J. Mol. Biol. (1991) 220, 959-973

Osmotic Induction of Gene osmC Expression in Escherichia coli K12 Claude Gutierrezt and Jean Christophe Devedjian Centre de Recherche de Biochimie et G&n&ique Cellulaire du CNRS 118 Route de Narbonne 31062, Toulouse Cedex, France (Received 23 January

1991; accepted 3 May 1991)

osmC, an osmotically inducible gene of Escherichia coli, was physically mapped on the bacterial chromosome, cloned on multicopy plasmids, and its product, OsmC, was identified as a 14 kDa protein in maxicells. The DNA sequence of the gene and its upstream region were determined. The sequence of an osmC-phoA gene fusion confirmed the osmC reading frame. A deletion of osmC from the E. coli chromosome was constructed by gene replacement, demonstrating that it is not an essential gene. The osmC, promoter region was subcloned and a lac operon fusion transcribed under osmC, control was constructed. The expression of this operon fusion demonstrated that osmC regulation occurs at the transcriptional level. S1 nuclease protection experiments and deletion analysis identified two overlapping promoters with transcription start sites separated by ten nucleotides. All the sequences necessary for osmotic regulation of both promoters are located within a 137 basepair DNA fragment extending from position - 95 to + 42 with respect to the putative osmC translation start. Two deletions were obtained that abolish the functioning of the upstream promoter. Yet, under our experimental conditions, the subsequent expression of the osmCla& fusion was equivalent to that obtained from the tandem promoters. Mutations leading to constitutive expression of osmC were selected. Two independent mutations were obtained, both affected osmZ, the gene encoding the histone-like protein Hl. Keywords: E. coli; osmotic regulation;

1. Introduction

bacterial promoters; gene fusion

glutamate (Sutherland et al., 1986; Dinnbier et al., 1988). In E. coli and Salmonella typhimurium, these responses to osmotic stress are achieved, at least in part, through the transcriptional induction of genes encoding permeases and enzymes involved in the uptake or the synthesis of the accumulated solutes (Cairney et al., 1985a,b; Dunlap t Csonka, 1985; Gowrishankar, 1985; May et al., 1986; Styrvold et al., 1986; Andersen et al., 1988; Eshoo, 1988; Giaever et al., 1988; Jovanovich et aE., 1988). The mechanism of osmotic induction of transcription has been studied mostly for three different systems: kdp, a high affinity K+ uptake system (Laimins et al., 1981), ompC/ompF, coding for major outer-membrane porins (Hall & Silhavy, 1981), and proU, encoding an uptake system for the compatible solute glycine betaine (Cairney et al., 1985a,b; Dunlap & Csonka, 1985; Gowrishankar, 1985; May et al., 1986). Transcription of kdp is induced upon a decrease in turgor. Indeed, kdp transcription is turned on transiently upon an osmotic upshock and turned off, whatever the osmotic pressure may be in the growth medium, when the cells have restored turgor by

The elongation of bacterial cells is triggered by a force, applied on the rigid cell wall, called the turgor pressure; this results from an osmotic pressure in the cytoplasm higher than that of the surrounding medium (for a review, see Csonka, 1989). Therefore, it is vital for cells to adapt to increases in the osmotic pressure of their growth medium to maintain the turgor pressure. In Escherichia coli, the primary response to a temporary loss of turgor following a hyperosmotic shock appears to be accumulation of K+ and certain anions, principally glutamate (Measures, 1975; Laimins et al., 1981; Richey et al., 1987; Dinnbier et al., 1988) in the cytoplasm, resulting in an increase in cytoplasmic osmotic strength that restores turgor. As a secondary response, cells may accumulate organic osmolytes such as trehalose, proline or glycine betaine, called compatible solutes (Strom et al., 1986; Csonka, 1989), that can substitute for K+ t Author to whom correspondence should be addressed.

959 0022-2836/91/160959-15

$03.00/O

0

1991 Academic

Press Limited

960

C. Gutierrez

and J. C. Devediian

increasing their internal solute concentration (Laimins et al., 1981; Epstein, 1986). In contrast, the two other systems do not respond to turgor. Their transcription rate varies with the osmotic pressure in the growth medium during steady-state growth, when turgor is maintained at a normal value. Transcription of ompC is induced in media of elevated osmotic pressure, while ompF is induced in low osmotic pressure media (Hall & Silhavy, 1981). This osmotic regulation is mediated through a two-component regulatory system that involves a transmembrane sensor, the product of en&?, and a transcriptional regulator, the product of ompR (for a review, see Forst & Inouye, 1988). ompR and envZ do not seem to affect the expression of other osmotically stimulated systems (Cairney et al., 198%; May et al., 1986; Gutierrrez et al., 1987). Osmotic stimulation of proU transcription is dependent upon accumulation of K+ in the cytoplasm (Sutherland et al., 1986). The proU promoter region has been characterized in E. coli (Gowriset al., 1989) and in hankar, 1989; May S. typhimurium (Overdier et al., 1989; Stirling et al., 1989). In an in vitro reconstituted system, K+ glutamate was identified as a signal stimulating proU expression (Ramirez et al., 1989; Jovanovich et al., 1989) and results obtained with purified components suggested a direct action of K+ glutamate on the transcription complex (Prince & Villarejo, 1990). Osmotic pressure-dependent variations in DNA supercoiling were also proposed to be involved in proU osmotic regulation (Higgins et al., 1988). Eight other osmotically inducible genes, encoding envelope proteins, were identified in E. coli by screening a library of phoA gene fusions (Gutierrez et al., 1987). Two of these genes, treA and osmB, have been shown to encode a periplasmic trehalase (Gutierrez et al., 1989) and a new outer-membrane lipoprotein (Jung et al., 1989), respectively, and to be transcriptionally inducible by an increase in osmotic pressure (Jung et al.: 1990; Repoila & Gutierrez, 1991). Here, we report an analysis of osmC, another member of the group of osmotically inducible genes. We mapped osmC physically on the bacterial chromosome, determined its DNA sequence and identified the OsmC protein. We constructed a lac operon fusion transcribed under control of the osmC promoter region and demonstrated that the regulation occurs at the transcriptional level. Two osmotically inducible promoters were identified by S1 protection mapping of the osmC mRNA 5’ end and deletion analysis. Mutations in the osmZ gene, which confer partially constitutive expression of the osmotically regulated protJ operon, also lead to partially constitutive expression of 0smC.

2. Materials (a) Bacterial

strains,

and Methods plasmids and phages

The bacterial strains, all derived from E. coli K12, and the plasmids used in this study are listed in Table 1.

Bacteriophages Plvir and INK561 (b221 c1: : TnlO Oam29 Pam80) were from the laboratory collection. The plasmid pCG310 (Fig. 4(a)) was constructed by cloning a 66 kbt BamHI chromosomal DNA fragment of strain CLGY (Gutierrez et al., 1987) into the vector pSB118 (VidalIngigliardi & Raibaud, 1985). A deletion of pCG310, between the P&I site in the multisite linker of pSB118 and a P&I site in the sequence of TnphoA generated plasmid pCG311 (see Fig. 4(a)). The plasmids described in Fig. 1 were constructed as follows: a HindIII-EcoRI DNA fragment from pBS20 (Fig. 3(a)), carrying osmC, was cloned into pBR322, resulting in pCG300. A deletion of pCG300, between the Hind111 site and a MZuI site of the insert, gave pCG304. A HindIII-KpnI fragment was purified from pCG300 and subcloned into the vector pTZ18R (Mead et al., 1986) and a HindIII-EcoRI fragment was then purified from this plasmid and cloned into pBR322, generating pCG301. pCG302 was derived from a deletion between the 2 SacI sites present on pCG301. Plasmid pCG4K was constructed by inserting the 1.3 kb kanamycin resistance cassette from pUC4K (Pharmacia) into the PstI site of pTZ19R. Plasmid pCG330 (Fig. 3(a)) resulted from the replacement of the 0.9 kb StuI-Sac1 osmC+ fragment of pBS20 by the HincII-Sac1 kanamycin resistance cassette of pCG4K. (b) Chemicals and media Media were made as described by Miller (1972). The low osmolarity medium referred to as K medium, was described by Kennedy (1982). The osmotic pressure in this medium is 70 m0sm. Ampicillin, kanamycin and tetracycline were used at concentrations of 100, 40 and 10 pg/ml, respectively. (c) Enzymic

assays

Alkaline phosphatase and j?-galactosidase activities were assayed by measuring the hydrolysis by SDS/chloroform-treated cells of p-nitrophenol phosphate or p-nitrophenol galactoside, respectively, as described (Gutierrez et al., 1987; Miller, 1972). The enzymic activities were expressed as described by Miller (1972) except that instead of reading the A,,, in the cell suspensions, the amount of total proteins was determined by the method of Lowry et al. (1951), using bovine serum albumin as a standard and the enzymic activities were expressed as units/mg of total protein. (d) Maxicell

experiments

Plasmids were transformed into strain CSR603. Plasmid-encoded proteins were labelled as described by Sancar et al. (1979) and fractionated by SDS/polyacrylamide gel electrophoresis, as described by Silhavy et aE. (1984). (e) Methods

used with nucleic

acids

Isolation of chromosomal and plasmid DNA, digestion with restriction enzymes, ligation with phage T4 DNA ligase, transformation, Southern transfer and hybridization were carried out as described by Maniatis et al. (1982) and Silhavy et al. (1984). A series of deletions in the DNA sequence upstream from the osmC, promoter was constructed on the plasmid pCG311, cleaved with Sac1 t Abbreviations reading frame.

used: kb, 10’ base-pairs: ORF, open

Osmotic Regulation

of

osmC Transcription

961

Table 1 Bacterial strains and plasmids Strain *r plasmid

Genotype’

A. E. coli strains MC4106 CLG3 CLG124 CSR603 v355 pop2249 CLG194 CLG320

(!LG321 CLG341 CLG323 CLG326 CLG327 CLG329 CLG360 CLG361 CLG362 CLG364 (!LG365 (‘LG’l66 GM2’29 (!LG331 (!LG333 CLG336 (‘LG337 CLG343 13. Plasmids PBS20 pSDllX pIY4K pCG4K “(:enetir

Reference or source

F-araDI39 A(argF-lac)U169 rpsLl50 relA1 jfbB5301 ptsF25 de&l MC4100 A(bnzQ-proC-phoA) oamC-8115 : : TnphoA” MC4100 A(bmQ-proC-p?wA) zef-236 : : TnlO recA1 uvrA6 phrl Alac3 trp49 relA rpsLl50 tsx93 spoT1 reeB1014 sbcB15 MC4100 &malQ-lacZ)hybllc pop2249 AphoA-Pvull MC4100 AphoA-Pvull ~[osmC,-nuzlP-~(malQ-lac.Z)hybll]d CLG320 osmC-8115 : : TnphoA MC4100 Ap?wA-PvuII &osmC, (Sspl/EcoRV)-malP-&m&Q-lacZ)hybll]’ MC4100 AphoA-PvuII q5 [A13 osmC,-m&P-&m&Q-lacZ)hybll] MC4100 AphoA-Pvull q5[AosmC,l&malP-&m&Q-lucZ)hybll] MC4100 Ap?wA-PvuIl 6[AosmC, lS-m&P-&m&Q-lacZ)hybll] MC4100 AphoA-PvulI d[AosmC, 19-malP-&malQ-1acZ)hybl l] MC4100 A(brnQ-proC-phoA) Ao.smC : :kan’ CLG320 AosmC : :kan CLG341 A osmC : :kan CLG326 AosmC : : kan CLG327 AosmC : : km (2J&329 AosmC’ : :kan MC4100 osmZ-205 : : TnlO CLG320 osmZ-205 : : TnlO CLG323 osmZ-205 : : TnlO CLG326 osmZ-205 : : TnlO CLG327 osmZ-205 : : TnlO (‘LG341 osmZ-205 : : TnlO

rbsR

This study This study This study This study This study This study This study This study This study This study This study This study This study E. Bremer This study This st,udy This study This study This study ,J. I’. Bouchk Vidal-lngigliardi

pBR322 carrying a 66 kb oamC+ E. coli chromosomal DNA fragment pUC18 derivative pUC4 derivative carrying a kanamycin resistance gene cartridge pTZl9R derivative carrying a kanamycin resistance gene cartridge nomenclature

is from Bachmann

Casadaban (1976) Gutierrez et al. (I 987) This study Sancar ef al. (1979) M. Villarejo 0. Raibaud This study

b Raibaud (1985)

Pharmacia This study

(1987) and Campbell et al. (1977).

“This insertion of the transposon TnphoA creates an in-frame gene fusion, encoding a hybrid protein between the amino-terminal

part of the OsmC protein and most of the alkaline phosphatase polypeptide at the carboxy-terminus. “This notation designates a gene fusion that encodes a hybrid protein between a part of the amylomaltase at the amino-terminus and most of the B-galactosidase at the carboxy-terminus. In the strains pop2249 and CLG194, this gene fusion is t,ransrribed under the control of a wild-type malP, promoter. dThis notation designates a transcriptional fusion in which the osmC, promoters, carried on the 2.4 kb DNA fragment described in Fig. 4(b), control the transcription of an operon composed of an intact malP gene and a &m&Q-1acZ)hybll hybrid gene. ‘In this transcriptional fusion, the osmC, promoters are carried on a 137 bp SapI-EcoRV DNA fragment (Fig. 2). ‘This notation designates the renlacement on the E. coli chromosome of a @92 kb DNA fragment carrying osm(’ by a I.3 kb DSA fragment, carrying a IYanamycin re’sistance gene.

BamHI (Fig. 4(a)), by using the Promega exonuclease III/S, nuclease system, according to the manufact,urer’s protocol. Deletion endpoints were determined by sequencing double-stranded DNA of the plasmids carrying t’hese deletions, after hybridization with the phage Ml3 reverse sequencing primer (New England Biolabs). DNA sequences were determined using Sequenase (USB Inc.) according to the manufacturer’s protocol.

and

(f) Preparation

of RNA

Cells were grown to exponential phase in K medium or K medium supplemented wibh @4 M-NaCl. Samples of the cultures were harvested by being poured into the same volume of -70°C ethanol to stop potential modifications of RXA immediately. RNA was then extracted by the hot phenol method (Aiba et al.. 1981) (g) Detrrmin~ation

of the

osmC mRNA

5’ ends

Plasmids containing the osmC 5’ end and upstream sequences cloned in the vector pTZ18R (Mead et al., 1986)

were linearized and transcribed with phage T7 RNA polymerase in the presence of [a-32P]dUTP (800 Ci/mmol, Amersham Co.), as described by Melton et al. (1984). After transcription, the mixtures were treated with RPu’ase-free DNase (Worthington) and precipitated with ethanol to remove unincorporated labelled nucleotide. S, nuclease protection experiments were performed as described by Faubladier et al. (1990). Protected RNA was then analysed on 6% (w/v) polyarrylamide/7 M-urea sequencing gels. (h)

Genetic

procedures

Standard procedures were used for growth of bacteria and bacteriophages (Miller, 1972). Generalized transduction with phage Plvir was as described by Silhavy ef al. (1984). Random TnlO insertions around the chromosome of strain CLG321 were obtained by infecting this strain by phage 2NK561 as described (Silhavy et al., 1984). Recombination of the osmC, promoter upstream from a &maZQ-Za&)hybl 1 gene fusion was as described by Jung et al. (1990) and in Fig. 4.

C. Gutierrez and J. C. Devedjian

962 (0)

r MS

H

pCG3OOa’d H

MS

osmC-phoA K

I

E

I

KSE

pCG 301 id\‘~b pCG302

c&~ H/M s

pCG 304 r”\tsI

K

I

E J

ti (b)

12345

Figure 1. OsmC protein identification in maxicells. (a) Plasmids carrying DNA fragments from the osmC region are represented. The pBR322 vector is shown as an open box. E. coli DNA is shown as a single line. The bent arrow indicates the position of the osmC-8115 : : TnphoA fusion, as determined from physical mapping by Southern transfer. The thick arrow shows the osmC position deduced from the maxicell experiment. (b) Maxicell analysis of pBR322 osmC+ derivatives. Plasmids were transformed into CSR603. Maxicells were labelled with [35S]methionine (Amersham, Co.), and proteins were fractionated on a 15 y. polyacrylamide gel and autoradiographed. Lane 1, pBR322 control; lane 2, pCG300; lane 3, pCG301; lane 4, pCG302; lane 5, pCG304. The position of molecular weight prestained markers (BRL) is shown on the right (M, x 10V3). The OsmC putative position is indicated by an arrow. E, EcoRI; H, HindIII; H/M, hybrid HindIII/MZuI site; K, KpnI; M, MluI; S, SacI.

3. Results (a) Physica

tion 312 kb on the restriction map of the E. coli replication termination region of Bouche (1982). This position corresponds to 1573 kb on the complete E. coli chromosomal restriction map from Kohara et al. (1987). The orientation of the TnphoA insertion indicated that osmC is transcribed in the clockwise orientation.

mapping of the osmC gene on the E. coli chromosome

The osmC gene was initially identified by screening a library of phoA gene fusions, constructed by random chromosomal insertion of the transposon TnphoA (Manoil & Beckwith, 1985), for those presenting an increased alkaline phosphatase activity when grown in media of elevated osmolarity (Gutierrez et al., 1987). The osmC-8115 : : TnphoA gene fusion, carried by strain CLG3, has been genetically mapped at 32.5 minutes on the E. coli chromosome. We first performed a physical mapping of this insertion by Southern transfer analysis. Chromosomal DNA of strain CL03 was digested with various restriction enzymes, transferred to a nylon membrane and hybridized with a TnphoA probe. The results of this experiment (data not shown) mapped osmC at posi-

(b) Cloning of osmC and identijication protein

of the OsmC

Plasmid pBS20 carries a 6.6 kb PstI fragment cloned in the PstI site of pBR325 (Fig. 3(a)). This fragment extends approximately from positions 308 to 315 on the Bouche restriction map (BouchB, 1982). Therefore, pBS20 carries the cloned osw& gene. As deduced from the physical mapping, the site of the osmC-8115 : : TnphoA insertion lies approximately @9 kb from a Hind111 site and 2.2 kb from an EcoRI site on the PstI insert of pBS20. Various DNA fragments covering this insertion site were subcloned into the vector pBR322 and the proteins encoded by these plasmids were analysed in maxicells (Fig. 1). A protein of apparent molecular mass 14 kDa was identified; it is encoded by all the plasmids carrying a 1 kb HindIII-Sac1 fragment containing the osmC-phoA fusion site, and not by pCG304, which carries only a small part of this fragment (Fig. 1). Therefore, the 14 kDa protein is likely to be OsmC. (c) Sequence of the osmC gene The nucleotide sequence of the HindIII-Sac1 fragment carrying osmC is shown in Figure 2. The longer open reading frame (ORF) present in this sequence would code for a protein of 138 amino acid residues, with a calculated molecular mass of 14.468 kDa, in good agreement with the molecular mass measured for the protein identified in maxicells and proposed to be OsmC. This ORF starts with an AUG codon, at nucleotide 485 (Fig. 2), preceded by a potential Shine and Dalgarno sequence, seven nucleotides upstream. It ends with a TAG codon, at nucleotide 898, very close to the position determined by physical mapping for the osmC-8115 : : TnphoA insertion site. (d) Cloning

of the osmC-8115 : : TnphoA fusion

To confirm the osmC ORF, we cloned the osmC-8115 : : TnphoA fusion, carried in strain CLG3, and sequenced the fusion junction. TnphoA is a T&-derived transposon that carries a unique BamHI site. We took advantage of this site to clone a BamHI DNA fragment from the chromosome of CLG3 carrying the kanamycin resistance gene of TnphoA and extending, upstream from the osmCphoA fusion, to the first BamHI site on the chromosomal DNA. The resulting plasmid, pCG310 (Fig. 4(a)), carries a 6.7 kb insert composed of 1.7 kb of chromosomal DNA and 5 kb of TnphoA DNA inserted into the vector pSBll8. The fusion

Osmotic Re&ztion sf osmC Transcrivtion

963

50 I

Hind111

stu1

~AGCTTGMCCCG*TTTGGT~*GCTCC*TG*GMTGTCA*CCAGTGA~MCACCATGCTGTGCCCGM~TGCTC 100 I I AATGGCATTAACCAGAGCGGGTTCTGCTGTTGAATTTTCTGCCTGAT~T~GT~CATAGTGATTCTCCGTGTCTGTG 200 I TATTTATGGTGTCTGCTACGGATCGCAGATTTATAAAGCACATTCAGCATGGC~TAT~GCCGCTTCGTTGTT~GAT 300 A13 I I 1 TAGTCCTGGTTGATGATTTTTATATTTTAACACCATGATA~CATAGGGA~GT~ATTGGTATGATCCGATT~TATTGA 400

SspI

I

I

TACAATATCTTTTGGGTTATATATTCCCGGT~TCTATTGCGCCGG

A19

A17

Al6

VI

ATTTTATTCGGAATATCCTGCTTATCCTCGTGCTGTTTCTCACGTAGTCTATM -----------

I

P2

*****

CCTTlTT@‘CCCACAGGAGAGC =-s--m Th%!

500

EcoRV

I

AACA ATG ACA ATC CAT AAG AAA GGT CAG GCA CAC TGG GAA GGC GAT ATC AAA CGC GGG AAG MET Tbr Ile His Lys Lys Gly Gln Ala His Trp Glu Gly Asp Ile Lys Arg Gly Lys 600 MluI , I GGA ACA GTA TCC ACC GAG AGT GGC GTG CTG AAC CAA CAG CCG TAT CGA TTT AAC ACG CGT Gly Tbr Val Ser Tbr Glu Ser Gly Val Leu Asn Gin Gln Pro Tyr Gly Phe Asn Thr Arg

I TTT Phe

GAA GGC GAA AAA GGA ACC AAC CCT GAA GAA CTG ATT GGC GCA GCG CAT GCC GCA TGT Glu Gly Glu Lys Gly Thr Asn Pro Glu Glu Leu Ile Gly Ala Ala His Ala Ala Cys 700

I TTC TCA ATG GCG CTT TCA TTA ATG CTG GGG GAA GCG GGA TTC ACG CCA ACA TCG ATT GAT Phe Ser Met Ala Leu Ser ieu Met Leu Gly Glu Ala Gly Phe Tbr Pro Tbr Ser Ile Asp

I ACC ACC GCC CAT GTG TCG CTG GAT AAA GTG GAT GCC GGT TTT GCG ATT ACG AAA ATC GCA Thr Thr Ala Asp Val Ser Leu Asp Lys Val Asp Ala Gly Phe Ala Ile Thr Lys Ile Ala 800

I CTG AAG ACT GAA GTT GCG GTG CCG GGT ATT GAT GCC TCT ACC TTT GAC GGC ATA ATC CAG Leu Lys Ser Glu Val Ala Val Pro Gly Ile Asp Ala Ser Tbr Phe Asp Gly Ile Ile Gln ~osmC:

: TnphoA

900

I

I I AAA GCA AAA GCA GGA TGC CCG GTC TCT CAG GTA CTG AAA GCG GAA ATT ACG CTG CAT TAG Lys Ala Lys Ala Gly Cys Pro Val Ser Gin Val Leu Lys Ala Glu Ile Tbr Leu Asp ---

Sac1 CGCCAGCACCGa Figure 2. Sequence of the osmC gene. The sequence of the antisense strand of the oamC region is shown with the translational product of the proposed osmC ORF. The stars indicate the Shine and Dalgarno sequence. The site of the osmC-8125 ::TnphA insertion is indicated by a bent arrow. The endpoints of4 deletions within the upstream region of osmC promoters are shown by arrowheads. The average position of the osmC mRNA transcription start sites, as determined by S1 mapping, are marked PI and P2 and putative hexanucleotides for the -10 and -35 regions of the are underlined with single and double lines, respectively. Two sequences conserved O@nGl and o.smC s2 promoters between the OsmC and the treA promoter regions are underlined with a broken line. This DNA sequence has been submitted to the EMBL data bank, and assigned the accession number X57433. For circled letters, see the text.

C. Gutierrez and J. C. Devedjian

964

pCG330 B

H

kon

K *

(b)

I

2

3

4

5

6

7

B

9

IO

II

4’gL ::;> 3.42.3-

Figure 3. Construction of an osmC deletion by gene replacement. (a) Plasmid pCG330 was constructed by replacement of the osmC+ 092 kb StuI-Sac1 DNA fragment of pBS20 by a kanamycin resistance cassette (filled block). The double line shows pBR325 vector DNA. E. coli chromosomal DNA is shown by a single line. The arrow indicates the position of the osmC ORF. (b) Southern transfer analysis of the deletion strains. Chromosomal DNA from strain MC41OO(lanes 6 and 10) and 3 deletion strains (lanes 3 and 7, 4 and 8, 5 and 9, respectively) were cut with BamHI (lanes 3 to 6) or Pat1 (lanes 7 to lo), transferred to a nylon membrane and hybridized with a pCG330 radiolabelled probe. Lanes 1, 2 and 11 contain pBS20 DNA cut with BarnHI, BumHI + EcoRI, and P&I, respectively. B, BumHI; E, EcoRI; H, HindIII; K, KpnI; P, P&I; Sa, SacI; St, S&I; St\Hi, hybrid StuI-HincII

site.

junction between osmC and TnphoA was sequenced and its position, deduced according to TnphoA leftend sequence (Manoil & Beckwith, 1985), is shown in Figure 2. The fusion is inside and in frame with the proposed osw&’ ORF, confirming this assignment of the ORF. (e) Site-directed deletion mutagenesis of osmC frm the E. coli chromosome The osmC gene was first identified by isolation of a transposon TnphoA insertion and it was tentatively concluded that it was not an essential gene However, the (Gutierrez et al., 1987). osmC-8115 : : TnphoA insertion appears to remove only eight amino acid residues from the mature OsmC protein carboxy-terminus and the hybrid protein could have retained at least part of the wildtype protein activity. Therefore, to address this question unambiguously, we constructed a deletion of osmC from the E. coli chromosome (Fig. 3). A 0.92 kb S&I-Sac1 DNA fragment carrying osw& was deleted from pBS20 and replaced by a 1.3 kb

kanamycin resistance cassette from plasmid pCG4K, resulting in pCG330 (Fig. 3(a)). pCG330 DNA (1 pg) linearized with EcoRI was used to transform the recB sbcB strain V355, selecting for kanamycin resistance. This led to the replacement of osmC by the kanamycin resistance gene on the bacterial chromosome through a double recombination event (Jasin & Schimmel, 1984). Phage Pl stocks were grown on eight independent transformants and used to transduce strain CLG124, which carries a TnlO insertion approximately 95% cotransducible with o@mC,to kanamycin resistance. In all cases we observed that, among the kanamycinresistant transductants, approximately 95% were tetracycline-sensitive, demonstrating that the kanamycin resistance cassette was mapping at the osmC locus. Finally, a Southern hybridization experiment was performed on three kanamycin resistant transductants of strain CLG124 obtained from Pl stocks grown on three different transformants (Fig. 3(b)). All three gave results identical with those predicted if the 0.92 kb osmC+ DNA fragment was replaced by the kanamycin resistance cassette. One transduc-

Osmotic Regulation of osmC Transcription

965

Table 2 Expression of a transcriptional Strain -___Relevant

fusion under the control of the osmC, promoter

CLG320

-.genotypea

~[oumC,-malP-~(malQ-laeZ)hybll]

CLG321

~[osmC,-malP-~(mal&-laeZ)hybl l]

osmC+

osmC-8115 : : TnphoA

Growth medium

K medium

j?-galactosidase activityb Alkaline phosphatase activityb

K medium + 0.3 M-NaCI

32

K medium

K medium + W3 M-N&I

43

592

632 233

10

“CLG320 and CLG321 carry a deletion of the chromosomal phoA gene. “Values are the average ofat

tant

was

conserved

AosmC : : Ean. deletion

least 4 independent

assays.

as a strain carrying and named CLG360.

(g) Mapping

the

of the 5’ end of osmC mRNA

To locate the osmC, promoter, we mapped the mRNA 5’ end by S, nuclease protection experiments. Two DNA fragments covering the promoter base-pair region, a 526 0smC HindIII-EcoRV and a 600 base-pair NindIII-MZuI fragment (Fig. 2) were cloned into the T7 promoter plasmid pTZ18R (Mead et aZ., 1986). 32P-labelled RNA probes, complementary to the 5’ end of the osmC mRNA and its upstream region, were obtained by transcription of these fragments with T7 RNA polymerase. Total RNA extracted from strain MC4100 grown at low and high osmotic pressure was hybridized with the two probes; the hybridization products were digested with S1 nuclease and analysed on a polyacrylamide/urea denaturing gel (Fig. 5). When hybridization was carried out with RNA extracted from cells grown at elevated osmotic pressure, protected RNA fragosmC

(fl Construction of an osmC-1acZ transcriptional fusion In order to test whether transcription was the step of osmC gene expression affected by osmotic pressure, we constructed a transcriptional fusion in which the osmC, promoter directed the transcription of a 1acZ gene. The system to clone and characterize promoters described by Vidal-Ingigliardi & Raibaud (1985) was used to construct this operon fusion, in single copy at the malA locus at 75 minutes on the bacterial chromosome. The construction is outlined in Figure 4 and was performed as described (Jung et al., 1990). The resulting strain, which carries a 4[osmC,-malP-&malQ-1acZ)hybl l] transcriptional An fusion (Fig. 4(e)), was named CLG320. osmC-8115 : : TnphoA fusion was introduced into CLG320 by transduction with the phage Pl, resulting in strain CLG321. Transcription initiating at the osmC’, promoter can be monitored by measuring the /l-galactosidase activity of the hybrid protein encoded by the &malQ-1acZ) hybll gene fusion in strains GLG320 and CLG321. The expression of the osmC,-lac fusion was first studied by streaking CLG320 and CLG321 onto EMB lactose agar supplemented with 0.25 M-NaCl. Both strains appeared as dark brown Lac+ colonies on this indicator medium in the presence of NaCl, while they showed a Lac- phenotype (pink colonies) in the absence of salt. A quantitative determination of the effect of NaCl on the expression of the transcriptional fusion is shown in Table 2. The b-galactosidase activities produced in strains CLG320 and CLG321 were apfiroximately 15-fold higher in K medium supplemented with 03 M-NaCl than in the low osmolarity medium. In strain CLG321, we could measure the expression of two different fusions transcribed under the control of the osmCp promoter and we also observed a 23-fold osmotic induction of alkaline phosphatase activity, as already reported for the expression of an osmC-8115 : : TnphoA fusion in strain CLG3 (Gugierrez et al., 1987). In conclusion, osmC gene expression is most probably controlled by osmotic pressure at the transcriptional level.

ments

of two sizes were obtained

with

each probe.

Comparison with the M13mp8 sequence scale shows that the major RNA bands protected by the shorter (EcoRV) and longer (MluI) probe migrate like DNA fragments of 61 and 71 or 135 and 145 bases, respectively. Assuming that RNA and DNA of the same size migrate similarly on sequencing gels, this would position the osmC mRNA 5’ end around nucleotides 456 and 466 in the sequence shown in Figure 2. Identical positions are obtained with both probes, reinforcing the assumption that RNA and DNA of the same size co-migrate. When hybridization was carried out with RNA extracted from cells grown at low osmotic pressure, the same protected bands were obtained, although in much lower amounts. This result confirms the transcriptional regulation of 0smC expression. Furthermore, it demonstrates that osmC expression utilizes the same promoter system in media of low and high osmotic pressure.

(h) A tandem promoter system controlling 0smC expression? The two 5’ ends determined for the osmC mRNA to two tandem promoters. may correspond Alternatively, they could result from the processing of longer RNA species. In particular, the shorter

C. Qutierrez and J. C. Devedjian

966 (0 1 pcc310

E

E s BH

EE

P

I

l-l

I I

I

B

PE

I

I kb

I -

--t----, osmCL+A

koll

Tn phoA

b/o

tet 1

(b)

I

Q I

pOM41

I 1 molP’

I :+----+-.-A

Y r-7

(c 1

molT

+

--e---w

4

mal T

(0)

--s--m

t -m-m---

e

:

I, ma/P

I,

------

ma/ T

-e-m

-m--e

t

molP

---- l-+

m---w--

mof 0’ ‘/ocZ

----osmC -phoA ’

-----c,,,,,,,I~Z~~XZ

lot Y

+----C=======I=====I==

mof P mol O:?oc 2

Figure 4. Construction of a transcriptional fusion expressed under the control of the osmC, promoters. (a) The plaamid pCG310 was constructed a8 described in Results. The extent of the TnphoA sequence is indicated by a bracket. The thick line show8 Tn5 DNA. The thin line show8 E. coli DNA. The vector pSB118 is shown in double lines. The filled triangle represents the osmC, promoters. (b) Plasmid pOM41 carries a part of the E. coli malA locus cloned in such a way that a transcriptional fusion was constructed between the m&P gene and the tetracycline resistance gene of pBR322. In this plasmid, the maZPppromoter ha8 been deleted and replaced by an EcoRI linker shown by a black dot. A 2.4 kb EcoRI DNA fragment carrying the osmC, promoters ~a.8 purified from pCG310 and cloned in the unique EcoRI site on pOM41. A prime indicate8 that the sequence of a gene is interrupted. (c) The plasmid pCG320 is represented above the muZA region on the chromosome of the strain CLG194, which carries a m&P-&m&Q-ZacZ)hybll hybrid operon. CLG194 is Lac+ (red colonies) on MacConkey plates supplemented with 1% lactose and 91% maltose. The single broken line represent8 the m&A region. Open triangles indicate the m&T, and m&P, promoters. Double interrupted line represents the lac region. In pCG320, the tetracycline resistance gene is transcribed under the control of the osmCr promoters. Presumably because these promoters are too weak, pCG320 doe8 not confer resistance to 10 pg tetracycline/ml. The position of a recombination event resulting in the insertion of pCG320 into CLG194 chromosome is shown by an arrow. (d) The m&A region on the chromosome of the strain issued from this insertion is shown. This strain grows on

Osmotic Regulation of osmC Transcription

967

Table 3 Effect of upstream deletions and an osmZ mutation promoter

on the activity

of the osmC,

/?-galactosidase activityb

-.

K medium + Strain CLG320 CLG341 CLG323 CLG326 CLG327 CLG329 CLG331 CLG343 CLG332 CLG336 CLG337

Relevant

genotype”

08mc; osmC,C(SspI-EcoRV) A13-osmC, AosmC,lG AoamC,17 AoJmC,lS osmC,+ 0smZ : : TnlO osmCg(SspI-EcoRV) 0rnnZ : : TnlO A13-osmC, osmZ: :TnlO Al&oamC, oamZ : : TnlO Al 7-0.3mC, osmZ : : TnlO

K medium

03 M-Nacl

32 100 26 84 71 3 368 669 246 243 239

592 710 440

607 607 7 1015 1196 882 1037 955

“All the promoter regions listed in this Table are in fromt of the m&P-&m&J-2aeZ)hybll “Values are the average of at least 4 independent assays.

RNA could be a maturation product of the longer one. We addressed this question by analysing the 5’ ends of the osmC mRNA after treatment with rifampicin (Fig. 6). Upon hybridization with RNA extracted from cells growing at high osmolarity eight minutes after the addition of rifampicin, a parallel decay for protected RNA bands of both sizes was observed (Fig. 6, lane 8). Therefore, the shorter RNA does not seem to result from the processing of the longer one. The possibility remained that both 5’ ends were processing sites. To test this, we performed a deletion analysis to define the upstream limit of the osmC regulatory region.

(i) Deletion analysis of the eztent of the osmC

promoter region A series of deletions within the osmCP promoter upstream region was obtained on plasmld pCG311, using the enzymes exonuclease III and S, nuclease (see Materials and Methods). The endpoints of four deletions (Al3, 16, 17 and 19) are shown in Figure 2. EcoRT DNA fragments carrying these deletions were cloned into the plasmid pOM41 and recombined upstream from a 4 (ma@-ZacZ)hybll gene fusion, as already described for the DNA fragment carrying the wild-type promoter. The resulting strains, CLG323, 326, 327 and 329 carry the deletions 13, 16, 17 and 19, respectively. The effect of the deletions on osmC expression and osmotic induction were then determined by measuring the

fusion

/?-galactosidase activities produced in these strains grown in K medium supplemented with @3 M-Nacl (Table 3). In the presence of deletion 19, the promoter activity is totally abolished. The /.%galactosidase activities measured in the presence of the other deletions are equivalent to those produced from the wild-type promoter region. Therefore, sequence information sufficient for expression and osmotic induction of the osmc,, promoter in our experimental conditions lies downstream from the endpoint of deletion 17. Deletions 16 and 17 remove part of the - 35 hexanucleotide of the upstream promoter of osmC (Fig. 2) and substitute newly adjacent sequences. As seen in Table 3, in the presence of these deletions, overall osmC transcription appears to be equivalent to that directed by an intact promoter region. To test the effect of deletions 16 and 17 on the promoters, we transduced a AosmC : : kan deletion to the strains CLG320, 326, 327 and 329 and determined the 5’ ends of the osmC mRNA produced in the resulting strains, GL361, 364, 365 and 366, respectively. Our results (Fig. 7) demonstrated first that the expression of the osmC promoters recombined at the m&A locus was identical with that from the wildtype region (compare Fig. 7, lane 1 with Fig. 5, lane 2). Secondly, they showed that deletions 16 and 17 abolish the transcription from the upstream promoter, while the transcription from that downstream is increased (Fig. 7, lanes 3 and 4). Deletion 19 totally abolished the production of the osmC mRNA.

MacConkey agar supplemented with 1 y. lactose, @l oh maltose and 10 pg tetracycline/ml (because the resistance gene is transcribed from the strong w&P,, promoter) and appears as Lac- (because the Zucregion is transcribed from the weak osmC, promoters). Brackets 1 and 2 indicate secondary recombination events resulting in spontaneous plasmid excision. Event 1 will restore the initial situation, while event 2 will leave the osmC, promoters upstream from the &mu@ ZaeZ)hybll gene fussion. (e) A derivative of such a recombinant cured from pCG320 is obtained after several steps of streaking on the same medium. Indeed, plaamids derived from pOM41 are somewhat unstable and are spontaneously lost by cells grown in the absence of selective pressure (Raibaud et al., 1984). The m&A region on the chromosome of one of these derivatives, named CLG320, is represented. The arrow shows the transcript of the operon fusion, synthesized under the control of the oRmC, promoters.

C. Gutierrez and J. C. Devedjian

968

I

2

G

A

T

C

3

4

In order to narrow the limits of the osmC regulatory region, a 137 base-pair SspI-EcoRV DNA fragment containing the osmC promoters (Fig. 2) was cloned into pSB118 cut at the WincII site, introducing EcoRI sites on both sides of the fragment. The resulting EcoRI fragment carrying the promoters was subcloned into pOM41 and recombined upstream from a &ma@-ZacZ)hybl 1 reporter fusion. P-Galactosidase assays (Table 3) and analysis of the osmC mRNA 5’ ends (Fig. 7, lane 2) demonstrated that the 137 base-pair DNA fragment contains sequences sufficient for expression and regulation of both promoters.

(j) osmC expression is partly constitutive in the presence of an osmZ-205 : : TnlO mutation Higgins et a2. (1988) isolated a mutation resulting in partially constitutive expression of proU, independent of the osmotic pressure in the medium. This mutation affects the gene osmZ, encoding the histone-like protein Hl (Hulton et al., 1990; May et al., 1990). A bacteriophage Pl stock was grown on strain GM229, which carries an osmZ-205 : : TnlO insertion, and used to transduce strains CLG320, 323, 326 and 327 to tetracycline resistance, leading to strains CLG331, 332, 336 and 337, respectively. The presence of an osmZ-205: :TnlO insertion resulted in partially constitutive expression of osmC, as can be seen in Table 3. The induced level of expression was approximately doubled as compared to isogenic osmZ+ strains. The increased osmC expression in the presence of an osmZ mutation is observed when osmC transcription is directed by the downstream promoter alone, in strains carrying the deletions 16 or 17. S, mapping of the 5’ ends of the osmC mRNA produced in strain GM229 (osmZp) growing in a medium of low osmotic pressure, demonstrated that a mutation in 0smZ results in an increase of transcription from both promoters (Fig. 8). (k) Transposon TnlO insertions 0smC expression

altering

In an attempt to characterize genes involved in regulation by osmotic pressure, we performed TnlO mutagenesis of strain CLG321 and screened for mutants exhibiting constitutive expression of osmC

osmC. A culture

Figure 5. Determination of osmC mRNA 5’ ends by S, nuclease mapping. Total RNA was extracted from the osmC+ strain MC4100 grown in K medium (lanes 1 and 4) or in K medium supplemented with 94 M-NaCl (lanes 2 and 3). RNA (5 pg) was hybridized with the 526 bases HindIII-EcoRV (lanes 1 and 2) or the 600 bases HindIII-MZuI (lanes 3 and 4) radiolabelled probes and digested with 2000 units of S, nuclease as described by Faubladier et al. (1990). The digestion products were analysed on a 6% polyacrylamide/7 M-urea sequencing gel. The dried gel was autoradiographed without a screen at room temperature. The sequencing ladder (lanes G, A.

of strain

CLG321

was infected

by

phage INK561 and plated onto EMB agar supplemented with 10 pg tetracycline/ml. Among approximately 20,000 colonies carrying independent TnlO insertions, two clones exhibited a Lac+ phenotype (dark-brown colony) on this medium. These two clones also constitutively express the osmC-phoA fusion present in CLG321, suggesting that the transposon insertion was affecting 0smC expression in

T, C) was obtained by sequencing M13mp18 DNA hybridized with the universal sequencing primer with Sequanase (IJSB Inc.) as described by the manufacturer.

Osmotic Regulation of osmC Transcription

969

Figure 6. S, nuclease mapping of osmC mRNA 5’ ends upon treatment with rifampicin. Strain MC4100 was grown in K medium supplemented with @4 M-NaCl and total RNA was extracted at various times (O-5, 1, 2, 4 and 8 min) following the addition of 200 pg rifampicin/ml. RNA (5 pg) was hybridized with the HindIII-EcoRV radiolabelled probe and the experiment was performed as described in the legend to Fig. 5. Lanes G, A, T, C indicate the M13mpl8 sequencing ladder. trans. Pl phage were grown on these clones and the TnlO insertions were transduced back to CLG320. The /II-galactosidase activities measured in these transductants were identical with the activities in measured strain carrying an CLG331 osmZ-205 : : ‘T’nlO insertion (data not shown). The C

T

A

G

I

2

3

4

5

two TnlO insertions were mapped genetically by PI transduction. Both showed a 23 y0 linkage with treA (26 min) and 2% with osmB (28.5 min). The locus is therefore located at 27 minutes on the E. coli genetic map, a position corresponding t,o that of osmZ. Mutations in osmZ are highly pleiotropic; in particular, they lead to an increased expression of bgl, a normally cryptic operon of E. coli (Higgins et al., 1988). Strains carrying the two TnlO insertions were checked for Bgl phenotype: both were Bgl+ while CLG321 was Bgl(E. Bremer. personal G

Figure 7. Effect of upstream deletions on the osmC promoters expression. Total RNA (5 pg) extracted from the AosmC : : kan strains CLG361 (lane 1), CLG362 (lane 2), CLG364 (lane 3), CLG365 (lane 4), and CLG366 (lane 5), grown in K medium supplemented with @4 M-N&l were hybridized with the HindIII-EcoRV radiolabelled probe and an 8, protection experiment was performed as described in the legend to Fig. 5, except that 2500 units of S, nuclease were used for each digestion. Lanes G, A, T, C indicate the M13mp18 sequencing ladder.

A

T

C

I

2

3

Figure 8. Effect of a mutation in osmZ on the osm(’ promoters expression. Total RNA (5 pg) extracted from strain MC4100 grown in K medium (lane 1) or K medium supplemented with @4 M-NaCl (lane 2) and from strain GM229 grown in K medium (lane 3) were hybridized with the HindIII-EcoRV radiolabelled probe and an S, protection experiment was performed as described in the legend to Fig. 7. Lanes G, A. T, C indicate the M13mp18 sequencing ladder.

C. Gutierrez and J. C. Devea$an

970

communication). Finally, chromosomal DNA was extracted from strains carrying the two TnlO insertions and analysed in a Southern transfer experiment, using a TnlO-specific probe. The results of this experiment (data not shown) located the two TnlO insertions within a 1.4 kb Pat1 DNA fragment, at position 1306 kb on the restriction map of the E. coli chromosome (Kohara et al., 1987). This Pat1 fragment contains part of the osmZ gene (May et al., 1999). Therefore, the two TnlO insertions leading to an osmC constitutive expression that we had isolated are most probably osmZ : : TnlO insertions.

4. Discussion We have characterized the osmC gene of E. coli. No significant similarity was found between OsmC and other proteins by scanning the EMBL protein sequence data bank and the function of this 14 kDa protein remains unknown. This gene has been identified, however, on the basis of its inducibility by elevated osmotic pressure in the growth medium, and it can be studied as a model to increase our knowledge of the mechanisms involved in the genetic response to osmotic stress. An osmC,-1acZ operon fusion was constructed. It showed osmotically stimulated expression (Table 2), suggesting very strongly that, as is also the case for all the osmotically stimulated genes studied so far, an increase in osmotic pressure induces osmC expression at the transcriptional level. As seen in S1 nuclease protection experiments, osmC mRNA exhibits two 5’ ends, ten nucleotides apart (Fig. 5). Analysis of these 5’ ends upon treatment with rifampicin (Fig. 6) and deletion mapping of the extent of the promoter region (Fig. 2 and Table 3) provided evidence that both 5’ ends correspond to transcription start sites rather than processing sites for longer RNA species. Therefore, it appears that osmC transcription is directed by two overlapping promoters. We named the upstream and downstream promoters osmCrl and (Fig. 2). The addition of osmc,, , respectively 94 M-NaGl to K medium resulted in a parallel increase in osmC mRNA of both sizes (Fig. 5), demonstrating that both promoters are osmotically inducible. As already reported for prolJ (May et al., 1989), treA (Repoila & Gutierrez, 1991) and osmB (Jung et al., 1990), our S1 mapping results established that osmC transcription does not start from different promoters in media of low and high osmotic pressure, demonstrating that osmotic induction does not involve the participation of alternate promoter systems. Six bases upstream from the average position for osmC,,, transcription start site determined in our S1 mapping experiments (circled T in Fig. 2), one can find a sequence presenting some homology to the consensus sequences of the promoters recognized by the o”-RNA polymerase holoenzyme (Harley & Reynolds, 1987). It is composed of -35 (TTATCC) and - 10 (TAGTCT) hexanucleotides, separated by 17 nucleotides. This sequence was revealed in a

computer search for bacterial promoters using the method of Mulligan et al. (1984) with a 5955% homology score and is very likely to represent the osmC,, promoter. Although homologies to the consensus sequence for the - 10 hexanucleotide of promoters recognized by the a” -RNA polymerase holoenzyme are found 9 (underlined in Fig. 2) or 11 nucleotides upstream from the average position for the downstream transcription start, no sequence was predicted for the osmC,, promoter in a computer search. Positively regulated promoters can diverge widely from the promoter consensus sequences constitutive (Raibaud 6 Schwartz, 1984). osmC,, might be a poor promoter of this class, with a particularly consensus sequences. homology to the osmCp2 may be recognized by an Alternatively, RNA polymerase core enzyme utilizing a minor o factor. Jovanovich et al. (1989) demonstrated that proU transcription depends on a” in an in vitro reconstituted system, and we provided genetic evidence that the same is true for treA (Repoila & Gutierrez, 1991). osmC promoters may function differently, however, and further work will be necessary to establish which a factor is involved in their transcription initiation. What can be the purpose of having two osmotically stimulated overlapping promoters? osmB, another osmotically inducible gene, is induced not only by elevated osmotic pressure but also when cells stop growing and enter stationary phase (Jung et al., 1990). We recently observed that the same is true for osmC (our unpublished results). Ni Bhriain et al. (1989) have shown that proU responds to changes in several parameters of the growth medium composition and proposed the concept of “stress-regulated” genes. It is attractive to suppose that osmC is a gene of this type. A tandem promoter system may allow the tine tuning of osmC expression in response to several stimuli and/or in different physiological states such as in growing or stationary cells. A number of osmotically inducible promoters have now been identified and can be compared. proU,, (Gowrishankar, 1989; May et al., 1989) presents no striking similarity with osmC,,, and oamf&, nor does it show any obvious feature in common with the treA (Repoila & Gutierrez, 1991) or osmB (Jung et al., 1999) promoters. When the osmC and treA promoter regions are compared, there are two blocks of conserved sequences (underlined by a broken line in Fig. 2). The 12 nucleotide sequence 5’-TAATTTCCTTTT-3, which overlaps osmC,, - 10, is almost identical with a sequence found 38 nucleotides upstream from heA,-- 35 (5’. TAATTCCCTTTT-3’). Deletion of this sequence, however, does not prevent treA osmotic induction in K medium (Repoila & Gutierrez, 1991). The ten nucleotide 5’-TTTTATTCGG-3’ sequence, found upstream from osmC,, -35 (Fig. 2), is also present within the leader region of the treA mRNA. Deletions 16 and 17 remove this sequence, demonstrating that it is not necessary for osmotic induc-

Osmotic Regulation of osmC Transcription tion at osmC,,, but this sequence could be involved in osmC,, regulation. The hexanucleotide TTATTC and its inverted repeat GAATAA flank the -35 region of the osm&., promoter and this structure was suggested to participate in the osmotic regulation of this promoter (Jung et al., 1990). We note that the ten nucleotide sequence common to the treA and osmC promoter regions includes a TTATTC hexanucleotide, although no inverted repeat of this sequence can be found in the treA or osmC region. Site-directed mutagenesis of these sequences, presently in progress, will test their role in osmotic induction. Several groups have searched for mutations affecting the expression of proU in order to identify proteins involved in osmotic regulation of this operon (Druger-Liotta et al., 1987; Higgins et al., 1988). Only two trans-acting loci were found in these studies: topA, which codes for DNA topoisomerase I, and osmZ, the gene encoding the histone-like protein Hl (Higgins et al., 1988; Hulton et al., 1990; May et al., 1990). Both topA and osmZ mutations alter the degree of supercoiling of reporter plasmids, supporting the hypothesis that proU osmotic induction is mediated by changes in DNA supercoiling (Higgins et al., 1988). Our data showed that a mutation in 08mZ also results in 0smC constitutive expression (Table 3). Furthermore, among 20,000 independent insertions of the transposon TnlO around the E. coli chromosome, two led to a constitutive expression of osmC and both appeared to be osmZ : : TnlO insertions. This, however, does not regulatory prove that there are no trans-acting genes controlling osmC expression, or that osmC is subject to a direct control by DNA supercoiling. The recent finding that osmC expression is increased upon the addition of K+ glutamate in an in vitro reconstituted system (Ramirez & Villarejo, 1991) suggests that a similar mechanism, through a direct on the transcriptional action of K+ glutamate complex, may operate in the regulation of osmC and proU, even though the promoters of these genes do

not have any obvious structure

in common.

We thank E. Bremer and M. Villarejo for bacterial strains and communication of unpublished results. We are particularly indebted to J. P. Bouchb for the gift of plasmid pBS20, M. Faubladier for advice about the S1 mapping technique and M. Chandler for critical reading of the manuscript. This work wa supported in part by grants from the Universitb Paul Sabatier in Toulouse and the Rhgion Midi-Pyr6nBes. References H., Adhya, S. & de Crombrugghe, B. (1981). Evidence for two functional gal promoters in intact J. Biol. Escherichia COli cells. Chem. 256, 11905-11910. Andersen, P. A., Kaasen, I., Styrvold, O., Boulnois, G. & Stram, A. R. (1988). Molecular cloning, physical mapping and expression of bet genes governing the osmoregulatory choline-glycinebetaine pathway of Escherichia coli. J. Qen. Microbial. 134, 1737-1746.

Aiba,

971

Bachman, B. J. (1987). Linkage map of Escherichia coli. Edition 7. In Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology (Neidhardt, F., Ingraham, J., Low, K., Magaaanik, B., Schaechter, M. & Umbarger, H., eds), pp. 807-876, American Society for Microbiology, Washington, DC. BouchB, J. P. (1982). Physical map of a 470 x 10’ basepair region flanking the terminus of DNA replication in the Escherichia coli K12 genome. J. Mol. Biol. 154, l-20. Cairney, J., Booth, I. R. BE Higgins, C. F. (1985a). Salmonella typhimurium prop gene encodes a transport system for the osmoprotectant betaine. J. Bacterial. 164, 1218-1223. Cairney, J., Booth, I. R. & Higgins, C. F. (1985b). Osmoregulation of gene expression in Salmonella typhimurium: proU encodes an osmotically induced betaine transport J. Bacterial. 164, system. 1224-1232. Campbell, A., Berg, D., Botstein, D., Lederberg, E., Novick, R., Starlinger, P. & Szybalski, W. (1977). Nomenclature of transposable elements in prokaryotes. In DNA Insertion Elements, Plasmids, and Episomes (Bukhari, A. I., Shapiro, J. A. L Adhya S. L., eds), pp. 15-22. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Casadaban, M. (1976). Transposition and fusion of the lac genes to selected promoters in Eecherichia coli using bacteriophage lambda and Mu. J. Mol. Biol. 104, 54-555. Csonka, L. N. (1989). Physiological and genetic response of bacteria to osmotic stress. Microbial. Rev. 53, 121-147. Dinnbier, U., Limpinsel, E., Schmid, R. t Bakker, E. P. (1988). Transient accumulation of potassium glutamate and its replacement by trehalose during adaptation of growing cells of Escherichia coli K12 to elevated sodium chloride concentrations. Arch. Microbial. 150, 348-357. Druger-Liotta, J., Prange, V. J., Overdier, D. G. & Csonka, L. N. (1987). Selection of mutations that of the alter osmotic control of transcription Salmonella typhimurium proU operon. J. Bacterial. 169, 2449-2459. Dunlap, V. J. t Csonka, L. N. (1985). Osmotic regulation of L-proline transport in Salmonella typhimum’um. J. Baeteriol. 163, 29%304. Epstein, W. (1986). Osmoreguletion by potassium transport in Escherichia coli. FEMS Microbial. Rev. 39, 73-78. Eshoo, M. W. (1988). lac fusion analysis of the bet genes of Escherichia coli: regulation by osmolarity, temperaand ture, choline glycinebetaine. oxygen, J. Bacterial. 170, 5208-5215. Faubladier, M., Cam, K. & BouchB, J. P. (1990). Escherichia coli cell division inhibitor DicF-RNA of the dicB operon. J. Mol. Biol. 212, 461471. Forst, S. & Inouye, M. (1988). Environmentally regulated gene expression for membrane proteins in Escherichia coli. Annu. Rev. Cell Biol. 4, 2142. Giaever, H., Styrvold, O., Kassen, I. & Strem, A. R. (1988). Biochemical and genetic characterization of osmoregulatory trehalose synthesis in Escherichia coli. J. Baeteriol. 170, 2841-2849. Gowrishankar, J. (1985). Identification of osmoresponsive genes in Escherichia coli: evidence for participation of potassium and proline transport systems in osmoregulation. J. Bacterial. 164, 434-445. Gowrishankar, ,J. (1989). Nucleotide sequence of the

972

C, Gutierrez

and J. C. Devedjian

osmoregulatory proU operon of Escherichia coli. J. Bucteriol. 171, 1923-1931. Gutierrez, C., Barondess, J., Manoil, C. & Beckwith, J. (1987). The use of transposon TnphoA to detect genes for cell envelope proteins subject to a common regulatory stimulus. J. Mol. Biol. 195, 289-297. Gutierrez, C., Ardourel, M., Bremer, E., Middendorf, A., Boos, W. & Ehman, U. (1989). Analysis and DNA sequence of the osmoregulated treA gene encoding the periplasmic trehalase of Escherichia coli K12. Mol. Gen. Genet. 217, 347-354. Hall, M. & Silhavy, T. (1981). The ompB locus and the regulation of the major outer membrane porin proteins of Escherichia coli K12. J. Mol. Biol. 146, 2343. Harley, C. & Reynolds, R. (1987). Analysis of E. coli promoter sequences. Nucl. Acids Res. 15, 2343-2361. Higgins, C. F., Dorman, C., Stirling, D., Wadell, L., Booth, I. R., May, G. & Bremer, E. (1988). A physiological role for DNA supercoiling in the osmotic regulation of gene expression in S. typhimurium and E. coli. Cell, 52, 569-584. Hulton, C., Seirafi, A., Hinton, J., Sidebotham, J., Waddell, L., Pavitt, G., Owen-Hughes, T., Spassky, A., But, H. 6 Higgins, C. F. (1999). Histone-like protein Hl (H-NS), DNA supercoiling and gene expression in bacteria. Cell, 63, 631-642. Jasin, M. & Schimmel, P. (1984). Deletion of an essential gene in Escherichia coli by site-specific recombination with linear DNA fragments. J. Bucteriol. 159, 783-786. Jovanovich, S. B., Martinell, M., Record, M. T., Jr & Burgess, R. B. (1988). Rapid response to osmotic upshift by osmoregulated genes in Escherichia coli and Salmonella typhimurium. J. Bacterial. 170, 534-539. Jovanovich, S. B., Record, M. T., Jr & Burgess, R. B. (1989). In an Escherichia coli coupled transcriptiontranslation system, expression of the osmoregulated gene proU is stimulated at elevated potassium concentrations and by an extract from cells grown at high osmolarity. J. Biol. Chem. 264, 7821-7825. Jung, J. U., Gutierrez, C. & Villarejo, M. (1989). Sequence inducible lipoprotein gene. of an osmotically J. BacterioE. 171, 511-520. Jung, J. U., Gutierrez, C., Martin, F., Ardourel, M. & Villarejo, M. (1990). Transcription of osmB, a gene encoding an Escherichia coli lipoprotein is regulated by dual signals. J. Biol. Chem. 265, 10574-10581. Kennedy, E. (1982). Osmotic regulation and the biosynthesis of membrane-derived oligosaccharides in Escherichia wli. Proc. Nat. Acad. Sci., U.S.A. 79, 1092-1095. Kohara, Y., Akiyama, K. & Isono, K. (1987). The physical map of the whole E. coli chromosome. Cell, 50, 495-508. Laimins, L., Rhoads, D. & Epstein, W. (1981). Osmotic control of kdp operon expression in Escherichia coli. Proc. Nat. Acad. Sci., U.S.A. 78, 464-468. Lowry, 0. H., Rosebrough, N. J., Farr, A. L. & Randall, R. J. (1951). Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265-275. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Manoil, C. & Beckwith, J. (1985). TnphoA: a transposon probe for protein export signals. Proc. Nat. Acad. Sci., U.S.A. 83, 8129-8133.

May, G., Faatz, E., Villarejo, M. & Bremer, E. (1986). Binding protein dependent transport of glycine betaine and its osmotic regulation in Escherichia coli. Mol. Gen. Genet. 205, 225-233. May, G., Faatz, E., Lucht, J. M., Haardt, M., Bolliger, M. & Bremer, E. (1989). Characterization of the osmoregulated Escherichia coli proU operon and identification of ProV as a membrane-associated protein. Mol. Microbial. 3, 1521-1531. May, G., Dersh, P., Haardt, M., Middendorf, A. & Bremer, E. (1990). The osmZ (bg1Y) gene encodes the DNA-binding protein H-NS (Hla), a component of the Escherichia coli nucleoid. Mol. Gen. Genet. 224, 81-96. Mead, D., Szczesna-Skorupa, E. & Kemper, B. (1986). Single-stranded DNA “blue” T7 promoter plasmids: a versatile tandem promoter system for cloning and protein engineering. Protein Engin. 1, 67-74. Measures, J. C. (1975). Role of amino acids in osmoregulation of nonhalophilic bacteria. Nature (London), 257, 39&400. Melton, D. A., Krieg, P. A., Rebagliati, M. R., Maniatis, T. & Green, M. R. (1984). Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucl. Acids Res. 12, 7035-7056. Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Mulligan, M., Hawley, D., Entriken, R. & McClure, W. (1984). Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity. Nucl. Acids Res. 12, 789-800. Ni Bhriain, N., Dorman, C. J. & Higgins, C. F. (1989). An overlap between osmotic and anaerobic stress responses: a potential role for DNA supercoiling in the coordinate regulation of gene expression. Mol. Microbial. 3, 933-942. Overdier, D. G., Olson, E. R., Erickson, B. D., Ederer, M. M. & Csonka, L. N. (1989). Nucleotide sequence of the transcriptional control region of the osmotically regulated proU operon of Salmonella typhimurium and identification of the 5’ endpoint of the proU mRNA. J. Bacterial. 171, 46944706. Prince, W. S. & Villarejo, M. (1990). Osmotic control of proU transcription is mediated through direct action of potassium glutamate on the transcription complex. J. Biol. Chem. 265, 17673-17679. Raibaud, 0. & Schwartz, M. (1984). Positive control of transcription initiation in bacteria. Annu. Rev. Genet. 18, 173-206. Raibaud, O., Mock, M. & Schwartz, M. (1984). A technique for integrating any DNA fragment into the chromosome of Escherichia coli. Gene, 29, 231-241. Ramirez, R. M. & Villarejo. M. (1991). Osmotic signal transduction to proTJ is independent of DNA supercoiling in Escherichia coli. J. Bacterial. 173, 879885. Ramirez, R. M., Prince, W. S., Bremer, E. & Villarejo, M. (1989). In vitro reconstitution of osmoregulated expression of proU of Escherichia coli. Proc. Nat. Acud. Sci., U.S.A. 86, 1153-1157. Repoila, F. & Gutierrez, C. (1991). Osmotic induction of the periplasmic trehalase in Escherichia coli K12: characterization of the treA gene promoter. Mol. Microbial. 5, 747-755. Richey, B., Cayley, D., Mossing, M., Kolka, C., Anderson, C., Farrar, T. & Record, M. T., Jr (1987) Variability in the intracellular ionic environment of Escherichia coli: differences between in vitro and in vivo effects of

Osmotic Regulation

ion concentrations on protein-DNA interactions and gene expression. J. Biol. Chem. 262, 7157-7164. Sancar, A., Hack, A. M. & Rupp, W. D. (1979). Simple method for identification of plasmid-coded proteins. J. Bacterial. 137, 692693. Silhavy, T., Berman, M. & Enquist, L. (1984). Experiments with Gene Fusions. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Stirling, D. A. & Hulton, C. S., Waddell, L., Park, S. F., Stewart, G. S., Booth, I. R. & Higgins, C. F. (1989). Molecular characterization of the proU loci of typhimurium and Escherichia coli Salmondla encoding osmoregulated glycine betaine transport systems, Mol. Microbial. 3, 10251038. Strsm, A. R., Falkenberg, P. & Landfald, B. (1986). Genetics of osmoregulation in Escherichia coli: uptake Edited

of osmC Transcription

973

and biosynthesis of organic osmolytes. FEMS Microbial. Rev. 39, 79-86. Styrvold, O., Falkenberg, P., Landfald, B., Eshoo, M., Bjornsen, T. & Strem, A. R. (1986). Selection, mapping and characterization of osmoregulatory mutants of Escherichia coli blocked in the cholineglycinebetaine pathway. J. Bacterial. 165, 856863. Sutherland, L., Cairney, J., Elmore. M. tJ., Booth. I. R. & Higgins, C. F. (1986). Osmotic regulation of transcription: induction of the proC’ betaine transport’ gene is dependent on accumulation of intracellular potassium. J. Bacterial. 168, 805814. Vidal-Ingigliardi, D. & Raibaud, 0. (1985). A convenient technique to compare the efficiency of promoters in Escherichia coli. Nucl. Acids Res. 13. 59195926.

by J. H. Miller