GENOMICS

13,502-508

(19%)

Organization

of the Gene Encoding the Mouse T-Cell-Specific Serine Proteinase “Granzyme A” K. EBNET, M. D. KRAMER,*

Max-Planck-lnstitut

AND

M. M. SIMON

fur Immunbiologie, Stiibeweg 51, D-7800 Freiburg, Germany; and *Institut fijr lmmunologie Heidelberg, Im Neuenheimer Fe/d 305, D-6900 Heidelberg, Germany Received

November

15, 1991,

The mouse serine protease granzyme A is a member of a closely related family of T-cell-associated proteolytic enzymes, designated granzymes A-G. Previous studies have indicated that granzymes A and B are involved in various Tcell-mediated processes. Here we report the genomic organization of the granzyme A gene. We have cloned a 15-kb DNA fragment from a genomic library of a cloned CDS’ T-cell line and sequencedthe exon-intron boundaries. The gene consists of five exons, and its genomic organization is very similar to that described for granzymes B, C, and F. In addition, we have sequenced 1.4 kb of the 5’-region and 1.1 kb of the 3’-region flanking the granzyme A gene. Putative promoter and enhancer elements were identified by sequence comparison with known consensus sequences. Some of these regulatory elements seem to be associated exclusively with granzyme A, whereas others are shared by members of the granzyme family. $’ 1992 Academic Press, IIIC.

INTRODUCTION

The murine T-cell-specific serine proteinase granzyme A (Masson et al., 1986a), also termed MTSP-1 (Simon et al., 1986), serine esterase 1 (Young et al., 1986), or Hanukah factor (Gershenfeld and Weissman, 1986), has been shown to be expressed in the majority of activated but not resting CD8+ cytotoxic T lymphocytes (CTL; Garcia-Sanz et al., 1987; Simon et al., 1988). This enzyme belongs to a family of highly related T-cell-associated proteolytic enzymes, i.e., granzymes A-G (Masson and Tschopp, 1987). All seven molecules were shown to be expressed in CDB’ T lymphocyte clones (TLC) and to be associated with their cytoplasmic granules (Masson and Tschopp, 1987). Together with other molecules such as the lytic perforin (Podack et al., 1985), granzymes are released during CTL-target cell interaction into the extracellular space (Takayama and Sitkovsky, 1987; Simon et al., 1989). In uiuo, only granzymes A and B and marginally also granzyme C have been found to be

revised

February

6, 1992

expressed in sensitized T cells (Garcia-Sanz et al., 1990; Ebnet et al., 1991); in addition, only granzymes A and B have been shown so far to express proteolytic activities for proteinaceous and synthetic substrates (Simon et al., 1986; Odake et al., 1991). Granzyme A is unique among this family of enzymes in that it forms a disulfide-linked homodimer (Masson et al., 198613;Simon et al., 1988). The biological role of granzymes is not known at present. However, the findings that granzyme A cleaves structures associated with extracellular matrices (Simon et al., 1991) and viruses (Simon et al., 1987) and that inhibitors of the enzyme interfere with granule-mediated target cell destruction (Simon et al., 1989) indicate its involvement in T-cell-mediated processes such as extravasation, regulation of virus replication, and cytolysis. Two enzymes homologous to mouse granzymes, i.e., human granzymes A and B (Fruth et al., 1987; Krahenbiihl et al., 1988; Poe et al., 1988,199l; Hameed et al., 1988), have been isolated from human CD8+ CTL. Recently, an additional member of this family, designated human granzyme H, has been described (Meier et al., 1990; Klein et al., 1990; Haddad et al., 1991). Comparisons of nucleotide sequences obtained from cDNA clones specific to each of the seven mouse and the three human granzymes point to their close evolutionary relationship (for review, seeJenne and Tschopp, 1988). This is further substantiated by the striking similarity in the genomic organization reported for mouse granzymes B, C, and F (Lobe et al., 1988; Jenne et al., 1991) and for human granzymes B (Klein et al., 1989; Caputo et al., 1990; Haddad et at., 1990) and H (Meier et al., 1990; Haddad et al., 1991). Here we report the genomic organization of mouse granzyme A. In addition, we present sequence information on the 5’- and 3’-regions flanking the gene. The data reveal an organization of the granzyme A gene corresponding largely to that of the other members of the granzyme family. MATERIALS

Sequence data from this article have been deposited with the EMBL Data Library under Accession Nos. X60310, X60311, X62542, and X62543.

0888-7543/92

Copyright All rights

Inc.

reserved.

AND

METHODS

A partial Screening of a genomic library. 30 library of the male antigen H-Y-specific 502

$5.00

0 1992 by Academic Press, of reproduction in any form

der Universitd’t

Sau3A CDS+

genomic Charon TLC 2.A4.2 was

ORGANIZATION EB

AC

PPS

SHHE \I

-c-c-

OF THE GENE EC

ENCODING H

A

S

-

-

(lkb

1

--

c

E I

4-

cc-cc t-

B

503

A

\I

--

4-

GRANZYME

-a

CC

*C ec

+--

FIG. 1. Restriction site map, genomic organization, and sequencing strategy of the granzyme A gene. The top part of the figure shows the restriction site map of a 10.2-kb region of the granzyme A gene that was subcloned into the pSK- plasmid. The genomic organization of the gene is shown in the middle part. Translated regions are indicated as open boxes; introns and noncoding regions of the 5’. and 3’-end are shown as solid lines. The second box indicates a putative aberrant splicing product (dashed box). The bottom part of the figure demonstrates the seauencing strategv. The arrows indicate seauencina in the sense and antisense directions. Abbreviations are E (EcoRI), B (BumHI), A (HpaI), C (HincII), H (HindIII), P (P&I), S (SmaI): screened in duplicate using oligonucleotide probes. Recombinant plaques (3 X 105) with lo4 plaques per 15-cm plate were analyzed. Plaques were lifted onto nitrocellulose filters, denatured in 0.5 M NaOH/1.5 M NaCl, and neutralized in 0.5 M Tris (pH 7.0)/1.5 M NaCl. After drying, the filters were baked for 2 h at 80°C in a vacuum oven. Hybridization. Hybridization of nitrocellulose filters as well as nylon membranes was performed essentially as described elsewhere (Ebnet et al., 1991). Southern blotting. Recombinant phage or plasmid DNA was resolved on agarose gels, stained with ethidium bromide, and transferred to a Zeta-probe nylon membrane (Bio-Rad, Richmond, CA) with the alkaline transfer method. The blotting was performed for 1 h at a constant vacuum of 50 mbar using a vacuum blotting system (Pharmacia LKB, Freiburg, Germany). The DNA was fixed by UVcrosslinking (Stratagene, La Jolla, CA). Polymerase chain reaction. Polymerase chain reaction (PCR) was performed essentially as described (Sambrook et al., 1989). Two hundred nanograms of the recombinant phage DNA was subjected to amplification in 10 mMTris-HCl (pH 8.4), 50 mA4 KCl, 2 n-&MgCl,, 100 pg/ml gelatin, 20 PM dithiothreitol. The primers were added at a concentration of 1 PM and each dNTP at 200 FM. After heat denaturation, 2 units of Toq DNA polymerase (Perkin-Elmer/Cetus, Norwalk, CT) was added, and the DNA was subjected to 35 cycles of PCR amplification as follows: the samples were denatured at 95°C for 70 s, cooled down to 55°C for 2 min for primer annealing, and finally kept at 72°C for 2 min for primer extension. PCR of cytoplasmic RNA was performed as described elsewhere (Ebnet et aZ., 1991). Plasmid and bacteDNA preparation and analysis of cloned DNA. riophage X DNAs were purified by standard techniques (Sambrook et al., 1989). Restriction enzyme digestions were performed under conditions recommended by the manufacturer. PCR amplification prodPurification and cloning of PCRproducts. ucts were resolved on 1% low-melting-point agarose gels (BRL, Eggenstein, Germany). The gel slices containing the DNA fragments were incubated at 7O”C, and the agarose was removed by several extractions with phenol and chloroform. Prior to ligation, the purified PCR products were phosphorylated at the 5’-end using T4 polynucleotide kinase (BRL). Plasmids were digested with restriction enzymes, producing blunt ends, and treated with calf intestine alkaline phosphatase (Boehringer, Mannheim, Germany) to reduce self-ligation. Sequencing. Sequencing of both cloned PCR products and genomic clones was performed according to the dideoxy chain-termination method (Banger et ai., 1977). The given sequences have been determined by sequencing both strands.

RESULTS

AND

DISCUSSION

Isolation of the Granzyme A Gene and Its Restriction Map A mouse genomic library from TLC 2.A4.2 was screened with oligonucleotide probes specific for the 5’and the 3’-regions of the granzyme A cDNA. Seven plaques positive with the 5’-probe, 17 with the 3’-probe, and 3 with both were initially identified. Only one of the double-positive clones was shown to hybridize to four cDNA-derived oligonucleotides (including the previous two) spanning the entire coding region of granzyme A, indicating that this clone contained the full-length granzyme A gene. Restriction enzyme fragments of this clone were subcloned. Figure 1 depicts the restriction map of the granzyme A gene. Determination of the Introns within the Granzyme A Gene To determine the number and size of the introns located within the granzyme A gene, randomly chosen oligonucleotides spanning the entire coding region in both sense and antisense orientations were used as primers for PCR (Fig. 2). It was expected that if one (or more) intron(s) were located between the two primer binding sites in the genomic clone, this would result in amplification products larger than those obtained from the cDNA. Seven primer pairs were added to each of the following templates: (i) genomic DNA from the isolated granzyme A-specific clone; (ii) cDNA derived from CD8+ TLC HY3-Ag3, which expresses granzyme A constitutively (Ebnet et al., 1991); and (iii) cDNA from the thymoma line EL4-F15, which does not express granzyme A (Ebnet et al., 1991). The gel patterns (Fig. 2) of the individual PCR products reveal the presence of at least five putative introns within the granzyme A gene (Fig. 1). To exclude the presence of additional introns located in regions of the exons that were not amplified

504

I

A

EBNET,

KRAMER,

C

D

B

123123123123

AND

SIMON

E

F

G

123123123

Primer

HF.5 S HFd AS

S-T-T5’GACCAG

HF.4 S HF-6 AS

S-ATCXXXA~TCTCCAll~

HF.6 S HF-2 AS

5’AACAAC4XTGKTCCTCCAATGAT~

HF.2 S HFB AS

5’CCGTAC

HF.8 S HF.7 AS

5’-AffiTAGGTG44G

HF.7 S HFAS

5’.ATTGCAGGAGTCClTKCACUG3

HFS HF-3 AS

5‘.CACAG4ACCCllCATAATCllClTTA-3

PCR-Product expected from dN4

PCR-Product obtained from geromic DNA

99bp

0.3kh

0 2kb

156bp

2.3kb

2.lkb

270bp

2.3kb

2.0kb

72bp

0.25kb

0.2kb

240bp

0.25kb

-

179bp

1 9kb

Approximate size of the intron

1.7kb

FIG. 2. PCR-amplified introns separated by agarose gel electrophoresis. Seven different primer pairs (A-G) spanning the entire cDNA were used for amplification of intron sequences of the granzyme A gene. Primer HF-5 is located immediately in front of the translation initiation site, representing the extreme 5’-end of the coding region; HF-3 represents the extreme 3’-end of the coding region lying immediately in front of the translation stop codon. All other primers are located between these two primers. PCR was performed for each pair with three different templates: genomic DNA of the isolated X Charon 30 clone (I), cytoplasmic RNA of CTL HY3-Ag3 as positive control (2), and cytoplasmic RNA of thymoma line EL4-F15 as negative control (3). The primer sequences, the sizes of the amplified PCR products expected and obtained from the cDNA, and those obtained from the genomic X Charon 30 DNA are depicted in the bottom part of the figure. Five of the seven pairs yielded larger amplification products from the genomic Charon 30 DNA template than from the cytoplasmic RNA (B, C, D, E, and G). The differences in size between the genomic DNAand the cytoplasmic RNA-derived PCR products reveal the length of the introns between the primer binding sites; they are 0.2 kb (B), 2.1 kb (C), 2.0 kb (D), 0.2 kb (E), and 1.7 kb (G). Primer pair A was expected to yield no amplification product and served as negative control, pair F yielded amplification products of the same size from cDNA and genomic X phage DNA as template, indicating that no intron is located between their binding sites.

by PCR, we sequenced all exons completely from the genomic clones at least on one strand. No additional intervening sequence (IVS) was found, indicating that all introns were amplified by previous PCR (see also Fig. 3). Sequencing of the Granzyme Organization

A Gene and Its Genomic

The sequence of the granzyme A gene encompassing the translated portion and parts of the four introns as well as the 5’- and 3’-flanking regions is depicted in Fig. 3. The exon/intron boundaries were initially determined by sequencing each of the five cloned PCR products from both ends (data not shown). To exclude the possibility that false nucleotides were introduced by Taq poly-

merase during PCR amplification, the subcloned EcoRI and BamHI fragments of the genomic clone were also sequenced using the appropriate oligonucleotides as primers and the sequencing strategy depicted in Fig. 1. Figure 3 shows that all 10 exon/intron boundaries fit well to the conserved consensus motifs of splicing donor and acceptor sites (Breathnach and Chambon, 1981). The first exon encodes a putative signal peptide with hydrophobic parts typical of proteins that are secreted or stored in intracellular compartments. Between the first and the second exon, there is an additional nucleotide sequence that is flanked by two sequences matching the conserved splice site consensus sequences (Breathnach and Chambon, 1981) and that was shown to be expressed in mature mRNA (Gershenfeld and Weissman, 1986), suggesting a further exon that encodes an

ORGANIZATION

OF

THE

GENE

ENCODING

GRANZYME

505

A

. . . . . . 10........20........30........40........50.... TATATATATATATAAAATATAACATAATAATAAmAAAAGTCAC TCCCCCCTTlTCATTCGGTGCAAG'TGTGAATT%T~~ CTCCTGCTATCTCACTGATGTTCCCGACAATGATGAAAn; TAAGGTCACGTGGmCTGAAGAA~ACTCAGAAGPACTCAG?TGGCCTGAAJ CATAGAGCCGGCCCTGTGCCTCACGACAGAGACCACTTCCV DGAAAGCAACT AGAC~KXi'f..AC~A~C GApcmm CA._ _. . ..~ ACGAAGAGACCAGAGATTGACC~~CXAA~A~

ACiATCTTCCTATCTCK;CAG?TCn;GGATCACAGCCACAC TGTGGCAAGTACTl'GAACAGA~TCTACCTC~ GGCCATKATMPAACACCCCAACTGA~TlTC GAGGCTACAAACCTC~

TCCAGCTCTACACCM TTGGGGTGGGAGAGCCAC~AAGACAGAC MetArgAsnAlaSerGlyPro~gGlyProSerLlaT~~u~uPheLeuLIleProGluG TCATGl’AAl.llTCATCAAAACCATCATAGAATAGATITG TAGCATl’CA T

A

GC’MTCACCATGATGTCTTAAGTAT?UiCTGAGAATAC’lT~~CTGGGAACACT TATGTAlTCATAGTlTCTITCCAAAAATTAGCAGAACCACCARTGGAGATIGCTGCCGA 1aGluProProMetGluIleAlaAlaAs

AGTGAMSiGATGGAGTGTGTl'AGcTA----1.7KB----ccCAGCTTA'll'CCACCcTCTTGTITTCCA

p GlyAspSerGlySerProLeuLeuCysAsp

TAAAGAAGATTAn;AAGGGITCTGIY;TAAATGTATGTCTlTCACTCCATCCCTGTCACTTCTGTGTCTGATCAC AlATAAMTC?!ACTTGAATGGCTGCA leLysLysIleMetLysGlySerVal*** CCIY;TCCTCCTCCn;TAACG?TCTPGGGCAGATCTCCAA AGGGGACmCTCCCn~~~~TC~C~CA~~A~~ TCAGCATTCTGAACTGCCCTAGGGGGl'A AGAGCGAAAAGGAAn;AAACCCCGCCCCCCC~CT~CCAC~CCACA~CACTCATATAC~~~~CATC~~~C~~A~ GGTAGGTTCCCTAGGCAGC TGTGCACTGCCTCCTGGCCTCTGACCTAAGATGAAGCTCAGCCCAGGAACACCTAGAGGTICTGAGTTCATTGACATCCX?T GCAACCCAGGCCGn;GCATTCC?TAACCACCCCn;G AGGGAlTCTGGAGTGATATTTTAGACATGTCATAATCTTTCATATAGA'MTGGAA TTlTAATTACAATAAATTAATTGCTCTATACTGAATACCATI-ITT TAAATIGlTGCCACAAACCTTCATGCATTGCTAGTTAAAGTACAAACTTGCCATAGTAAATMC ?TGGAAAAAATTACTAGTGcCTATGGAAGATTAAGC TC~A~TA~C~C~~T~G~CACC~~TATATCC~TA~CATAC~G ACTAAGTAClTAAACTCAUACTCTACATGACTl'AGGTAGCAGGGCCTMTGC CTACTTTATITGGGTTCCTATATCTACCACCC'M'CTCTACTCCAATC TCTTCCAACAGCCCAGCACTAGGTAGG TGGGAMGAGGGTTAGAGGAGGTATAGCTPTCTITAGACTACTTCTTGCTGA~CAAG TTTCGTGGACTTGGGACAAGGTCAATCTKATCCTTAGGATATCTCTAACCAG FIG. 3. Genomic nucleotide sequence anddeducedamino acid sequenceofthegranzyme A gene.Genomic fragments ofX Charon 30were subclonedandpartiallysequenced.Thesequenceincludes1.4kboftheB'-promoterregion.Thecanonical TATAboxaswell asseveralputative regmatoryelementsinthis regionareunderlined (seetextformoredetail).Withinthecodingregionthetranslatedpartsareunderlinedandthe deducedamino acid sequenceisshownbelowthe nucleotide sequence. The aminoacid sequence below the nucleotide sequencenotunderlined containsonein-frame stopcodonindicatedbyasterisks andcorrespondstothepeptideencodedbyapresumably aberrantspliceproduct.The polyadenylation signal is located 50 bp downstream of the TAA stop codon (underlined); the site of poly(A) addition is indicated by a boldface character.

506

EBNET,

KRAMER,

AND

SIMON

Gran B

0.1

261

t

Gran C

0.1

261

/-0.5jYE-J

Gran F

0.2

261

-(,,,I

0.4-pT-j

261

I j-O.641

HuGran H

256

f. 0.4-p-J

MMCP-1

255

RMCP-2

255

t

HuCat-G

255

)0.43[1711

Hu Ela

231

HuGran B

I

0.6

~l.Oj~tO.46-ff~

0.2

1

I 141

1 1

0.36{7[

FIG. 4. Comparison of the granzyme A gene with other hematopoietic and F (Gran B, Gran C, Gran F), the human granzymes B and H (HuGran cell protease 1 (MMCP-1) and rat mast cell protease 2 (RMCP-2), human open boxes represent exons (for exons 1 and 5 only the coding sequences and between boxes indicate the sizes of exons (in bp) and introns (in kb), of the predicted enzymes are indicated by H (histidine), D (aspartic acid),

cell-specific serine protease genes. These are murine granzymes B, C, B, HuGran H), two mast cell proteases of mouse and rat, mouse mast cathepsin G (HuCat G), and human neutrophil elastase (Hu Ela). The are represented) and introns are shown as lines. The numbers within respectively. The positions of the amino acids forming the active sites and S (serine) and are located at corresponding sites in all eight genes.

additional leader. However, this putative exon contains one in-frame stop codon and therefore presumably gives rise to short peptides without biological function. Furthermore, the DNA located 5’-upstream of this sequence contains only a truncated version of a branch site consensus motif that is usually located 18 to 40 nucleotides upstream from the splice acceptor site of an intron (Reed and Maniatis, 1985). We therefore suspect that the expression of this putative leader sequence is the result of an aberrant splicing event utilizing the splice donor and acceptor sites of the putative exon and one of the incomplete branch sites located 21 and 56 nucleotides upstream of this region. This would also be an explanation for the heterogeneity of the 5’-region of the granzyme A cDNA previously reported (Jenne and Tschopp, 1988; Gershenfeld and Weissman, 1986). Notably, cDNAs containing intron-like sequences close to their 5’-ends including in-frame stop codons have also been reported for the human granzyme B (Trapani et al., 1988). However, since the mRNA isolated was shown to start with a donor splice site, this sequence is most probably derived by an incomplete splicing event. The region encoding the active enzyme consists of four exons, i.e., 2, 3, 4, and 5 with 145, 139, 270, and 156 bp, respectively (Fig. 3). Exon 2 encodes 48 amino acids including the putative activation peptide Glu-Arg that is removed prior to formation of the active enzyme. In addition, this exon encodes the first 44 amino acids of

the mature protein, including the histidine residue (His 41) that forms part of the catalytic site. The second amino acid of the catalytic triad, aspartic acid (Asp 85), is encoded by the third exon. The active-site serine residue (Ser 183) is located on the fifth exon. This particular segregation of the three amino acid residues forming the catalytic triad of granzyme A on separate exons is typical of serine proteases (Rogers, 1985). The genomic organization of the granzyme A gene is very similar to that reported for mouse granzymes B, C, and F (Lobe et al., 1988; Jenne et al., 1991), human granzymes B and H (Klein et al., 1989; Meier et al., 1990), and other serine proteinases of hematopoietic cells such as mouse mast cell protease 1 (Huang et al., 1991), rat mast cell protease 2 (Benfey et al., 1987), human cathepsin G (Hohn et al., 1989), and human neutrophil elastase (Takahashi et al., 1988) (Fig. 4). The number of the exons and the splice phase of the introns are identical and the sizes of the corresponding exons (coding parts of exons 1 and 5) are very similar in all these genes. Moreover, the amino acid residues forming the charge relay system, histidine (His 57), aspartic acid (Asp 102), and serine (Ser 195; chymotrypsin nomenclature), characteristic of serine proteinases, are encoded by exons 2,3, and 5, respectively, and are located at similar positions in all genes. These features suggest that these genes may have evolved by duplication from a common ancestral gene (Rogers, 1985).

ORGANIZATION

OF

THE

GENE

Analysis of 5’- and 3’-Regions Flanking the Granzyme A Gene Parts of the regions flanking the granzyme A gene at the 5’- and 3’-ends are shown in Fig. 3. The 5’-promoter region contains several short sequence stretches with similarity to known regulatory elements. A canonical TATA box is present at position 1360 (underlined). The octamer sequence between positions 591 and 598 closely matches the conserved sequence of one of the CAMP-responsive elements (Roesler et al., 1988). The sequence between positions 1123 and 1130 resembles the binding site for AP-1 (Lee et al., 1987) and that between positions 1221 and 1228 resembles the AP-a-responsive element described for the human metallothionein IIA promoter (Mitchell et al., 1987). Furthermore, two sequences with similarity to a T-cell-specific consensus sequence that has initially been described for the interleukin-2 (IL-2) gene (Fujita et al., 1986) are located between positions 667 and 684 and between positions 1369 and 1386. The match-up with the IL-2 consensus is 12/ 18 and 13/18 nucleotides, respectively. The CAMP-responsive element and the AP-2 binding site have also been identified in promoter regions of granzymes B, C, and F. Moreover, the IL-2 consensus sequence is also present in the 5’-regions flanking the granzyme B and C genes but not in that of granzyme F. The AP-1 binding site seemsto be specific for granzyme A among the murine granzymes analyzed so far (Jenne et al., 1991; Lobe et al., 1989). Note that a repetitive sequence, (GT), (GA),, (GT),, is located at position 730 in the granzyme A promoter. A similar repetitive element is present within a region at the 3’-end of the CD3 delta gene that displays a T-cellspecific enhancer activity (Georgopoulos et al., 1988) as well as in the 3’-region of the rat somatostatin gene where it adopts Z-DNA conformation (Hayes and Dixon, 1985). Such DNA conformations have been suggested to be involved in recombination and gene conversion (Shen et al., 1981) and in the regulation of gene transcription as part of enhancer sequences (Nordheim and Rich, 1983). It is therefore possible that this sequence is involved in the regulation of transcription of the granzyme A gene. The biological significance of these putative regulatory elements associated with the promoter region of the granzyme A gene is currently being analyzed. The knowledge of the genomic organization of granzyme A now allows the construction of targeting vectors suitable for inactivation of this enzyme by homologous recombination in uiuo. This approach may help to reveal the precise function(s) of granzyme A in T-cell-mediated processes. ACKNOWLEDGMENTS We thank Drs. P. Angel, R. Kemler, J. Langhorne, P. Nielsen, R. Wallich, and J. Tschopp for helpful discussions and critically reading the manuscript. We also thank U. Hartmann and T. Tran for expert

ENCODING

GRANZYME

507

A

technical assistance. This study was supported in part by grants from the Deutsche Forschungsgemeinschaft (Si 214/i-7 and Kr 931/2-l).

REFERENCES Benfey, P. N., Yin, F. H., and Leder, P. (1987). Cloning of the mast cell protease, RMCP. II. Evidence for cell-specific expression and a multigene family. J. Biol. Chem. 262: 5377-5384. Breathnach, R., and Chambon, P. (1981). Organization and expression of eucaryotic split genes coding for proteins. Annu. Reu. Bio&em. 50:349-383. Caputo, A., Sauer, D. E. F., and Rowe, P. E. (1990). Nucleotide sequence and genomic organization of a human T lymphocyte serine protease gene. J. Immunol. 145: 737-744. Ebnet, K., Chluba-de Tapia, J., Hurtenbach, U., Kramer, M. D., and Simon, M. M. (1991). In uiuo primed mouse T cells selectively express T cell-specific serine proteinase-1 and the proteinase-like molecules granzyme B and C. Znt. Zmmunol. 3: 9-19. Fruth, U., Simon, from a secreted munol.

Sinigaglia, F., M. M. (1987). cloned human by activated 17: 1625-1633.

Schlesier, M., Kilgus, J., Kramer, M. D., and A novel serine proteinase (HuTSP) isolated CD8+ cytolytic T cell line is expressed and CD4+ and CD8’ T lymphocytes. EUF. J. Zm-

Fujita, T., Shibuya, H., Ohashi, T., Yamanishi, K., and Taniguchi, T. (1986). Regulation of human interleukin-2 gene: Functional DNA sequences in the 5’-flanking region for the gene expression in activated T lymphocytes. Cell 46: 401-407. Garcia-Sanz, Nabholz, Zmmunol.

J. A., MacDonald, H. R., Jenne, D. E., Tschopp, J., and M. (1990). Cell specificity of granzyme gene expression. J. 145: 3111-3118.

Garcia-Sanz, J. A., Plaetinck, G.. Velotti, F., Masson, D., Tschopp, J., MacDonald, H. R., and Nabholz, M. (1987). Perforin is present only in normal activated Lyt2+ T lymphocytes and not in L3T4+ cells, but the serine proteinase granzyme A is made by both subsets. EMBO J. 6: 933-938. Georgopoulos, K., van den Elsen, P., Bier, E., Maxam, A., and Terhorst, C. (1988). A T cell-specific enhancer is located in a DNaseIhypersensitive area at the 3’.end of the CD3-6 gene. EMBO J. 7: 2401-2407. Gershenfeld, H. K., and Weissman, for a T cell-specific serine protease

I. L. (1986). Cloning of a cDNA from a cytotoxic T lymphocyte.

Science232:854-858. Haddad, P., Clement, M.-V., Bernard, Sasportes, M., and Mathieu-Mahul, tion of the hCTLA-1 gene encoding 265-271.

O., Larsen, C.-J., Degos, L., D. (1990). Structural organizahuman granzyme B. Gene 87:

Haddad, P., Jenne, D., Tschopp, D., Clement, M.-V., Mathieu-Mahul, D., and Sasportes, M. (1991). Structure and evolutionary origin the human granzyme H gene. Znt. Zmmunol. 3: 57-66.

of

Hameed, A., Lowrey, D. M., Lichtenheld, M., and Podack, E. R. (1988). Characterization of three serine esterases isolated from human IL-2 activated killer cells. J. Zmmunol. 141: 3124-3147. Hayes, T. E., and Dixon, J. E. (1985). gene. J. Biol. Chem. 260: 8145-8156. Hohn, P. A., Popescu, T. J. (1989). Genomic the human cathepsin

Z-DNA

in the rat somatostatin

N. C., Hanson, R. D., Salvesen, G., and Ley, organization and chromosomal localization of G gene. J. Biol. Chem. 264: 13,412-13,419.

Huang, R., Blom, T., and Hellman, L. (1991). Cloning and structural analysis of MMCP-1, MMCP-4 and MMCP-5, three mouse mast cell-specific serine proteases. Eur. J. Zmmunol. 21: 1611-1621. Jenne, D., and Tschopp, J. (1988). Granzymes, a family of serine proteases released from granules of cytolytic T lymphocytes upon T cell receptor stimulation. Zmmunol. Reu. 103: 53-71. Jenne, D. E., Zimmer, M., Garcia-Sanz, J. A., Tschopp, J., and Lichter, P. (1991). Genomic organization and subchromosomal in situ localization of the murine granzyme F, a serine protease expressed in CD8+ T cells. J. Zmmunol. 147: 104551052.

508

EBNET,

KRAMER,

Klein, J. L., Selvakumar, A., Trapani, J. A., and DuPont, B. (1990). Characterization of a novel, human cytotoxic lymphocyte-specific serine protease cDNA clone (CSP-C). Tissue Antigens 35: 220-228. Klein, J. L., Shows, T. B., DuPont, B., and Trapani, J. A. (1989). Genomic organization and chromosomal assignment for a serine protease gene (CSPB) expressed by human cytotoxic T lymphocytes. Genomics 5: 110-117. Krahenbiihl, O., Rey, C., Jenne, D., Lanzavecchia, A., Groscurth, P., Carrel, S., and Tschopp, J. (1988). Characterization of granzymes A and B isolated from granules of cloned human cytotoxic T lymphocytes.J. Immunol. 141:3471-3477. Lee, W., Mitchell, P., and Tjian, R. (1987). Purified tor AP-1 interacts with TPA-inducible enhancer

transcription facelements. Cell 49:

741-752. Lobe, C. G., Shaw, J., Fregeau, C., Duggan, B., Meier, M., Brewer, A., Upton, C., McFadden, G., Patient, R. K., Paetkau, V., and Bleackley, R. C. (1989). Transcriptional regulation of two cytotoxic T lymphocyte-specific serine protease genes. Nucleic Acids Res. 17: 5765-

5779.

J. (1986a). Granesterases. EMBO

Masson, D., and Tschopp, J. (1987). A family of serine esterases in lytic granules of cytolytic T lymphocytes. Cell 49: 679-685. Masson, D., Zamai, M., and Tschopp, J. (1986b). Identification of granzyme A isolated from cytotoxic T-lymphocyte granules as one of the proteases encoded by CTL-specific genes. FEBS Z&t. 208:

84-88. Meier, M., Kwong, P. C., Fregeau, C. J., Atkinson, E. A., Burrington, M., Ehrman, N., Sorensen, O., Lin, C. C., Wilkins, J., and Bleackley, R. C. (1990). Cloning of a gene that encodes a new member of the human cytotoxic cell protease family. Biochemistry 29: 4042-

4049. Mitchell, P. J., Wang, C., and Tjian, R. (1987). Positive regulation of transcription in uitro: Enhancer-binding is inhibited by SV40 T antigen. Cell 50: 847-861. Nordheim, A., and Rich, A. (1983). Negatively virus 40 DNA contains Z-DNA segments within hancer sequences. Nature 303: 674-679. Odake, S., Kam, C.-M., Narasimhan, L., Poe, Krahenbiihl, O., Tschopp, J., and Powers, J. C. murine cytotoxic T lymphocyte serine proteases: with peptide thioester substrates and inhibition and cytolysis by isocoumarins. Biochemistry 30:

SIMON

from granules ficity. J. Biol.

and characterization of inhibitor Chem. 263: 13,215-13,222.

and substrate

speci-

Poe, M., Blake, J. T., Boulton, D. A., Gammon, M., Sigal, N. H., Wu, J. K., and Zweerink, H. J. (1991). Human cytotoxic lymphocyte granzyme B: Its purification from granules and the characterization of substrate and inhibitor specificity. J. Biol. Chem. 266: 98-103. Reed, R., and Maniatis, T. (1985). Intron formation during pre-mRNA splicing. Roesler, W. J., Vandenbark, AMP and the induction Chem. 263: 9063-9066.

sequences involved Cell 41: X-105.

in lariat

G. R., and Hanson, R. W. (1988). Cyclic of eukaryotic gene transcription. J. Biol.

Rogers, J. (1985). Split-gene evolution: Exon shuffling and intron insertion in serine protease genes. Nature 315: 458-459. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). “Molecular Cloning: a Laboratory Manual,” Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:

5463-5467.

Lobe, C. G., Upton, C., Duggan, B., Ehrman, N., Letellier, M., Bell, J., McFadden, G., and Bleackley, R. C. (1988). Organization of two genes encoding cytotoxic T lymphocyte-specific serine proteases CCP I and CCP II. Biochemistry 27: 6941-6946. Masson, D., Nabholz, M., Estrade, C., and Tschopp, ules of cytolytic T lymphocytes contain two serine J. 5: 1595-1600.

AND

and negative protein AP-2

supercoiled transcriptional

simian en-

M., Blake, J. T., (1991). Human and Subsite mapping of enzyme activity 2217-2227.

Podack, E. R., Young, J. D.-E., and Cohn, Z. A. (1985). Isolation and biochemical and functional characterization of perforin 1 from cytolytic T cell granules. Proc. Natl. Acad. Sci. USA 82: 8629-8633. Poe, M., Bennet, C. D., Biddison, W. E., Blake, J. T., Norton, G. P., Rodkey, J. A., Sigal, N. H., Turner, R. V., Wu, J. K., and Zweerink, H. J. (1988). Human cytotoxic lymphocyte tryptase: Its purification

Shen, S., Slightom, J. L., and Smithies, 0. (1981). A history of the human fetal globin gene duplication. Cell 26: 191-203. Simon, H.-G., Fruth, U., Eckerskorn, C., Lottspeich, F., Kramer, M. D., Nerz, G., and Simon, M. M. (1988). Induction of T cell serine proteinase 1 (TSP-l)-specific mRNA in mouse T lymphocytes. Eur. J Immunol. l&855-861. Simon, H.-G., Fruth, U., Kramer, M. D., and Simon, M. M. (1987). A secretable serine proteinase with highly restricted specificity from cytolytic T lymphocytes inactivates retrovirus-associated reverse transcriptase. FEBS Lett. 223: 352-360. Simon, M. M., Hoschiitzky, H., Fruth, U., Simon, H.-G., and Kramer, M. D. (1986). Purification and characterization of a T cell-specific serine proteinase (TSP-1) from cloned cytolytic T lymphocytes. EMBO J. 5: 3267-3274. Simon, M. M., Prester, M., Kramer, M. D., and Fruth, U. (1989). An inhibitor specific for the mouse T cell-associated serine proteinase 1 (TSP.1) inhibits the cytolytic potential of cytoplasmic granules but not of intact cytolytic T cells. J. Cell. Biochem. 40: 1-13. Simon, M. M., Kramer, M. D., Prester, M., and Gay, S. (1991). Mouse T cell-associated serine proteinase 1 degrades collagen type IV: A structural basis for the migration of lymphocytes through vascular basement membranes. Immunology 73: 117-119. Takahashi, H., Nukiwa, T., Yoshimura, K., Quick, C. D., States, D. J., Holmes, M. D., Whang-Peng, d., Knutsen, T., and Crystal, R. G. (1988). Structure of the human neutrophil elastase gene. J. Biol. Chem. 263: 14,739-14,747. Takayama, H., and Sitkovsky, M. V. (1987). Antigen receptor-regu lated exocytosis in cytotoxic T lymphocytes. J. Exp. Med. 166: 725-

743. Trapani, J. A., Klein, J. L., White, P. C., and DuPont, B. (1988). Molecular cloning of an inducible serine esterase gene from human cytotoxic lymphocytes. Proc. Natl. Acad. Sci. USA 85: 6924-6928. Young, J. D.-E., Leong, L. G., Liu, C.-C., Damiano, A., Wall, D. A., and Cohn, Z. A. (1986). Isolation and characterization of a serine esterase from cytolytic T cell granules. Cell 47: 183-194.