J, Cosgrove DJ. The expansin superfamily. Genome Biol 2005;6:242. Simon-Plas F, Elmayan T, Blein JP. The plasma membrane oxidase NtrbohD is responsible for AOS production in elicited tobacco cells. Plant J 2002;31:137–47. Slaymaker DH, Navarre DA, Clark D, Del Pozo O, Martin GB, Klessig DF. The tobacco salicylic acid-binding protein 3 (SABP3) is the chloroplast carbonic anhydrase, which exhibits antioxidant activity and plays a role in the hypersensitive defense response. Proc Natl Acad Sci U S A 2002;99:11640–5. Slooten L, Capiau K, Van Camp W, Van Montagu M, Sybesma C, Inzé D. Factors affecting the enhancement of oxidative stress tolerance in transgenic tobacco overexpressing manganese superoxide dismutase in the chloroplasts. Plant Physiol 1995;107:737–50. Sun L, Liu Y, Kong X, Zhang D, Pan J, Zhou Y, et al. ZmHSP16. 9, a cytosolic class I small heat shock protein in maize (Zea mays), confers heat tolerance in transgenic tobacco. Plant Cell Rep 2012:1–12. Welinder K. Plant peroxidases: structure–function relationships. Plant Peroxid 1980;1990:1–24. Wu Y, Thorne ET, Sharp RE, Cosgrove DJ. Modification of expansin transcript levels in the maize primary root at low water potentials. Plant Physiol 2001;126:1471–9. Xing SC, Li F, Guo QF, Liu DR, Zhao XX, Wang W. The involvement of an expansin gene TaEXPB23 from wheat in regulating plant cell growth. Biol Plant 2009;53:429–34.