Hum Genet (1991) 87 : 33-40

9 Springer-Verlag 1991

Osteogenesis imperfecta due to recurrent point mutations at CpG dinucleotides in the COL1A1 gene of type I collagen Charles J. Pruchno 1, Daniel H. Cohn 2' 3, Gillian A. Wallis 1, Marcia C. Willing 1, Barbra J. Starman 1, Xiaoming Zhang 2' 3, and Peter H. Byers 1 1Departments of Medicine, Pediatrics and Pathology and the Center for Inherited Disease, University of Washington, Seattle, WA 98195, USA 2Department of Pediatrics, University of California at Los Angeles, Los Angeles, CA, USA 3Division of Medical Genetics, Cedar-Sinai Medical Center, Los Angeles, CA 90048, USA Received July 19, 1990 / Revised October 19, 1990

Summary. Most individuals with osteogenesis imperfecta (OI) are heterozygous for dominant mutations in one of the genes that encode the chains of type I collagen. Each of the more than 30 mutations characterized to date has been unique to the affected member(s) of the family. We have determined that two individuals with a progressive deforming variety of OI, O I type III, have the same new dominant mutation [al (I)gly154 to arg] and that two unrelated infants with perinatal lethal OI, O I type II, share a second new dominant muation [al(I)glyl003 to ser]. These mutations occurred at C p G dinucleotides, in a manner consistent with deamination of a methylated cytosine residue, and raise the possibility that C p G dinucleotides are common sites of recurrent mutations in collagen genes. Further, these findings confirm that the OI type-III phenotype, previously thought to be inherited in an autosomal recessive manner, can result from new dominant mutations in the C O L I A 1 gene of type-I collagen.

Prockop et al. 1989). Each of the mutations characterized has been unique to the affected individual or affected family members. We found that two unrelated individuals with OI type III were heterozygous for a G - t o - A transition that resulted in substitution of arginine for glycine at position 154 in the triple helical domain of the p r o a l (I) chains encoded by the mutant allele. Two unrelated infants with the lethal OI type-II phenotype were heterozygous for a G - t o - A transition that results in substitution of serine for glycine at position 1003 in the triple helical domain of the p r o a l ( I ) chain. Mutations at both sites occurred at C p G dinucleotides, which suggests that recurrent mutations of the COL1A1 gene of type-I collagen may cluster at such sites. These findings also provide confirmation that OI type III can result from dominant mutations.

Materials and methods Clinical s u m m a r y

Introduction Osteogenesis imperfecta (OI) is a heterogeneous disorder characterized by osteopenia and bone fragility (Sillence et al. 1979) which usually results from mutations in the genes that encode the chains of type I collagen (reviewed in Byers 1989, 1990; Prockop et al. 1989). Characterization of mutations that produce O I has begun to elucidate the relationship between phenotype and genotype. It now appears that multi-exon rearrangements are lethal, while the effect of exon-skipping mutations or point mutations in coding regions depends on the chain in which the mutation occurred, the nature of the mutation, and its location in the chain (Byers 1989, 1990; Offprint requests to: P. H. Byers, Department of Pathology, SM30, University of Washington, Seattle, WA 98195, USA

Proband 1 (our identification number 87-053) is a 33-year-old man who was the second of four children born to his phenotypically normal nonconsanguineous parents. Shortly after birth he was found to have an acute fracture of the right clavicle and a healing fracture of the right femur. Within the first 2 years of life he experienced three additional fractures all of which healed well. During that time he was noted to have bowing and deformity of the long bones of both legs. By the age of 12 years he had had more than 20 fractures of the long bones, largely of the legs. By this age he had developed a pectus carinatum deformity and had about 35~ of scoliosis. The scoliosis was gradually progressive despite attempts to stabilize with a Milwaukee brace (see Fig. 1). By puberty he had had more than 60 fractures virtually all of which involved his legs. At the age of 35 he is 3'7" tall, he has soft discolored teeth (dentinogenesis imperfecta), slightly blue sclerae, and has normal hearing. He is able to walk with braces or crutches but spends a good part of the day in a hand-driven wheelchair. Proband 2 (our identification number 85-042) is a 26-year-old man who was the third of three children born to normal nonconsanguineous parents. There was no family history of OI and neither

34

Fig. 1. A Chest radiograph of proband 1. There is marked kyphoscoliosis, diminished bone density, evidence of protrusio acetabulae, and intramedullary rods in the femurs. B Radiographs of femur (left) and tibia and fbula (right) of proband 1. The bones are thin and markedly undermineralized

sib was affected. The proband had multiple fractures during childhood, which were generally treated at home with splinting. He has had only a few fractures since puberty but may have had as many as 60 prior to that time, largely of the legs. He is currently 3'2" tall and walks independently or with the use of crutches. He was light grey sclerae, soft discolored teeth (dentinogenesis imperfecta), a barrel chest (pectus carinatum), short extremities with bowing of the forearms and tibias, and short and bowed humeral bones and femurs. Proband 3 [our identification number 86-069, previously included as patient 47 by Byers et al. (1988)] was the first child born to a 32-year-old woman and her 42-year-old husband. One previous pregnancy had resulted in a spontaneous abortion. The infant was born at 33 weeks gestation following spontaneous rupture of membranes. She was 2 lbs 3 oz at birth and 32 cm in length. She died within minutes of delivery and was noted to have gastroschisis in addition to characteristic findings of lethal OI. Radiographic features were those of OI type II. Proband 4 (our identification number 80-040) died in the perinatal period. No additional clinical or radiographic information was available. Cells were provided to Dr. David Rowe, University of Connecticut who forwarded them to us.

Cell culture and analysis of collagenous proteins Dermal fibroblasts were obtained from explants of skin biopsies from all affected individuals and from an unaffected sibling of proband 1. Age-matched control cell strains were also used and all biopsies were obtained with appropriate consent. Biochemical studies were performed on cells between the fourth and twelfth

passages. The cultures were maintained as previously described (Bonadio and Byers 1985; Bonadio et al. 1985). Labeling of collagenous proteins with 2, 3, 4, 5@H]proline, analysis of proc~ chains and ct chains by sodium dodecyl sulfate-polyaerylamide gel electrophoresis (SDS-PAGE), two-dimensional SDS-PAGE cyanogen bromide peptide mapping, and preparation of cyanogen bromide peptides of collagens and their analysis by isoelectric focusing and SDS-PAGE were performed as previously described (Bonadio and Byers 1985).

Preparation of cDNA and D N A sequence determination The sequence of oligonucleotides used as primers for the reverse transcription and polymerase chain reactions (PCR) are presented in Table 1. R N A was isolated from cultured dermal fibroblasts (Chomczynski and Sacchi 1987). Ten micrograms of R N A was precipitated with 1 ~tg of primer B or D, and e D N A was prepared as previously described (Willing et al. 1990). PCR (Saiki et al. 1988) was used to amplify the domain of e D N A that encodes triple helical residues 123-401 of ul(I) [cd (I)CBS] using primers A and B or e D N A that encodes residues 823-1014 of cd(I) [al(I)CB6] using primers C and D. Primers A and C incorporated an EcoRI site, and B and D contained a SalI restriction site for directional cloning. PCR was carried out using Tag D N A polymerase (Perkin Elmer Cetus, Norwalk, Conn.) according to manufacturer's suggested conditions with the following alterations: 1.6 units of Taq D N A polymerase were used, M g + + concentration was 4raM, DTT concentration was 10raM, and 150 pmoles of each primer was used. Conditions were: denature at 94°C for 1.5min, anneal at

35

Results

55~ for 2 min, and extend at 72~ for 3 min, for 30 cycles. The amplified product was separated by electrophoresis in 0.6% agarose, extracted from agarose using Gene-clean (Bio 101, La Jolla, Calif.) according to the manufacturer's protocol, and then resuspended in water. The fragment was digested sequentially with E c o R I and SaII (New England Biolabs), according to manufacturer's instructions, and 30 ng was ligated to 100 ng of similarly prepared M13mp18 or M13mp19. Single-stranded D N A was prepared from clones containing inserts of appropriate size, and the D N A sequence was determined by the dideoxy chain-termination method (Sanger et al. 1977), using T7 D N A polymerase (Sequenase, United States Biochemical). D N A was isolated from cultured dermal fibroblasts as described previously (Maniatis et al. 1982). Amplification of genomic D N A was performed by PCR with primers G and H to amplify the sequence surrounding the mutation site in the domain of a l ( I ) C B 8 , with primers E and F to amplify D N A at the intragenic polymorphic RsaI site in intron 5 of the COL1A1 gene (Sykes et al. 1986; D'Allessio et al. 1988), and with primers I and D to amplify the sequence surrounding the mutation site in the cd(I)CB6 domain (Fig. 2). For amplification of genomic D N A at the mutation site in cd(I)CB8 and the RsaI polymorphic site in C O L I A 1 , primers were annealed at 48 ~ C for 2 min, but the extension and denaturation temperatures and times were as described above. The amplified product that contained the mutation site for probands 1 and 2 was digested with ApaI; the amplified product that contained the polymorphic RsaI site was digested with RsaI according to manufacturer's conditions. The products were analyzed by 6% P A G E electrophoresis.

Abnormal collagens Except for subtle differences in efficiency of secretion of proal(I) chains of type-I procollagen we could not distinguish molecules synthesized by cells of each proband with OI type III from those synthesized by cells from controls (Fig. 3A, B). Because of the slight alteration in secretion, we examined cyanogen bromide peptides of collagens synthesized by the cells from the probands to determine if there were any change in size or charge of peptides. Two-dimensional separation of cyanogen bromide peptides of collagens synthesized by cells from both probands demonstrated a normally migrating species of ~I(I)CB8, and a more basic species (the data from proband 1 are shown in Fig. 3C). In contrast to cells from the probands with OI type III, cells from two unrelated infants with OI type II synthesized some normal type-I procollagen molecules and some type-I procollagen molecules that were poorly secreted. The poorly secreted molecules were overmodifled along the entire length of the chain (data not shown), which suggested that mutations were in the carboxyl-terminal domains of the triple helix (see Byers et al. 1988). Point mutations at CpG dinucleotides

Table 1. Oligonucleotide primers used for reverse transcription and the polymerase chain reaction

Six clones of amplified cDNA that encoded the al(I)CB8 domain of proal(I) (Figs. 2,3C) from proband 1 and 18 clones from proband 2 were isolated and partial sequence was determined. Three of six from proband 1 and 12 of 18 from proband 2 had a G-to-A transition in the first nucleotide of the codon for amino acid residue 154 (glycine) of the triple helical domain, which resulted in substitution of a glycine codon by an arginine codon (Fig. 4). To confirm that the mutation did not occur in the preparation of the cDNA of in the amplification proccess, and to exclude the possibility that contamination with a cloned cDNA fragment led to the finding of the identical mutation in two unrelated individuals, genomic DNA was isolated from the cells of both,

Prim- Sequence er

A B C D E F G H I

5 ' G G G G T C G A C G G A A A C C T G G A G C A C C A G C A A T 3' 5 ' G A G C G A A T T C G C C C T G G T G A A A A T G G A G C T 3' 5' G G G A A T T C A G C A A G T G G T G A A C G T G G T C C 3' 5' G G C G T C G A C A C G C C G G T A G T A G C G G C C A C 3' 5 ' C A A G A G C A T T C T C T T A A C T G A C C T 3' 5 ' T C C T G G A C T G G A T C C C A G A T T G G G 3' 5' C C A G T G C T C A G T G G A C T T A 3' 5 ' A A G T C A C A C C T G G G A C A G A 3' 5 ' C C A A A G C A C T T G G A T G C C G G T A A T C 3'

A COL1A1 cDNA (triple helix) I [ 4~1 12 4 5

8

I~ B

3

C~

I

~D

I

100 bp

C COL1A1 exons 42-49

B COL1A1 exons 5-17 Rsal*l //_.~ E ~ ' ~ F 6

7 8 9

r~ ~

G_.~H 10 11 12131415 16

~-~--k-~.

34

17

f--~:---L-~q/ 200 hp

Fig. 2A, B. Location of primers used for analysis of mutations and polymorphic sites in the COL1A1 gene. A Map of c D N A that encodes the triple helical domain of the proal(I) chain of type-I procollagen. The locations of methionyl codons are indicated by the vertical lines and the peptides produced by cleavage of the protein chain with cyanogen bromide are indicated by the numbers below

I.~2D 454,

,7

200 bp

the line. The positions of the amplification primers are marked by the arrows and the letter designations are of primers indicated in Table 1. B Partial structure of the C O L I A 1 gene with location of amplification primers at the RsaI polymorphic site and at the sites of both mutations

36 erozygosity at the ApaI site and confirming the presence of the mutation (Fig. 5). Identically amplified D N A from two controls was cleaved to completion by ApaI (data from one control shown in Fig. 5). To exclude the possibility that cell strain contamination, or nucleic acid preparation contamination, led to the finding of the same mutation in the two probands, we examined the status of both individuals at a polymorphic RsaI site in intron 5 of C O L I A 1 . Amplified D N A from proband 1 was completely cleaved by RsaI, indicating homozygosity for the presence of the polymorphic site. Amplified D N A from proband 2 was completely resistant to RsaI digestion, demonstrating homozygosity for the absence of the site, and nonidentity with proband 1 (Fig. 5). One control D N A was partially cleaved with RsaI, indicating heterozygosity for this site (data not shown) while the other cleaved completely (Fig. 5, lane 9, 10). Ten c D N A clones derived by selective amplification of the domain that encodes a l ( I ) C B 6 (see Fig. 2, 3C) from proband 3 and 8 clones derived similarly from proband 4 were isolated and their partial sequences were determined. Five of 10 clones from proband 3 and 2 of 8 from proband 4 had a G-to-A transition in the first nucleotide of codon for the glycine at position 1003 of the triple helix. The mutation resulted in the substitution of serine for glycine (Fig. 4B, C). The analyses were done in different laboratories (Seattle and Los Angeles), which precludes contamination. The two cell strains were distinguished by a COL2A1 polymorphism (data not shown), which confirmed that the mutations occurred independently.

Discussion od(I)

c

1245 II II

l?

8 4

I

3

I

3

7

I

6

,

Fig. 3A-C. Proa chains, ct chains, and cyanogen bromide peptide maps of collagen synthesized by cells from proband I (01), his sibling (S), and a control (C). A Proct chains separated under reducing conditions. The broad band near the top of the gel is fibronectin; the bands between the proct chains of type-I procollagen and below proct2(I) are intermediates in the proteolytic conversion of procollagen to collagen. B Pepsin-treated procollagens (a chains) separated under nonreducing conditions. The electrophoretic mobilities of the chains of type-I procollagen are normal. The electrophoretic mobilities of the ctl(I) and ct2(I) chains of the proband are normal. There is a subtle difference in the proportion of type-I collagen secreted by cells from the proband. C Cyanogen bromide peptides separated by nonequilibrium isoelectric focusing in the first dimension and by SDS-PAGE in the second dimension. There is a more basic than normal representative of the ctl(I)CB8 peptide (arrow) in the samples synthesized by proband 1. The size and location of the cyanogen bromide peptides in the al(I) and a2(I) chains are represented at the bottom of the figure

and a fragment that contained the exon with the mutation site was amplified with intron-specific primers. About half the amplified D N A from the mutation site in both probands was cleaved by ApaI, which recognizes the wild-type sequence 5 ' G G G C C C 3', indicating het-

More than 30 point mutations in COL1A1 that lead to OI have been characterized (summarized in Byers 1990; Prockop et al. 1989). Our report, which characterizes two pairs of mutations that occur at CpG dinucleotides, provides the first examples of which we are aware in which unrelated individuals with similar OI phenotypes have the same mutation. It has been proposed that CpG "hot spots" could explain recurrent mutations in several genes, including factor VIII (Youssoufian et al. 1986), factor IX (Davis et al. 1987), phenylalanine hydroxylase (Abadie et al. 1989) and [3-globin (Wong et al. 1986). In a survey of point mutations identified in a variety of human genetic diseases, 35% occurred at CpG dinucleotides (Cooper and Youssouffian 1988). In this model, methylation-induced deamination of 5-methyl cytosine (Coulondre et al. 1978) results in C-to-T transitions that are stabilized at replication. The repair enzyme N-uracil-DNA glycosylase is unable to excise the 5-methylcytosine deamination product, thymine, in the heteroduplex (Wong et al. 1986; Lindahl 1979). In a C and G rich gene such as C O L I A 1 , C-to-T transitions at CpG sites might be expected to be common. Deamination of the methylcytosine on the antisense D N A strand in the complement of the C G G N N N N N N N sequence, in which G G N encodes glycine of the repeating Gly-X-Y triplet of the collagen triple helix, would be

37

Exon 15

5' 5'

Exon

5 w

141 154 156 GlyAlaArgGlyAsnAspGlyAlaThrGlyAlaAlaG_~yProPro GGTGCTCGTGGAAATGATGGTGCTACTGGTGCTGCCGGGCCCCCT

!

GGTC-CTCGTGGAAATGATGGTGCTACTGGTGCTGCCAGGCCCCCT GlyAlaArgGlyAsnAspGlyAlaThrGlyAlaAlaArgProPro

49

(partial

3' 3'

sequence}

1000 1003 1014 GlyProProGlyProProGlyProProGlyProProGlyProProSerAlaGlyPheAspPhe GGTCCCCCCGGCCCTCCTGGACCTCCTGGTCCCCCTGTCCTCCCAGCGCTGGI-I-rCGACI~C

....

3 w

! 5'

C

GGTCCCCCC_AGCCCTCCTGGACCTCCTGGTCCCCCTGGTCCTCCCAGCGCTGGTTTCGACTTC.. GlyProProSerProProGlyProProGlyProProGlyProProSerAlaGlyPheAspPhe

expected to produce OI, whereas deamination of the methylcytosine on the sense strand would lead to mutations of the third nucleotide encoding the Y position aminoacid residue (and thus usually have no phenotypic consequence). In the COL1A1 gene, which encodes the proul(I) chain of type I procollagen), only 31 of the 338 glycine codons in the triple helix are preceded by C (data analyzed from D'Allessio et al. 1988; Bernard et al. 1983). This analysis excludes 5 apparent CpG dinucleotides in the cDNA sequece in which an exon ends in C, creating a CpG not reflecting the genomic sequence, and therefore not susceptible to the proposed mutation mechanism. Most CpG mutations leading to OI would appear as GGN-to-AGN transitions (C-to-T on the noncoding strand) and to substitutions of serine or arginine for glycine. Of the 34 point mutations in COLIA1 that result in substitution for glycine in the triple helical domain, 5 occur at CpG sites and are compatible with the proposed mechanism (Bateman et al. 1988, and the mutations cited in this paper). Although this represents a 1.6-fold increase above a random frequency of this mutation, there

~

3'

Fig. 4A-C. Nucleotide sequence of normal and mutant cDNA clones prepared from cells of proband 1 (A) and proband 4 (B) and the sequences of the exons in which the mutations occurred (C). The a r r o w s mark the sites of G-to-A transitions

is a bias in the ascertainment of collagen mutations because some were identified as protein variants using methods that readily identified charge changes, eg., glycine to arginine. Mutations at 116 (79%) of the 147 CpG dinucleotides in the region of the COLIA1 gene that encodes the triple helical domain of the proal(I) chain would result either in substitutions for residues other than glycine, most of which are likely to be phenotypically silent, or in silent changes in third position nucleotides. We are aware of one such mutation (CGC to CAC), which results in substitution of arginine by histidine at X-position amino acid 386 of the triple helical portion of the ~1 (I) chain (C. J. Pruchno and P. H. Byers, unpublished observation) and another in the COL1A2 gene (Phillips et al. 1990). Both appear to represent uncommon variants of uncertain phenotypic effect. The paucity of CpG dinucleotides that could result in substitutions for glycine residues in the triple helical domain of the proal (I) chain of type I procollagen is striking and represents nonrandom use of C in the third posi-

38

Fig. 5. Restriction endonuclease digestion of amplified DNA containing the mutation site or the intragenic RsaI site of probands 1 and 2 and control. Lanes 1, 5, and 9: undigested amplification product containing the RsaI site; lanes 2, 6, and 10: RsaI-digested amplification products; lanes 3, 7, and 11: undigested amplification product containing the mutation site; lanes 4,8, and 12: ApaI-digested amplification products from above. Amplification products from probands 1 and 2 partially cleave at the ApaI site, confirming the presence of a mutation that disrupts this site

Table 2. Influence of amino acid coding position and nearest following neighbor on frequency of of third position nucleotide

A C G T

X-position amino acid Not followed by G Followed by G Non-Prob Prob Non-Pro Pro

Y-position amino acida

0.15 0.37 0.23 0.26

0.20 0.07 0.14 0.56

0.01 0.78 0 0.21

0.30 0.06 0.13 0.51

0.03 0.30 0 0.68

Non-Pro Pro 0.04 0.13 0 0.83

a Third position nucleotides encoding Y-position amino acids are always followed by G b Non-Pro, codon for amino acid other than proline; Pro, codon for proline

tion of codons for Y-position amino acids (perhaps as a result of accumulation of previous C to T transitions in C p G dinucleotides in the sense strand of the gene). For example, the third nucleotide of proline codons (which occupy about 30% of both X and Y positions and are equally distributed between each) differs markedly in the X and Y position. For proline codons in the X-position the third position nucleotide is A (0.01), C (0.78), G (0) or T (0.21) if followed by A, C, or T but A (0.03), C (0.30), G (0) or T (0.68) if followed by G. These ratios are similar to estimates for the human genome in general (Josse et al. 1961; Lathe 1985). However, among 3rd-position nucleotides encoding Y position proline the distribution is A(0.04), C(0.13), G ( 0 ) or T(0.83) (see Table 2). Mutations that involve CpG dinucleotides in the first group would not result in replacement of glycine residues whereas some of those in the second could. Thus it is likely that the COL1A1 gene is protected from the CpG mechanism of mutation in that only 11% of triple helical glycine residues are targets and less than a quarter of all C p G dinucleotides could give rise to substitutions for glycine residues. Given the still small number of point mutations that have been characterized in human collagen genes and the bias in selection for analysis of many of them we cannot

be certain of the common mutation mechanisms. While CpG sites may not ultimately be overrepresented in the total pool of mutations, they may be sites where recurrent mutation is more common than in the remainder of collagen genes. A second issue that deserves comment is the clinical classification of the two individuals with the progressive deforming variety of OI as OI type III, and the mode of inheritance of that phenotype. OI type III has been defined clinically by severe and progressive deformities, marked short stature and radiographic findings of "popcorn calcification," femoral bowing, and generalized osteopenia (Sillence et al. 1979, 1986). Despite this clinical definition, Sillence et al. (1986) suggested that the OI type III designation be reserved for the recessively inherited from. Because the clinical phenotype most often occurs sporadically, pedigree analysis may be of little help in determining the mode of inheritance. Support for the hypothesis of autosomal recessive inheritance of OI type III has rested on family studies (Sillence et al. 1979, 1986, Viljoen and Beighton, 1987), linkage studies that exclude collagen genes in a small number of families (Aitchison et al. 1988) and the characterization of a COL1A2 mutation in a single consanguineous family (Deak et al. 1983; Pihlajaniemi et al. 1984; Nicholls et al. 1984). Biochemical studies are generally compatible with the presence of a dominant mutation or are inconclusive (Wenstrup et al. 1990). Furthermore, heterozygosity for point mutations that produced substitution of cysteine for glycine at residue 526 of the triple helix in ctl(I) (Starman et al. 1989) and of serine for glycine at position 844 in cd (I) (Pack et al. 1989) have been identified in two individuals with this phenotype and indicate that it can result from dominant mutations. Our findings contribute to a growing body of evidence that the clinically defined severe deforming variety of OI, OI type III can result from dominant mutations in collagen genes. The mutation identified in the two individuals with OI type III described here extends a pattern in the genotypephenotype relationship that is developing as point mutations producing OI are identified. Starman et al. (1989) proposed that with cysteine for glycine substitutions in the ~zl (I) chain, those near the amino terminus of the triple helix produced mild OI phenotypes, a mutation near the middle of the chain produced OI type III, and those in the carboxyl-terminal portion ot the triple helix were lethal. It appears that substitutions of arginine for glycine may have a similar pattern although the transition from lethal to nonlethal phenotype is at a more amino-terminal position. Previous studies have shown that substitution of arginine for glycine at positions 847, 667, 550, and 391 were all lethal (Bateman et al. 1987, 1988; Wallis et al. 1990a, b) the transition to the nonlethal phenotypes is presumably between 154 and 391. For cysteine to glycine substitutions is this transition carboxyl-terminal to residue 526 of the triple helix. We and others (Starman et al. 1989, Bonadio and Byers 1985, Bateman et al. 1987) have used the extent of overmodification (increased lysyl hydroxylation and hydroxylysyl glycosylation) along the a chains of type I collagen to localize mutations. Furthermore, the presence

39 o f n o r m a l a n d o v e r - m o d i f i e d m o l e c u l e s is g e n e r a l l y indicative o f h e t e r o z y g o s i t y for a c o l l a g e n g e n e m u t a t i o n . A m i n o - t e r m i n a l to p o s i t i o n 154 t h e r e a r e o n l y t h r e e p o t e n t i a l l y h y d r o x y l a t a b l e lysyl r e s i d u e s , o n e o f w h i c h usually is h y d r o x y l a t e d ( P u i s t o l a et al. 1980). A s a r e s u l t , t h e effect o f i n c r e a s e d m o d i f i c a t i o n (lysyl h y d r o x y l a t i o n a n d g l y c o s y l a t i o n ) o n e l e c t r o p h o r e t i c m o b i l i t y is s u b t l e a n d c o u l d easily b e o v e r l o o k e d . I n a b o u t 2 0 % o f cell strains f r o m i n d i v i d u a l s with O I t y p e I I I , W e n s t r u p et al. (1990) w e r e u n a b l e to i d e n t i f y a l t e r a t i o n s in e l e c t r o p h o retic m o b i l i t y o f t h e chains o f t y p e I p r o c o l l a g e n s y n t h e sized. O u r findings i n d i c a t e t h a t h e t e r o z y g o s i t y f o r p o i n t m u t a t i o n s n e a r t h e 5' e n d o f t h e t r i p l e helical d o m a i n s in C O L 1 A 1 o r C O L I A 2 can p r o d u c e O I a n d y e t b e difficult to d e t e c t at t h e p r o t e i n level. Acknowledgements. We thank probands 1 and 2 and the families of probands 3 and 4 for their interest and participation, Meg Hefner and Dr. Judith Miles for providing samples from proband i and his family, Dr.John Forrest and the Shriners Hospitals for Crippled Children for providing medical records and copies of x-rays; Dr. Kirk Aleck for providing samples from proband 3 and family members; and Dr. David Rowe for providing cells from proband 4. We thank Kathy Braun and Laura Susserman for expert cell culture assistance and Barbara Kovacich for manuscript preparation. We also wish to thank Dr. William G. Couser for his support and encouragement of this project. This work was supported in part by grants from the National Institutes of Health (DK 07467, A R 21557, AM 34198, AM 32051, A R 39837), a clinical research grant (6-298) from the March of Dimes Birth Defects Foundation, the Michael Geisman Memorial Fellowship Award to G . A . W . from the Osteogenesis Imperfecta Foundation, Inc., and Arthritis Investigator Awards (to D . H . C , and M.C.W.).

References Abadie V, Lyonnet S, Maurin N, Berthelon M, Caillaud C, Giraud F, Mattei JF, Rey F, Munnich A (1989) CpG dinucleotides are mutation hot spots in phenylketonuria. Genomics 5 : 936-939 Aitchison K, Ogilvie D, Honeyman M, Thompson E, Sykes B (1988) Homozygous osteogenesis imperfecta unlinked to collagen I genes. Hum Genet 78:233-236 Bateman JF, D. Chan D, Walker ID, Rogers JG, Cole WG (1987) Lethal perinatal osteogenesis imperfecta due to substitution of agrinine for glycine at residue 391 of the al(I) chains of type I collagen. J Biol Chem 262 : 7021-7027 Bateman JF, Lamande SR, Dahl HHM, Chan D, Cole WG (1988) Substitution of arginine for glycine 664 in the collagen ctl (I) chain in lethal perinatal OI. J Biol Chem 263:11627-11630 Bernard MP, Chu ML, Myers JC, Ramirez F, Eikenberry EF, Prockop DJ (1983) Nucleotide sequences of complementary deoxyribonucleic acids for the proal chain of human type I procollagen. Statistical evaluation of structures that are conserved during evolution. 22 : 5213-5223 Bonadio JF and Byers PH (1985) Subtle structural alterations in the chain of type I procollagen produce osteogenesis imperrecta type II. Nature 316:363-366 Bonadio JF, Holbrook KA, Gelinas RE, Jacob J, and Byers PH (1985). Altered triple helical structure of tpye I procollagen in lethal perinatal osteogenesis imperfecta. J Biol Chem 260: 1734-1742 Byers PH (1989) Disorders of collagen biosynthesis and structure. In: Scriver CS, Beaudet AL, Sly WS, Valle D (eds) Metabolic basis of inherited disease, 6th edn. McGraw-Hill, New York, pp 2805-2842

Byers PH (1990) Brittle bones-fragile molecules: disorders of collagen gene structure and expression. Trends Genet 6 : 293-300 Byers PH, Tsipouras P, Bonadio JF, Starman BJ, and Schwartz RC (1988) Perinatal lethal osteogenesis imperfecta (OI type II) : a biochemically heterogeneous disorder usually due to new mutations in the genes for type I collagen. Am J Hum Genet 42 : 237-248 Chomczynski P, Sacchi N (1987) Single-step method for RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162 : 156-159 Cooper DN, Youssoufian H (1988) The CpG dinucleotide and human genetic disease. Hum Genet 78 : 151-155 Coulondre C, Miller JH, Farabaugh PJ, Gilbert W (1978) Molecular basis of base substitution hotspots in Escherichia coli. Nature 274: 775-780 D'Allessio M, Bernard M, Pretorius PJ, Wet W de, Ramirez F (1988) Complete nucleotide sequence of the region encdmpassing the first twenty-five exon of the human proul(I) collagen gene (COL1A1). Gene 67 : 105-115 Davis LM, McGraw RA, Ware JL, Roberts HR, Stafford DW (1987) Factor IX Alabama: a point mutation in a clotting protein results in hemophilia B. Blood 69:140-143 Deak SB, Nicholls A, Pope FM, Prockop DJ (1983) The molecular defect in a non-lethal variant of osteogenesis imperfecta. Synthesis of proa2(1) chains wich are not incorporated into trimers of type I procollagen. J Biol Chem 258 : 15192-15197 Josse J, Kaiser AD, Kornberg A (1961) Enzymatic synthesis of deoxyribonucleic acid. VIII. Frequencies of nearest neighbor base sequences in deoxyribonucleic acid. J Biol Chem 236: 864-875 Lathe R, (1985) Synthetic oligonucleotide probes deduced from amino acid sequence data: theoretical and practical considerations. J Mol Biol 183 : 1-12 Lindahl T (1979) DNA glycosylases, endonucleases for apurinic/ apyrimidinic sites, and base excision-repair. Prog Nucleic Acid Res Mol Biol 22:135-192 Maniatis T, Fritsch EF, Sambrook J (1982) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp 213-216 Nicholls AC, Osse G, Schloon HG, Lenard HG, Deak S, Myers JC, Prockop DJ, Weigel WRF, Fryer P, Pope FM (1984) The clinical features of homozygous u2(I) collagen deficient osteogenesis imperfecta, J Med Genet 21 : 257-262 Pack M, Constantinou CD, Kalia K, Nielsen KB, Prockop DJ (1989) Substitution of serine for ul(I)-glycine 844 in a severe variant of osteogenesis imperfecta minimally destabilizes the triple helix of type I proco|lagen. The effects of glycine substitutions on thermal stability are either position or amino acid specific. J Biol Chem 264 : 19694-19699 Phillips CL, Shrago-Howe AW, Pinnell SR, Wenstrup RJ (1990) A substitution at a non-glycine position in the triple helical domain of proa2(I) collagen chains present in an individual with a variant of the Marfan syndrome. J Clin Invest 86 : 1723-1728 Pihlajaniemi T, Dickson LA, Pope FM, Korhonen VR, Nicholls AC, Prockop DJ, Myers JC (1984) Osteogenesis imperfecta: cloning of a prott2(I) collagen gene with a frameshift mutation. J Biol Chem 259 : 12941-12944 Prockop D J, Constantinou CD, Dombrowski KE, Hojima Y, Kadler KE, Kuivaniemi H, Tromp G, Vogel BE (1989) Type I procollagen: the gene-protein system that harbors most of the mutations causing osteogenesis imperfecta and probably more common heritable disorders of connective tissue. Am J Med Genet 34 : 60-67 Puistola U, Turpeenniemi-Hujanen TM, Myllyla R, Kivirikko KI (1980) Studies on the lysyl hydroxylase reaction. II. Inhibition kinetics and the reaction mechanism. Biochem Biophys Acta 611 : 51 Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich H A (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239 : 487-491

40 Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acid Sci USA 74 : 54635467 Sillence DO, Senn A, Danks DM (1979) Genetic heterogeneity in osteogenesis imperfecta. J Med Genet 16:101-116 Sillence DO, Barlow KK, Cole WG, Dietrich S, Garber AP, Rimoin DL (1986) Osteogenesis imperfecta type III: delineation of the phenotype with reference to genetic heterogeneity. AM J Med Genet 23 : 821-832 Starman BJ, Eyre D, Charbonneau H, Harrylock M, Weis MA, Weiss L, Graham JM, Byers PH (1989) Osteogenesis imperfecta: the position of substitution for glycine by eysteine in the triple helical domain of the proul(I) chains of type I collagen determines the clinical phenotype. J Clin Invest 84 : 1206-1214 Sykes B, Ogilvie D, Wordsworth P, Anderson J, Jones N (1986) Osteogenesis imperfecta is linked to both type I collagen structural genes. Lancet II : 69-72 Viljoen D, Beighton P (1987) Osteogenesis imperfecta type III: an ancient mutation in Africa? Am J Med Genet 27:907-912 Wallis GA, Starman BJ, Zinn AB, Byers PH (1990a) Variable expression of osteogenesis impeffecta in a nuclear family is explained by somatic mosaicism for a lethal point mutation in the ~l(I) gene (COL1A1) of type I collagen in a parent. Am J Hum Gent 46:1034-1040

Wallis GA, Starman BJ, Schwartz MF, Byers PH (1990b) Substitution of arginine for glycine at position 847 in the triple helical domain of the ctl (I) chain of type I collagen produces lethal osteogenesis imperfecta. Molecules that contain one or two abnormal chains differ in stability and secretion. J Biot Chem 265 : 18628-18633 Wenstrup RJ, Willing MC, Starman BJ, Byers PH (1990) Molecular basis of clinical heterogeneity in nonlethal variants of osteogenesis imperfecta: distinct biochemical phenotypes predict clinical severity. Am J Hum Genet 46 : 975-982 Willing MC, Cohn DH, Byers PH (1990) Frameshift mutation near the 3' end of the COLIA1 gene of type I collagen predicts an elongated proul(I) chain and results in osteogenesis imperrecta type I. J Clin Invest 85 : 282-290 Wong C, Antonarakis SE, Goff SC, Orkin SH, Boehm CD, Kazazian HK (1986) On the origin and spread of B thalassemia recurrent observation of four mutations in different ethnic groups. Proc Natl Acad Sci USA 83 : 6529-6532 Youssoufian H, Kazazian HH, Phillips DG, Aronis S, Tsiftis G, Brown VA, Antonarakis SE (1986) Recurrent mutations in haemophilia A give evidence for CpG mutation hotspots. Nature 324 : 380-382