Nucleic Acids Research
Volume 4 Number 9 September 1977
Oligonucleotide mapping of non-radioactive virus and messenger RNAs
David Frisby
Imperial Cancer Research Fund Laboratories, P. 0. Box 123, Lincoln's Inn Fields, London, WC2A 3PX, UK
Received 20 July 1977
ABSTRACT A modification of the known method for obtaining radioactive finger prints from non-radioactive nucleic acids by labelling a digest with 5'hydroxyl polynucleotide kinase and [y-3 -ATP has been applied to RNase T1 digests from various high molecular wei,ght virus RNAs and to ovalbumin mRNA. Fractionation of the resultant[32P -labelled T1 RNase digests by two-dimensional polyacrylamide electrophoresis demonstrates that in the case of virus RNAs, the fingerprints thus obtained are very similar to those derived from uniformly labelled RNAs.
P]
The value of this technique is that it requires only 1 - 5 p.g of purified virus RNA and at least three orders of magnitude less radioactivity than is routinely employed in preparing uniformly labelled RNA. INT RODU CTION The mapping of large T1 RNase resistant oligonucleotides by homo-
chromatography and more recently by two-dimensional polyacrylamide gel electrophoresis has greatly facilitated the biochemical analysis of a variety of virion RNA and viral messenger RNAs (mRNA)
1-12 .
In both techniques
the fractionated T1 oligonucleotides are located by autoradiography making the avalibility of highly labelled RNA a pre-requisite. As previously recognised by Szekely and Sanger , however, not all RNAs can be labelled to a high enough level for fingerprinting studies by uniform labelling with
[2P1
orthophosphate in vivo. Some of the major groups of RNA viruses, such as the myxoviruses, paramyxoviruses and several groups of RNA tumour viruses, together with most mRNAs, fall within this Sz~kely Sange13 have demonstrated that and Sanger category. Szekely digests of nonradioactive nucleic acids with a free 5'-OH can be labelled to high specific activity with the aid of polynucleotide kinase using [-32P] ATP as carrier-free
C Information Retrieval Limited 1 Falconberg Court London W1 V 5FG England
2975
Nucleic Acids Research Although this technique has been used successfully to label RNase T1 oligonucleotides,of tRNA and 18S ribosomal RNA,of short and intermediate lengthl3 l4 l5 16 l7 and more recently to label viroid RNAs2,
phosphate donor.
it has not been used to study high molecular weight RNAs such as virus and
mRNAs. In this paper a modification of the Szekely and Sanger technique using
commercially available polynucleotide kinase and
[y-32]
ATP has been
employed to label T RNase digests of microgram amounts of RNA from two picornaviruses and from two serotypes of vesicular stomatitis virus (VSV).
The large oligonucleotides present in each preparation were resolved by two dimensional polyacrylamide gel electrophoresis ' and the resultant maps compared with those given by T1 digests of the corresponding uniformly
labelled virus RNA. The fingerprints obtained using the kinase technique gave essentially the same characteristic pattern of large T1 oligonucleotides as that given by T1 digests of uniformly labelled RNAs.
Some obvious
differences between the fingerprints obtained using the two labelling techniques were apparent, however, possibly due to some preferential activity
of the polynucleotide kinase enzyme.
successfully applied also to RNase From this
study
T1
The kinase technique has been
digests of ovalbunmin mRNA.
it is evident that PNK-
[-32 P]
ATP
labelling P
allows a reduction of several orders of magnitude in the amount of
required for the analysis of T1 digests of large molecular weight RNAs. Furthermore the technique should prove useful in the analysis of other high molecular weight virus RNAs and mRNAs that hitherto have been difficult to label to sufficient specific activity in vivo.
MATERIALS AND METHODS Viruses Encephalomyocarditis virus (EMC) and bovine enterovirus strain VG-5-27 (BE) (from the same stock used in previous studies '
2'
) were
propagated at 37°C, in Krebs ascites cells and BHK 21 cells, respectively, 20 . as described in detail previously 19, The New Jersey and Indiana serotypes of vesicular stomatitis virus (VSV),obtained originally from Dr. C.
Pringle, Institute of Virology, Glasgow, were both grown at 32°C in 2976
Nucleic Acids Research Eagle's medium on monolayers of Vero cells
Preparation and purification of non-radioactively labelled virus EMC and BE virus. EMC virus was purified according to Frisby, Cotter 22 23 and BE according to Brown and Cartwright and Richards VSV serotypes. The VSV serotypes were prepared and purified as described
below for uniformly
P - labelled VSV.
Preparation and purification of uniformly labelled EMC and BE virus.
Uniformly
P-labelled EMC and BE virus were
prepared and purified as described previously VSV serotypes.
P - viruses
5'19,209
Monolayers of about 2 x 10 Vero cells in 90 mm plates
(Nunclon) were infected at 1 p.f.u. /cell with the New Jersey or Indiana serotype of VSV in 2. 0 ml of complete phosphate buffered saline (PBS) containing 1% (v/v) foetal calf serum. After adsorption for 60 min at 32°C, the monolayers were washed and then finally overlaid with 4. 0 ml of phosphate-
free Eagle's medium supplemented with 5% (v/v) FCS. incubated at 32°C until 1 h post-adsorption when
[2P]
The cells were
orthophosphate
(Radiochemical Centre, Amersham, Bucks, U.K.) was added to a final concentration of 250 1Ci/ml. The incubation was then continued overnight at 32°C.
Overnight harvests from both
P-labelled VSV serotypes were
centrifuged at 12, 000 g for 10 min and the virus pelleted from the supernatant at 100, 000 g for 1 h. The virus pellets were resuspended in 0.02 M TrisHC1 pH 7. 5, 0.10 M NaCl, 0.001 M EDTA (TNE pH 7. 5) layered on to 5. 0
ml 20-60% (w/w) linear sucrose gradients (in TNE pH 7. 5) and the gradients centrifuged at 270, OO0g for 1.5 h. at 2°C. The gradients were fractionated into 0. 5 ml fractions and 20 ILl aliquots taken into 5.0 ml Aquasol (New England
Nuclear). Radioactivity was determined in a Packard Tri-Carb scintillation counter.
Preparation of virus RNAs Both labelled and unlabelled virus RNAs were prepared in the same manner. Pooled peak fractions from sucrose gradients were made 1.
0%(v/v)
with SDS, extracted three times with phenol/chloroform/isoamylalcohol
(50: 50: 1, PCI) and twice with chloroform/isoamylalcohol (50: 1, CI) alone. Carrier RNA (tRNA, 10 F±g/ml, BDH, Poole, Dorset, U.K.) was added to 2977
Nucleic Acids Research the aqueous phase of
P-labelled RNAs before precipitation with 2.5
volumes of cold ethanol in the presence of 0.1M sodium acetate. Unlabelled
RNAs (at>2 Fig/ml) were precipitated in the absence of any carrier tRNA.
Precipitation was at -20°C overnight or (in the case of low RNA concentration at -70°C for at least 1 h). The precipitated RNA was finally collected by centrifugation at 20, 000 g for 20 min and dried in vacuo. T RNase digestion of uniformly labelled 1
P-RNAs
P-labelled virus RNA precipitates were resuspended in 20 ,ul 0. 02 M Tris-HCl pH 7. 5, 0. 002M EDTA, 5p.l of T RNase (Sankyo, Japan, 1 mg/ml) added to give a final enzyme: substrate ratio of 1: 20 and the solution incubated in a sealed capillary for 40 min at 37°C. The samples were then dried in vacuo, resuspended in 12 p1 9 M urea plus 8 ±L1 tracker
dye (50% sucrose, 5 M urea, 0.2% (w/v) bromo-phenol blue, 0.2% (w/v) xylene cyanol), and 15 p.1 of this sample applied to the first dimension of the two dimensional gel.
Ribonuclease T and bacterial alkaline phosphatase digestion of unlabelled RNAs Unlabelled RNA precipitates (in 5 p.g aliquots) for the kinase reaction were resuspended in 5 p.1 of 0.02 M Tris-HCl pH 7. 8, 2.5 p.1 of
T1 RNase
(0.1 mg/ml enzyme : substrate ratio 1: 20) and 1. 0 .1l of bacterial alkaline phosphatase (BAP. FS, Worthington Biochemical Corporation, 0.1 mg/ml; enzyme : substrate ratio 1: 50) added and the mixture incubated for 40 min at 37°C. The reaction was stopped by diluting to 200
.l with 0. 2
M NaCl,
1% SDS and extracting the T1/BAP. FS digest three times with PCI and twice with CI. The extractions were performed in Beckman microfuge tubes
with'-10 sec. spins in the Beckman microfuge to separate the phases. The aqueous phase was finally lyophilised.
5'-terminal labelling of T1 oligonucleotides Polynucleotide kinase (P-L Biochemicals) was used in all the experiments described in this study. This commercial preparation contains contaminating levels of RNase, a problem which was overcome in this study by the use of short incubation periods together with the inclusion of a polyamine
2978
The use of ribonuclease-free polynucleotide kinase,whenever
Nucleic Acids Research possible, is strongly recommended ' 32 [Y- PJ ATP (20p.Ci, specific activity>7, 000 CGmmcale,New England Nuclear Corporation)was lyophilised from 100 p1 aliquots of distilled water three times before resuspension in 33 p1 of denaturation buffer (5 mM Tris pH
7.4, 0.01 mM EDTA 3Na, 0.2mM spermidine).
Lyophilised T and BAP.
FS digests (5 p.g) of RNAs were resuspended in 10 .1l of denaturation buffer,
heated in sealed capillaries for 10 min at 85°C and immediately chilled in ice-water. The RNA digest was then added, together with 5 .1l of 10 x kinase
buffer (0.5M Tris-HCl pH 7.4, 0.1M MgCGl, 0. 05 M dithiothreitol, 50%
32~~~~~~~
glycerol) to the [y- P] ATP which had been transferred to a Beckman microfuge tube. The reaction was started by the addition of 2 p.1 of polynucleotide kinase (1 unit/ ,uld, P-L Biochemicals Ltd), to the centre of the reaction mix making a final reaction volume of 50 p.1. Incubation was for 4 min. at 370C. The reaction was terminated by the addition of 100 1l1, 1 M ammonium acetate, 10 p.1 10% (w/v) SDS and 20 p.1 0.1 M EDTA. After mixing well with the aid of a vortex mixer and centrifuging (~5 sec) in the Beckman microfuge, 10 .1l of tRNA 10 mg/ml BDH Ltd., Poole, Dorset) was added as carrier. The solution was then extracted three times with PCI and twice with CI before precipitation of the aqueous phase with 2. 5 volumes of absolute alcohol in the presence of 0.1 M sodium acetate. Samples were left at -20°C
overnight or for 1 h at -70°C to allow full precipitation of the T1 oligonucleotides before lyophilisation. The samples were finally resuspended in 12 p1 9 M urea plus 8 p.1 tracker dye in preparation for two-dimensional gel
electrophoresis. Two-dimensional polyacrylamide gel electrophoresis of oligonucleotides Two-dimensional polyacrylamide gel electrophoresis was performed 18 5 using the method of De Wachter and Fiers as modified by Frisby et al.,
Samples were heated for 1 min at 600C in 6M urea before application to the first dimension gel in order to eliminate any possible annealing or aggrega5 tion. Autoradiography was performed as described by Frisby et al., Autoradiography was usually for 6 h in the case of PNK [2P-] ATP labelled preparations compared with 24 h for in vivo labelled preparations.
2979
Nucleic Acids Research RESULTS
Fingerprints of picornavirus RNA EMC As may be seen from Fig. 1 the fingerprint obtained by labelling a cold T /BAP. FS digest of EMC-RNA with ATP and polynucleotide 1 kinase (PNK, Fig. la and c) is very similar to that obtained from a T1 digest of uniformly labelled EMC-RNA (Fig.lb and d). It is apparent, how-
[y-32
ever, that although qualitatively similar, there are quantitative differences between the fingerprints obtained by the two methods. For example, it is clear that oligonucleotides 1 (the poly
C-tract), 14 and 29 give spots of low
intensity. One qualitative difference was evident also, namely the appearance of an oligonucleotide, with a mobility between that of oligonucleotides 4 and 10, in the kinase labelled preparation that has not previously been encountered on a routine basis in uniformly labelled preparations. BE
[y- 3] ATPof a uniformly-
A comparison of the fingerpint obtained from a PNK -
labelled
T1 and BAP.FS digest (a, c) of BE-RNA with that labelled TIdigest (b, d) is shown in Fig. 2. In the case of this
picornavirus RNA the quantitative differences between the two fingerprinting techniques are more apparent than with EMC RNA and oligonucleotides 4, 5, 6, 7, 8, 11, 20, 30 and 33 have been poorly phosphorylated (oligonucleotide 6 being only visible upon direct exanmination of the autoradiograph). Qualitative differences are evident between the comparative fingerprints of BE-RNA also, oligonucleotides 1, 13 and 31 being completely absent from the kinase labelled
fingerprint. Oligonucleotide 10 (see Fig. 2c) appears to have run differently in the in vitro labelled
preparation. Again several additional spots, not
present in fingerprints of in vivo labelled BE-RNA were observed in the endlabelled preparation. Such additional spots are indicated in Fig. 2c by single hatching.
Fingerprints of VSV-RNAs VSV Indiana serotype
Figure 3 shows fingerprints of a cold VSV Indiana serotype RNA 2980
Nucleic Acids Research preparation digested with T RNase/BAP. FS and phosphorylated with poly-
nucleotide kinase (Fig. 3a) and of a RNase
T1-digest
of uniformly labelled
RNA preparation (Fig. 3b) together with direct tracings of the respective autoradiographs (Fig. 3c and 3d). Upon close examination it is evident that most of the characteristic T1 products labelledwith PNK-
[y-32P]
ATP
present in the fingerprint shown in Figs. 3a and 3c have migrated to approx-
imately the same position as their counterparts in the fingerprint of in vivo
(Fig. 3b and 3d). Several oligonucleotides (namely spots 3, 8,15,17,18, 20, 21, 36 and 38) have been poorly phosphorylated in the PNK- [y-32] ATP preparation and oligonucleotide 27 appears to labelled
T1 oligonucleotides
remain unphosphorylated.
VSV New Jersey serotype
Comparative fingerprints of a PNK- [y- 32] ATP labelled T1/BAP. FS digest of VSV New Jersey serotype RNA (a, c) and of a uniformly-labelled T1 digest (b, d) are shown in Fig. 4. Although detailed scrutiny reveals that the fingerprints obtained by the two different approaches are qualitatively similar, quantitative differences due to incomplete phosphorylation of several nucleotides (namely, 2, 5, 6, 8,11, 22, 31, and 32)in the PNK - [y-32
ATP preparation are again evident. Furthermore, three oligonucleotides present in the fingerprint of in vivo labelled VSV New Jersey serotype RNA
(Fig. 4b and d) are completely absent from the in vitro preparation (spot numbers 1,18 and 29 Fig. 4a and c). It would also appear that there is some discrepancy in the area of spot 23. The in vivolabelledT fingerprints of the two VSV serotypes studied
(Indiana and New Jersey) are, as might be expected, easily distinguishable from one another. Several characteristic T1 oligonucleotides from their position on the fingerprint alone, could possibly be common to both the New Jersey and Indiana serotypes. Further analysis by pancreatic digestion of the in vivo products and/or partial digestion with snake venom phospho-
diesterase of the in vitro products would be necessary, however, to confirm that these oligonucleotides are indeed common to both the VSV serotypes
studied.
2981
Nucleic Acids Research
,a. ...
lst
i2nd
.
a
.b .:
1 C.
V
02 03
04
Il8%C07 120 l 108
21
130
D1 18
325~
09
23 15
2712614 \ 016 190 22 3&
36
1
4
33r"\
Autoradiographs of bidimensional polyacrylamide gels of the ribonuclease T oligonucleotides o0 f MC-RNA labelled (a) in vitro with PNK Tracings of the and [y- P] AT (b) in vivo with lP1 - orthophosphate. top half of the autoradiographs are shown in (c) and (d) to provide a guide for comparison. The numbers refer to those oligonucleotides that have previously been subjected to RNase A digestion5 with the exception of spots 37-45. Oligonucleotides in (c) marked 0 are common to both fingerprints; Figure 1.
0, 2982
are those that have been incompletely phosphorylated in the
PNK-+-
Nucleic Acids Research ! ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~~~~~~~~ ~ .' .. ''
~.
. . .:
'' g.~~~~~~~~~~~~~ ~~~~~~~ :'~~~~~~~~~~~~~~~~~~~~.. ....:: ..*. . .. ..:.
:.:
.:.
...:. I:
d. 0D 2
03 C D04
121110 o 00 12
8
8 09 07 0 23°
320~~~~~3 1831 309
21
1
-
-
32P7JATP reaction; *, those that appear in the fingerpint of in vitro labelled reaction but are absent from the in vivo labelled fingerprint and @ those that are present in the uniformly labelled fingerprint but which appear to be completely absent from the fingerprint of in vitro labelled T1 oligonucleotides. The origin ( 0) is at the top left hand corner and the arrows indicate the direction of electrophoresis. The streak is the heterogeneous poly (A) tract described previously5' 6. 2983
Nucleic Acids Research
O
a.,
t
__e*
2nd
4..*
*. ..w.. .......
....... 0
At
C.
9
IQ
g 4
012
3
o
a
10
o 90
It
11
?7 c18*
8 13 14 1 13 14 15c
20
1g26S
24S
2
18
29
0022332CD3 40 ~~31
Figure 2. Autoradiographs of bidimensional polyacrylamide gels of the ribonuclease T oligonucleotides of BE-RNA. The assignments of (a), (b), (c) and (d) and other details are as given in Figure 1. The numbers have 2984
Nucleic Acids Research
U:.
a
I
d 2
c.)1
0)
3
0
6
C
5 4 0
1020
22 210
14 ° 23
been assigned arbitrarily to aid in comparison of the fingerprints. The key to the shaded spots in (c) is given in the legend to Figgre 1. The streak is the heterogeneous poly (A) tract described previously . 2985
Nucleic Acids Research
--.
a.
1 St
01
2nd:.:
Go
60 180 29 26 7019 06280°
r
120 130
36@
0o3034 33C 035
Figure 3. Autoradiographs of bidimzensional polyacrylamide gels of the ribonuclease T1 oligonucleotides of VSV Indiana RNA. Assignments of (a), 2986
Nucleic Acids Research
0-
:
..
0
.::*:
0
-2.L
0:
:'WI Am
4:
I
0
2
. . .:0, 1. .
d
0 14
3
4 C15
°17 60
018
70 190 9 ,8
0::
120 130
29 26
2728 CR38
200 24 ,K25ti39 210 GYi:3140 374 22zc923
36
030 031
Q3234 33c2'~ 035
(b), (c) and (d), the convention for shading of the spots in (c)and other details are as given in the legend to Figure 1.
2987
Nucleic Acids Research
-i
O
-
a.
1st
2nd
.1..
Co Is2 *
30
14
01663 22030 170 ¶72°631 280
1118 0 29*0Qz: _8 12D 190 025 6
70
8*
130
0032
34c~,~33
260
200 Figure 4. Autoradiographs of bidimensional polyacrylamide gels of the ribonuclease TI oligonucleotides of VSV New Jersey RNA. Assignments 2988
of
Nucleic Acids Research -
0w
,mw.w:=,-
r
jmm. 11,.W
11 T:- !I:
d
2
OS 3
)14
9C-) conV 40 sQ 68022 10 15
7
24
5 0U~11
07
eQ
12
1
130
18
29
3
4033
0 2
26
200 (a), (b), (c) and (d), the convention for shading of the spots in (c) and other detials are as given in the legend to Fig.l. 2989
Nucleic Acids Research Fingerprint of ovalbumin mRNA Ovalbumin mRNA was subjected to combined T RNase and BAP. FS
digestion, labelled in vitro with
[y32PJ
ATP and PNK and the labelled
digest fractionated by bidimensional polyacrylamide gel electrophoresis as described in the Methods section. Figure 5 shows a photograph of the result-
ant autoradiograph. The complexity of the fingerprint is that expected of a molecule of molecular weight approximately 650, 000
with several oligo-
nucleotides (.15) in the 10-25 nucleotide size range. The longest oligonucleotide is estimated, from its position on the gel, to be about 30 nucleotides in length.
2nd--_----------- 1St
2nd
.-1
4" *
Figure 5. Autoradiograph. of a bidimensional polyacrylamide gel fractionation of the T RNase oligonucleotides of ovalbumin mRNA labelled in vitro by the PNK- -3 2ATP method. The origin and directions of electrophoresis are as given in the legend to Fig. 1. 2990
Nucleic Acids Research DISCUSSION In this paper the potential usefulness of the in vitro phosphorylation
for obtaining fingerpints of high molecular weight virus and messenger RNAs has been explored. Virus RNAs that
technique of Szekely and Sanger
label to high specific activity in vivo were .chosen for this study so that
fingerprints obtained using the in vitro labelling technique could be compared directly with those derived from uniformly labelled RNAs. vitro phosphorylation technique the
y3
P]from
[y-32]
In the in
ATP is enzymatic-
ally transferred to free 5' hydroxyl groups of unlabelled oligonucleotides
(derived from a combined T RNase and bacterial alkaline phosphatase digest) with the aid of polynucleotide kinase from T4- 'phage infected E. coli Successful application of this technique would allow fingerprint and at least partial sequence analysis of RNAs from human influenza virus strains,
measles virus, various retroviruses and also mRNAs, all of which are
insufficiently labelled in vivo and/or subject to limited availability.
Fingerprints were prepared from T RNase/BAP.FS digests of two picornavirus RNAs and the RNAs of two VSV serotypes using the in vitro ~~~~~13 phosphorylation method of Szekely and Sanger and compared with fingerprints of uniformly labelled T digests of the corresponding RNAs in vivo. The comparison demonstrated that the in vitro labelling technique yielded representative T fingerprints thus providing an economical yet efficient
fingerprints of high molecular weight RNAs. As a few differences were encountered in some preparations,however, it would
way of preparing
T1
seem advisable, where possible, to obtain an in vivo labelled
T1
fingerprint
as a guideline in the first instance. The in vitro phosphorylation technique, as described in this paper, has been successfully applied also to two other
enterovirus RNAs namely poliovirus and swine vesicular disease virus (T.Harris, personal communication). In each case the pattern of large characteristic T oligonucleotides obtained was indistinguishable from the pattern derived from digestion of the uniformly labelled RNA. It is also of crucial importance when employing this technique to use RNA of the highest purity and structural integrity and to ensure that any RNase activity contaminating the PNK enzyme is removed or inactivated.
2991
Nucleic Acids Research The quantitative differences (judged by the lack of corresponding intensity of spots from one fingerprint to another) noted between T1 oligonucleotide maps derived from in vitro and in vivo labelling are presumably due to incomplete phosphorylation of several oligonucleotides by the PNK enzyme. The reasons for this are unclear, however, it is evident from the
random distribution of the incompletely phosphorylated oligonucleotides on
the fingerprints that the effect is not related to size or base composition. The possible effect of secondary structure of the RNA in this respect cannot be discounted but would appear remote as (i) some quite short oligonucleotides are effected and (ii) the phosphorylation is performed after heating the RNA at 850C for 10 min in denaturation buffer. Qualitative differences between fingerprints obtained from T RNase digests labelled in vitro and
those derived from digests of uniformly labelled RNA were less frequent than quantitative differences but, nevertheless, regularly occurred. The
reason(s) for these discrepancies again are unclear although preferential activity of the PNK enzyme, incompletedephosphorylation and blocking of the 5' hydroxyl are all possibilities. In the case of BE-RNA, three oligonucleotides (marked 1, 13 and 31 remain totally unphosphorylated in the PNK-
[y-32P]
-ATP reaction. In a
previous study one of these (marked 1) had been shown to have a base composition inconsistent with its position in the two-dimensional gel 5 . The reason for the anomalous migration of this oligonucleotide was not clear at that time. Recently, however, both Lee et al.}
and Flanagan et al., have reported that the 5' terminus of poliovirion RNA is blocked with a protein. Furthermore Flanagan et al.2 demonstrated that treatment of
virion RNA with T RNase alone generated a proteinase K-sensitive oligo1 ribonucleotide of the structure,protein - pUUAAAACAG. The composition 5 of the 1 of BE-RNA is 1
anomalously migrating spot
AAAAC, lAG, 2-3U
the exact composition expected from a pancreatic RNase digestion of the blocked 5' terminal T RNase oligonucleotide of poliovirion RNA. It is proposed, therefore, that oligonucleotide 1 is the blocked 5' terminal T RNase oligonucleotide of BE-RNA and that it is identical to the 5'-terminal
T1 oligonucleotide of poliovirion RNA. The fact that this oligonucleotide is not phosphorylated with polynucleotide kinase would then be explained by the 2992
Nucleic Acids Research presence of a blocked 5' hydroxyl. The lack of in vitro phosphorylation of
oligonucleotides 13 and 31 of BE-RNA and of various other EMC and VSV
oligonucleotides (see above) cannot be so readily explained.
Poor phosphor-
ylation of the poly C tract of EMC-RNA would not appear to be due to its homopolymeric nature since synthetic poly r C alone is labelled to the expect-
ed extent (unpublished observations). Some fingerprints obtained by the in vitro labelling method consistently yielded one or more additional spots. Similar observations were noted
by Szekely and Sanger
and these authors comments apply equally to this
study. It is also feasible that trace levels of contaminating RNA could
contribute T RNase oligonucleotides which are preferentially phosphorylated. It would seem unlikely that such additional spots are due to T 1RNase
overdigestion as similar spots have not been observed in in vivo
P prep-
arations even when picornavirus RNAs have been digested to completion.
oligonucleotide map of ovalbumin mRNA obtained by the PNK- [y-32] ATP technique has the expected complexity of an RNA of~ 1900 nucleotides in length with at least 15 large characteristic oligoThe
T1
nucleotides. From its position on the two-dimensional gel the spot marked with an arrow in Figure 5 possibly represent the run
5, UUCCUUUAAUCAUAAUAAAAACAUGp 3, 8 32 present in the 3' sequence of ovalbumin mRNA as determined by Cheng 28 27 have also published a T oligonucleotide map of et al. . Woo et al. ovalbumin mRNA. These authors used in vitro labelling with
I and
fractionated the oligonucleotides using homochromatography. It is difficult,
therefore, to make any direct comparison of the two T maps. Furthermore, I-fingerprints are difficult to interpret and hence of somewhat limited 29 use as has been discussed previously by other authors . Iodination of RNA also requires more than a 5-fold greater amount of RNA together with a
200-fold greater amount of radioactivity to obtain specific activities of the same order of magnitude as that produced by in vitro phosphorylation with
polynucleotide kinase. The advantage of the Szekely and Sanger technique is that it allows further analysis by sequence determination with the aid of 2993
Nucleic Acids Research partial snake venom phosphodiesterase digestion.
Another approach to fingerprinting and sequence analysis of mammalian mRNAs and other polyadenylated RNAs that are difficult to label efficiently in vivo has been used by Marrotta et al., and by Paddock et al.,31
Complementary DNA (cDNA) is synthesized using the RNA-directed DNA polymerase from avian myeloblastosis virus and oligo (dT) as primer. The cDNA is then used as a template for in vitro RNA synthesis with E. coli RNA polymerase and highly P-labelled nucleoside triphosphate precursors. The radioactive RNA transcript, after nuclease digestion, is further fractionated and analysed in an identical fashion to uniformly labelled RNA.
This approach, apart from being rather involved and time-consuming,
suffers from the disadvantage that, although the cDNA would appear to be a faithful copy of the polyadenylated RNA, in some instances only certain regions of cDNA are transcribed by the E. coli polymerase . Direct sequencing of the cDNA using the new DNA sequencing techniques 32'
however, would circumvent this problem. In conclusiorL, the in vitro labelling of large T1 oligonucleotides
from virus and mRNAs with the aid of polynucleotide kinase and [y-32] ATP provides, with the provisos discussed above, several advantages over alternative methods of fingerprinting and/or sequencing RNAs which are
inefficiently or inadequately labelled in vivo.
ACKNOWLEDGEMENTS I am grateful to Dr. E. Humphries for help with the polynucleotide
kinase method and to Dr. T. Harris for the communication of results con-
cerning the application of the technique described in this paper to other picornavirus RNAs. The two-dimensional polyacrylamide gel analyses were performed in the laboratory of Dr. P. Fellner (Searle Research Lab-
oratories) and I thank Dr. J. Smith and Mr. C. Newton for help with some of these analyses. I am also indebted to Dr. T. Harris for the provision of
purified BE-RNA and to Dr. M. Doel for the provision of purified ovalbumin mRNA. Mr. P. Bennett provided excellent technical assistance during the preparation and purification of the VSV serotypes. I should also like to
2994
Nucleic Acids Research express my gratitude to Drs. B. Griffin, P. Fellner and R. Weiss for
reviewing the manuscript and for their encouragement throughout this work. *
On leave of absence from Searle Research Laboratories, Lane End Road, High Wycombe, Bucks, UK REFERENCES
1. 2.
3.
4. 5.
6. 7.
Billeter, M.A., Parsons, J.T. and Coffin, J.M. (1974) Proc.Natl. Acad.Sci. USA 71, 3560-3564. Joho, R.H., Billeter, M.A., and Weissman, C. (1975)Proc.Natl. Acad.Sci.USA 72, 4772-4776. Wang, L.H., Duesberg, P., Beemon, K. and Vogt, P.K. (1975) J.Virol. 16, 1051-1070. Coffin, J.M. and Billeter, M.A. (1976) J.Mol.Biol. 100, 293-318. Frisby, D .P., Newton, C., Carey, N.H., Fellner, P., Newman, J.F.E., Harris, T.J.R. and Brown, F. (1976) Virology 71, 379-388. Frisby, D.P., Smith, J., Jeffers, V. and Porter, A.G. (1976) Nucleic Acids Research 3, 2789-2809. Lee, Y.F. and Wimmer, E. (1976) Nucleic Acids Research 3
1647-1658. 10. 11.
Harris, T.J.R. and Brown, F. (1976) J.gen.Virol. 33, 493-501. Kennedy, S.I.T. (1976) J.Mol.Biol. 108, 491-511. Harris, T.J.R. and Brown, F. (1977) J.gen.Virol. 34, 87-105. Harris, T.J.R., Doel, T.R. and Brown, F. (1977) J.gen.Virol. 35,
12.
299-315. Wengler, G., Wengler, G. and Filipe, A.R. (1977) Virology 78,
8. 9.
124-134. 13. 14. 15.
16. 17. 18. 19.
20. 21.
22. 23. 24.
Sz6kely, M. and Sanger, F. (1969) J.Mol.Biol. 43, 607-617. Simsek, M., Ziegenmeyer, J., Heckman, J. and Raj Bhandary,U.L. (1973) Proc.Natl.Acad.Sci.USA 70, 1041-1045. Simsek, M., Raj Bhandary, U.L. Boisnard, M., and Petrissant, G. (1974) Nature 247, 518-520. Szeto, K.S. and Soll, D. (1974) Nucleic Acids Research 1, 1733-1738. Fuke, M. and Busch, H. (1977) Nucleic Acids Research 4, 339-352. DeWachter,R., and Fiers, W. (1972) Analyt.Biochem. 49, 184-197. Porter, A.G., Carey, N.H. and Fellner, P. (1974) Nature 248, 675-678. Brown, F., Newman, J., Stott, J., Porter, A., Frisby, D., Newton, C., Carey, N. and Fellner, P. (1974) Nature 251, 341-344. Earley, E., Peralta, P.H. and Johnson, K.M. (1967) Proc.Soc.Exp. Biol.Med. 125, 741-747. Frisby, D., Cotter, R. and Richards, B. (1977) J.gen.Virol. In Press. Brown, F. and Cartwright, B. (1963) Nature, London 19 1168-1170. Panet, A., van de Sande, J.H., Loewen, P.C., Khorana, H.G., Raae, A. J., Lillehaug, J.R. and Kleppe, K. (1973) Biochemistry, 12, 5045-5050. 2995
Nucleic Acids Research 25.
26. 27.
28. 29. 30. 31.
32. 33.
2996
Lee, Y.F., Nomoto, A., Detjen, B.M. and Wimmer, E. (1977) Proc.Natl.Acad.Sci.USA 74, 59-63. Flanagan, J.B., Pettersson, R.F., Ambros,V., Hewlett, M.J., and Baltimore, D. (1977) Proc.Natl.Acad.Sci.USA 74, 961-965. Woo, S.L., Rosen, J.M., Liarakos, C.D., Choi, Y.C., Busch, H., Means, R., O'Malley, B.W. and Robberson, D.L. (1975) J.Biol. Chem. 250, 7027 -7039. Cheng, C.C., Brownlee, G.G., Carey, N.H., Doel, M.T., Gillam, S., and Smith, M. (1976) J.Mol.Biol. 1Q7, 527-547. Gross, H.J., Domdey, H. and Sanger, H.L. (1977) Nucleic Acids Research 4, 2021-2028. Marotta, C.A., Forget, B.G., Weissman, S.M., Verma, I.M., McCaffrey, R.P. and Baltimore, D. (1974) Proc.Natl.Acad.Sci.USA 71, 2300-2304. Paddock, G.V., Ponn, R., Heindell, H.C., Isaacson, J., and Salser, W. (1977) J.Biol.Chem. 252, 3446-3458. Sanger, F. and Coulson, A.R. (1975) J.Mol.Biol. 94, 441-451. Maxam, A.M. and Gilbert, W. (1977) Proc.Natl.Acad.Sci.USA 74, 560-564.
Volume 4 Number 9 September 1977
Oligonucleotide mapping of non-radioactive virus and messenger RNAs
David Frisby
Imperial Cancer Research Fund Laboratories, P. 0. Box 123, Lincoln's Inn Fields, London, WC2A 3PX, UK
Received 20 July 1977
ABSTRACT A modification of the known method for obtaining radioactive finger prints from non-radioactive nucleic acids by labelling a digest with 5'hydroxyl polynucleotide kinase and [y-3 -ATP has been applied to RNase T1 digests from various high molecular wei,ght virus RNAs and to ovalbumin mRNA. Fractionation of the resultant[32P -labelled T1 RNase digests by two-dimensional polyacrylamide electrophoresis demonstrates that in the case of virus RNAs, the fingerprints thus obtained are very similar to those derived from uniformly labelled RNAs.
P]
The value of this technique is that it requires only 1 - 5 p.g of purified virus RNA and at least three orders of magnitude less radioactivity than is routinely employed in preparing uniformly labelled RNA. INT RODU CTION The mapping of large T1 RNase resistant oligonucleotides by homo-
chromatography and more recently by two-dimensional polyacrylamide gel electrophoresis has greatly facilitated the biochemical analysis of a variety of virion RNA and viral messenger RNAs (mRNA)
1-12 .
In both techniques
the fractionated T1 oligonucleotides are located by autoradiography making the avalibility of highly labelled RNA a pre-requisite. As previously recognised by Szekely and Sanger , however, not all RNAs can be labelled to a high enough level for fingerprinting studies by uniform labelling with
[2P1
orthophosphate in vivo. Some of the major groups of RNA viruses, such as the myxoviruses, paramyxoviruses and several groups of RNA tumour viruses, together with most mRNAs, fall within this Sz~kely Sange13 have demonstrated that and Sanger category. Szekely digests of nonradioactive nucleic acids with a free 5'-OH can be labelled to high specific activity with the aid of polynucleotide kinase using [-32P] ATP as carrier-free
C Information Retrieval Limited 1 Falconberg Court London W1 V 5FG England
2975
Nucleic Acids Research Although this technique has been used successfully to label RNase T1 oligonucleotides,of tRNA and 18S ribosomal RNA,of short and intermediate lengthl3 l4 l5 16 l7 and more recently to label viroid RNAs2,
phosphate donor.
it has not been used to study high molecular weight RNAs such as virus and
mRNAs. In this paper a modification of the Szekely and Sanger technique using
commercially available polynucleotide kinase and
[y-32]
ATP has been
employed to label T RNase digests of microgram amounts of RNA from two picornaviruses and from two serotypes of vesicular stomatitis virus (VSV).
The large oligonucleotides present in each preparation were resolved by two dimensional polyacrylamide gel electrophoresis ' and the resultant maps compared with those given by T1 digests of the corresponding uniformly
labelled virus RNA. The fingerprints obtained using the kinase technique gave essentially the same characteristic pattern of large T1 oligonucleotides as that given by T1 digests of uniformly labelled RNAs.
Some obvious
differences between the fingerprints obtained using the two labelling techniques were apparent, however, possibly due to some preferential activity
of the polynucleotide kinase enzyme.
successfully applied also to RNase From this
study
T1
The kinase technique has been
digests of ovalbunmin mRNA.
it is evident that PNK-
[-32 P]
ATP
labelling P
allows a reduction of several orders of magnitude in the amount of
required for the analysis of T1 digests of large molecular weight RNAs. Furthermore the technique should prove useful in the analysis of other high molecular weight virus RNAs and mRNAs that hitherto have been difficult to label to sufficient specific activity in vivo.
MATERIALS AND METHODS Viruses Encephalomyocarditis virus (EMC) and bovine enterovirus strain VG-5-27 (BE) (from the same stock used in previous studies '
2'
) were
propagated at 37°C, in Krebs ascites cells and BHK 21 cells, respectively, 20 . as described in detail previously 19, The New Jersey and Indiana serotypes of vesicular stomatitis virus (VSV),obtained originally from Dr. C.
Pringle, Institute of Virology, Glasgow, were both grown at 32°C in 2976
Nucleic Acids Research Eagle's medium on monolayers of Vero cells
Preparation and purification of non-radioactively labelled virus EMC and BE virus. EMC virus was purified according to Frisby, Cotter 22 23 and BE according to Brown and Cartwright and Richards VSV serotypes. The VSV serotypes were prepared and purified as described
below for uniformly
P - labelled VSV.
Preparation and purification of uniformly labelled EMC and BE virus.
Uniformly
P-labelled EMC and BE virus were
prepared and purified as described previously VSV serotypes.
P - viruses
5'19,209
Monolayers of about 2 x 10 Vero cells in 90 mm plates
(Nunclon) were infected at 1 p.f.u. /cell with the New Jersey or Indiana serotype of VSV in 2. 0 ml of complete phosphate buffered saline (PBS) containing 1% (v/v) foetal calf serum. After adsorption for 60 min at 32°C, the monolayers were washed and then finally overlaid with 4. 0 ml of phosphate-
free Eagle's medium supplemented with 5% (v/v) FCS. incubated at 32°C until 1 h post-adsorption when
[2P]
The cells were
orthophosphate
(Radiochemical Centre, Amersham, Bucks, U.K.) was added to a final concentration of 250 1Ci/ml. The incubation was then continued overnight at 32°C.
Overnight harvests from both
P-labelled VSV serotypes were
centrifuged at 12, 000 g for 10 min and the virus pelleted from the supernatant at 100, 000 g for 1 h. The virus pellets were resuspended in 0.02 M TrisHC1 pH 7. 5, 0.10 M NaCl, 0.001 M EDTA (TNE pH 7. 5) layered on to 5. 0
ml 20-60% (w/w) linear sucrose gradients (in TNE pH 7. 5) and the gradients centrifuged at 270, OO0g for 1.5 h. at 2°C. The gradients were fractionated into 0. 5 ml fractions and 20 ILl aliquots taken into 5.0 ml Aquasol (New England
Nuclear). Radioactivity was determined in a Packard Tri-Carb scintillation counter.
Preparation of virus RNAs Both labelled and unlabelled virus RNAs were prepared in the same manner. Pooled peak fractions from sucrose gradients were made 1.
0%(v/v)
with SDS, extracted three times with phenol/chloroform/isoamylalcohol
(50: 50: 1, PCI) and twice with chloroform/isoamylalcohol (50: 1, CI) alone. Carrier RNA (tRNA, 10 F±g/ml, BDH, Poole, Dorset, U.K.) was added to 2977
Nucleic Acids Research the aqueous phase of
P-labelled RNAs before precipitation with 2.5
volumes of cold ethanol in the presence of 0.1M sodium acetate. Unlabelled
RNAs (at>2 Fig/ml) were precipitated in the absence of any carrier tRNA.
Precipitation was at -20°C overnight or (in the case of low RNA concentration at -70°C for at least 1 h). The precipitated RNA was finally collected by centrifugation at 20, 000 g for 20 min and dried in vacuo. T RNase digestion of uniformly labelled 1
P-RNAs
P-labelled virus RNA precipitates were resuspended in 20 ,ul 0. 02 M Tris-HCl pH 7. 5, 0. 002M EDTA, 5p.l of T RNase (Sankyo, Japan, 1 mg/ml) added to give a final enzyme: substrate ratio of 1: 20 and the solution incubated in a sealed capillary for 40 min at 37°C. The samples were then dried in vacuo, resuspended in 12 p1 9 M urea plus 8 ±L1 tracker
dye (50% sucrose, 5 M urea, 0.2% (w/v) bromo-phenol blue, 0.2% (w/v) xylene cyanol), and 15 p.1 of this sample applied to the first dimension of the two dimensional gel.
Ribonuclease T and bacterial alkaline phosphatase digestion of unlabelled RNAs Unlabelled RNA precipitates (in 5 p.g aliquots) for the kinase reaction were resuspended in 5 p.1 of 0.02 M Tris-HCl pH 7. 8, 2.5 p.1 of
T1 RNase
(0.1 mg/ml enzyme : substrate ratio 1: 20) and 1. 0 .1l of bacterial alkaline phosphatase (BAP. FS, Worthington Biochemical Corporation, 0.1 mg/ml; enzyme : substrate ratio 1: 50) added and the mixture incubated for 40 min at 37°C. The reaction was stopped by diluting to 200
.l with 0. 2
M NaCl,
1% SDS and extracting the T1/BAP. FS digest three times with PCI and twice with CI. The extractions were performed in Beckman microfuge tubes
with'-10 sec. spins in the Beckman microfuge to separate the phases. The aqueous phase was finally lyophilised.
5'-terminal labelling of T1 oligonucleotides Polynucleotide kinase (P-L Biochemicals) was used in all the experiments described in this study. This commercial preparation contains contaminating levels of RNase, a problem which was overcome in this study by the use of short incubation periods together with the inclusion of a polyamine
2978
The use of ribonuclease-free polynucleotide kinase,whenever
Nucleic Acids Research possible, is strongly recommended ' 32 [Y- PJ ATP (20p.Ci, specific activity>7, 000 CGmmcale,New England Nuclear Corporation)was lyophilised from 100 p1 aliquots of distilled water three times before resuspension in 33 p1 of denaturation buffer (5 mM Tris pH
7.4, 0.01 mM EDTA 3Na, 0.2mM spermidine).
Lyophilised T and BAP.
FS digests (5 p.g) of RNAs were resuspended in 10 .1l of denaturation buffer,
heated in sealed capillaries for 10 min at 85°C and immediately chilled in ice-water. The RNA digest was then added, together with 5 .1l of 10 x kinase
buffer (0.5M Tris-HCl pH 7.4, 0.1M MgCGl, 0. 05 M dithiothreitol, 50%
32~~~~~~~
glycerol) to the [y- P] ATP which had been transferred to a Beckman microfuge tube. The reaction was started by the addition of 2 p.1 of polynucleotide kinase (1 unit/ ,uld, P-L Biochemicals Ltd), to the centre of the reaction mix making a final reaction volume of 50 p.1. Incubation was for 4 min. at 370C. The reaction was terminated by the addition of 100 1l1, 1 M ammonium acetate, 10 p.1 10% (w/v) SDS and 20 p.1 0.1 M EDTA. After mixing well with the aid of a vortex mixer and centrifuging (~5 sec) in the Beckman microfuge, 10 .1l of tRNA 10 mg/ml BDH Ltd., Poole, Dorset) was added as carrier. The solution was then extracted three times with PCI and twice with CI before precipitation of the aqueous phase with 2. 5 volumes of absolute alcohol in the presence of 0.1 M sodium acetate. Samples were left at -20°C
overnight or for 1 h at -70°C to allow full precipitation of the T1 oligonucleotides before lyophilisation. The samples were finally resuspended in 12 p1 9 M urea plus 8 p.1 tracker dye in preparation for two-dimensional gel
electrophoresis. Two-dimensional polyacrylamide gel electrophoresis of oligonucleotides Two-dimensional polyacrylamide gel electrophoresis was performed 18 5 using the method of De Wachter and Fiers as modified by Frisby et al.,
Samples were heated for 1 min at 600C in 6M urea before application to the first dimension gel in order to eliminate any possible annealing or aggrega5 tion. Autoradiography was performed as described by Frisby et al., Autoradiography was usually for 6 h in the case of PNK [2P-] ATP labelled preparations compared with 24 h for in vivo labelled preparations.
2979
Nucleic Acids Research RESULTS
Fingerprints of picornavirus RNA EMC As may be seen from Fig. 1 the fingerprint obtained by labelling a cold T /BAP. FS digest of EMC-RNA with ATP and polynucleotide 1 kinase (PNK, Fig. la and c) is very similar to that obtained from a T1 digest of uniformly labelled EMC-RNA (Fig.lb and d). It is apparent, how-
[y-32
ever, that although qualitatively similar, there are quantitative differences between the fingerprints obtained by the two methods. For example, it is clear that oligonucleotides 1 (the poly
C-tract), 14 and 29 give spots of low
intensity. One qualitative difference was evident also, namely the appearance of an oligonucleotide, with a mobility between that of oligonucleotides 4 and 10, in the kinase labelled preparation that has not previously been encountered on a routine basis in uniformly labelled preparations. BE
[y- 3] ATPof a uniformly-
A comparison of the fingerpint obtained from a PNK -
labelled
T1 and BAP.FS digest (a, c) of BE-RNA with that labelled TIdigest (b, d) is shown in Fig. 2. In the case of this
picornavirus RNA the quantitative differences between the two fingerprinting techniques are more apparent than with EMC RNA and oligonucleotides 4, 5, 6, 7, 8, 11, 20, 30 and 33 have been poorly phosphorylated (oligonucleotide 6 being only visible upon direct exanmination of the autoradiograph). Qualitative differences are evident between the comparative fingerprints of BE-RNA also, oligonucleotides 1, 13 and 31 being completely absent from the kinase labelled
fingerprint. Oligonucleotide 10 (see Fig. 2c) appears to have run differently in the in vitro labelled
preparation. Again several additional spots, not
present in fingerprints of in vivo labelled BE-RNA were observed in the endlabelled preparation. Such additional spots are indicated in Fig. 2c by single hatching.
Fingerprints of VSV-RNAs VSV Indiana serotype
Figure 3 shows fingerprints of a cold VSV Indiana serotype RNA 2980
Nucleic Acids Research preparation digested with T RNase/BAP. FS and phosphorylated with poly-
nucleotide kinase (Fig. 3a) and of a RNase
T1-digest
of uniformly labelled
RNA preparation (Fig. 3b) together with direct tracings of the respective autoradiographs (Fig. 3c and 3d). Upon close examination it is evident that most of the characteristic T1 products labelledwith PNK-
[y-32P]
ATP
present in the fingerprint shown in Figs. 3a and 3c have migrated to approx-
imately the same position as their counterparts in the fingerprint of in vivo
(Fig. 3b and 3d). Several oligonucleotides (namely spots 3, 8,15,17,18, 20, 21, 36 and 38) have been poorly phosphorylated in the PNK- [y-32] ATP preparation and oligonucleotide 27 appears to labelled
T1 oligonucleotides
remain unphosphorylated.
VSV New Jersey serotype
Comparative fingerprints of a PNK- [y- 32] ATP labelled T1/BAP. FS digest of VSV New Jersey serotype RNA (a, c) and of a uniformly-labelled T1 digest (b, d) are shown in Fig. 4. Although detailed scrutiny reveals that the fingerprints obtained by the two different approaches are qualitatively similar, quantitative differences due to incomplete phosphorylation of several nucleotides (namely, 2, 5, 6, 8,11, 22, 31, and 32)in the PNK - [y-32
ATP preparation are again evident. Furthermore, three oligonucleotides present in the fingerprint of in vivo labelled VSV New Jersey serotype RNA
(Fig. 4b and d) are completely absent from the in vitro preparation (spot numbers 1,18 and 29 Fig. 4a and c). It would also appear that there is some discrepancy in the area of spot 23. The in vivolabelledT fingerprints of the two VSV serotypes studied
(Indiana and New Jersey) are, as might be expected, easily distinguishable from one another. Several characteristic T1 oligonucleotides from their position on the fingerprint alone, could possibly be common to both the New Jersey and Indiana serotypes. Further analysis by pancreatic digestion of the in vivo products and/or partial digestion with snake venom phospho-
diesterase of the in vitro products would be necessary, however, to confirm that these oligonucleotides are indeed common to both the VSV serotypes
studied.
2981
Nucleic Acids Research
,a. ...
lst
i2nd
.
a
.b .:
1 C.
V
02 03
04
Il8%C07 120 l 108
21
130
D1 18
325~
09
23 15
2712614 \ 016 190 22 3&
36
1
4
33r"\
Autoradiographs of bidimensional polyacrylamide gels of the ribonuclease T oligonucleotides o0 f MC-RNA labelled (a) in vitro with PNK Tracings of the and [y- P] AT (b) in vivo with lP1 - orthophosphate. top half of the autoradiographs are shown in (c) and (d) to provide a guide for comparison. The numbers refer to those oligonucleotides that have previously been subjected to RNase A digestion5 with the exception of spots 37-45. Oligonucleotides in (c) marked 0 are common to both fingerprints; Figure 1.
0, 2982
are those that have been incompletely phosphorylated in the
PNK-+-
Nucleic Acids Research ! ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~~~~~~~~ ~ .' .. ''
~.
. . .:
'' g.~~~~~~~~~~~~~ ~~~~~~~ :'~~~~~~~~~~~~~~~~~~~~.. ....:: ..*. . .. ..:.
:.:
.:.
...:. I:
d. 0D 2
03 C D04
121110 o 00 12
8
8 09 07 0 23°
320~~~~~3 1831 309
21
1
-
-
32P7JATP reaction; *, those that appear in the fingerpint of in vitro labelled reaction but are absent from the in vivo labelled fingerprint and @ those that are present in the uniformly labelled fingerprint but which appear to be completely absent from the fingerprint of in vitro labelled T1 oligonucleotides. The origin ( 0) is at the top left hand corner and the arrows indicate the direction of electrophoresis. The streak is the heterogeneous poly (A) tract described previously5' 6. 2983
Nucleic Acids Research
O
a.,
t
__e*
2nd
4..*
*. ..w.. .......
....... 0
At
C.
9
IQ
g 4
012
3
o
a
10
o 90
It
11
?7 c18*
8 13 14 1 13 14 15c
20
1g26S
24S
2
18
29
0022332CD3 40 ~~31
Figure 2. Autoradiographs of bidimensional polyacrylamide gels of the ribonuclease T oligonucleotides of BE-RNA. The assignments of (a), (b), (c) and (d) and other details are as given in Figure 1. The numbers have 2984
Nucleic Acids Research
U:.
a
I
d 2
c.)1
0)
3
0
6
C
5 4 0
1020
22 210
14 ° 23
been assigned arbitrarily to aid in comparison of the fingerprints. The key to the shaded spots in (c) is given in the legend to Figgre 1. The streak is the heterogeneous poly (A) tract described previously . 2985
Nucleic Acids Research
--.
a.
1 St
01
2nd:.:
Go
60 180 29 26 7019 06280°
r
120 130
36@
0o3034 33C 035
Figure 3. Autoradiographs of bidimzensional polyacrylamide gels of the ribonuclease T1 oligonucleotides of VSV Indiana RNA. Assignments of (a), 2986
Nucleic Acids Research
0-
:
..
0
.::*:
0
-2.L
0:
:'WI Am
4:
I
0
2
. . .:0, 1. .
d
0 14
3
4 C15
°17 60
018
70 190 9 ,8
0::
120 130
29 26
2728 CR38
200 24 ,K25ti39 210 GYi:3140 374 22zc923
36
030 031
Q3234 33c2'~ 035
(b), (c) and (d), the convention for shading of the spots in (c)and other details are as given in the legend to Figure 1.
2987
Nucleic Acids Research
-i
O
-
a.
1st
2nd
.1..
Co Is2 *
30
14
01663 22030 170 ¶72°631 280
1118 0 29*0Qz: _8 12D 190 025 6
70
8*
130
0032
34c~,~33
260
200 Figure 4. Autoradiographs of bidimensional polyacrylamide gels of the ribonuclease TI oligonucleotides of VSV New Jersey RNA. Assignments 2988
of
Nucleic Acids Research -
0w
,mw.w:=,-
r
jmm. 11,.W
11 T:- !I:
d
2
OS 3
)14
9C-) conV 40 sQ 68022 10 15
7
24
5 0U~11
07
eQ
12
1
130
18
29
3
4033
0 2
26
200 (a), (b), (c) and (d), the convention for shading of the spots in (c) and other detials are as given in the legend to Fig.l. 2989
Nucleic Acids Research Fingerprint of ovalbumin mRNA Ovalbumin mRNA was subjected to combined T RNase and BAP. FS
digestion, labelled in vitro with
[y32PJ
ATP and PNK and the labelled
digest fractionated by bidimensional polyacrylamide gel electrophoresis as described in the Methods section. Figure 5 shows a photograph of the result-
ant autoradiograph. The complexity of the fingerprint is that expected of a molecule of molecular weight approximately 650, 000
with several oligo-
nucleotides (.15) in the 10-25 nucleotide size range. The longest oligonucleotide is estimated, from its position on the gel, to be about 30 nucleotides in length.
2nd--_----------- 1St
2nd
.-1
4" *
Figure 5. Autoradiograph. of a bidimensional polyacrylamide gel fractionation of the T RNase oligonucleotides of ovalbumin mRNA labelled in vitro by the PNK- -3 2ATP method. The origin and directions of electrophoresis are as given in the legend to Fig. 1. 2990
Nucleic Acids Research DISCUSSION In this paper the potential usefulness of the in vitro phosphorylation
for obtaining fingerpints of high molecular weight virus and messenger RNAs has been explored. Virus RNAs that
technique of Szekely and Sanger
label to high specific activity in vivo were .chosen for this study so that
fingerprints obtained using the in vitro labelling technique could be compared directly with those derived from uniformly labelled RNAs. vitro phosphorylation technique the
y3
P]from
[y-32]
In the in
ATP is enzymatic-
ally transferred to free 5' hydroxyl groups of unlabelled oligonucleotides
(derived from a combined T RNase and bacterial alkaline phosphatase digest) with the aid of polynucleotide kinase from T4- 'phage infected E. coli Successful application of this technique would allow fingerprint and at least partial sequence analysis of RNAs from human influenza virus strains,
measles virus, various retroviruses and also mRNAs, all of which are
insufficiently labelled in vivo and/or subject to limited availability.
Fingerprints were prepared from T RNase/BAP.FS digests of two picornavirus RNAs and the RNAs of two VSV serotypes using the in vitro ~~~~~13 phosphorylation method of Szekely and Sanger and compared with fingerprints of uniformly labelled T digests of the corresponding RNAs in vivo. The comparison demonstrated that the in vitro labelling technique yielded representative T fingerprints thus providing an economical yet efficient
fingerprints of high molecular weight RNAs. As a few differences were encountered in some preparations,however, it would
way of preparing
T1
seem advisable, where possible, to obtain an in vivo labelled
T1
fingerprint
as a guideline in the first instance. The in vitro phosphorylation technique, as described in this paper, has been successfully applied also to two other
enterovirus RNAs namely poliovirus and swine vesicular disease virus (T.Harris, personal communication). In each case the pattern of large characteristic T oligonucleotides obtained was indistinguishable from the pattern derived from digestion of the uniformly labelled RNA. It is also of crucial importance when employing this technique to use RNA of the highest purity and structural integrity and to ensure that any RNase activity contaminating the PNK enzyme is removed or inactivated.
2991
Nucleic Acids Research The quantitative differences (judged by the lack of corresponding intensity of spots from one fingerprint to another) noted between T1 oligonucleotide maps derived from in vitro and in vivo labelling are presumably due to incomplete phosphorylation of several oligonucleotides by the PNK enzyme. The reasons for this are unclear, however, it is evident from the
random distribution of the incompletely phosphorylated oligonucleotides on
the fingerprints that the effect is not related to size or base composition. The possible effect of secondary structure of the RNA in this respect cannot be discounted but would appear remote as (i) some quite short oligonucleotides are effected and (ii) the phosphorylation is performed after heating the RNA at 850C for 10 min in denaturation buffer. Qualitative differences between fingerprints obtained from T RNase digests labelled in vitro and
those derived from digests of uniformly labelled RNA were less frequent than quantitative differences but, nevertheless, regularly occurred. The
reason(s) for these discrepancies again are unclear although preferential activity of the PNK enzyme, incompletedephosphorylation and blocking of the 5' hydroxyl are all possibilities. In the case of BE-RNA, three oligonucleotides (marked 1, 13 and 31 remain totally unphosphorylated in the PNK-
[y-32P]
-ATP reaction. In a
previous study one of these (marked 1) had been shown to have a base composition inconsistent with its position in the two-dimensional gel 5 . The reason for the anomalous migration of this oligonucleotide was not clear at that time. Recently, however, both Lee et al.}
and Flanagan et al., have reported that the 5' terminus of poliovirion RNA is blocked with a protein. Furthermore Flanagan et al.2 demonstrated that treatment of
virion RNA with T RNase alone generated a proteinase K-sensitive oligo1 ribonucleotide of the structure,protein - pUUAAAACAG. The composition 5 of the 1 of BE-RNA is 1
anomalously migrating spot
AAAAC, lAG, 2-3U
the exact composition expected from a pancreatic RNase digestion of the blocked 5' terminal T RNase oligonucleotide of poliovirion RNA. It is proposed, therefore, that oligonucleotide 1 is the blocked 5' terminal T RNase oligonucleotide of BE-RNA and that it is identical to the 5'-terminal
T1 oligonucleotide of poliovirion RNA. The fact that this oligonucleotide is not phosphorylated with polynucleotide kinase would then be explained by the 2992
Nucleic Acids Research presence of a blocked 5' hydroxyl. The lack of in vitro phosphorylation of
oligonucleotides 13 and 31 of BE-RNA and of various other EMC and VSV
oligonucleotides (see above) cannot be so readily explained.
Poor phosphor-
ylation of the poly C tract of EMC-RNA would not appear to be due to its homopolymeric nature since synthetic poly r C alone is labelled to the expect-
ed extent (unpublished observations). Some fingerprints obtained by the in vitro labelling method consistently yielded one or more additional spots. Similar observations were noted
by Szekely and Sanger
and these authors comments apply equally to this
study. It is also feasible that trace levels of contaminating RNA could
contribute T RNase oligonucleotides which are preferentially phosphorylated. It would seem unlikely that such additional spots are due to T 1RNase
overdigestion as similar spots have not been observed in in vivo
P prep-
arations even when picornavirus RNAs have been digested to completion.
oligonucleotide map of ovalbumin mRNA obtained by the PNK- [y-32] ATP technique has the expected complexity of an RNA of~ 1900 nucleotides in length with at least 15 large characteristic oligoThe
T1
nucleotides. From its position on the two-dimensional gel the spot marked with an arrow in Figure 5 possibly represent the run
5, UUCCUUUAAUCAUAAUAAAAACAUGp 3, 8 32 present in the 3' sequence of ovalbumin mRNA as determined by Cheng 28 27 have also published a T oligonucleotide map of et al. . Woo et al. ovalbumin mRNA. These authors used in vitro labelling with
I and
fractionated the oligonucleotides using homochromatography. It is difficult,
therefore, to make any direct comparison of the two T maps. Furthermore, I-fingerprints are difficult to interpret and hence of somewhat limited 29 use as has been discussed previously by other authors . Iodination of RNA also requires more than a 5-fold greater amount of RNA together with a
200-fold greater amount of radioactivity to obtain specific activities of the same order of magnitude as that produced by in vitro phosphorylation with
polynucleotide kinase. The advantage of the Szekely and Sanger technique is that it allows further analysis by sequence determination with the aid of 2993
Nucleic Acids Research partial snake venom phosphodiesterase digestion.
Another approach to fingerprinting and sequence analysis of mammalian mRNAs and other polyadenylated RNAs that are difficult to label efficiently in vivo has been used by Marrotta et al., and by Paddock et al.,31
Complementary DNA (cDNA) is synthesized using the RNA-directed DNA polymerase from avian myeloblastosis virus and oligo (dT) as primer. The cDNA is then used as a template for in vitro RNA synthesis with E. coli RNA polymerase and highly P-labelled nucleoside triphosphate precursors. The radioactive RNA transcript, after nuclease digestion, is further fractionated and analysed in an identical fashion to uniformly labelled RNA.
This approach, apart from being rather involved and time-consuming,
suffers from the disadvantage that, although the cDNA would appear to be a faithful copy of the polyadenylated RNA, in some instances only certain regions of cDNA are transcribed by the E. coli polymerase . Direct sequencing of the cDNA using the new DNA sequencing techniques 32'
however, would circumvent this problem. In conclusiorL, the in vitro labelling of large T1 oligonucleotides
from virus and mRNAs with the aid of polynucleotide kinase and [y-32] ATP provides, with the provisos discussed above, several advantages over alternative methods of fingerprinting and/or sequencing RNAs which are
inefficiently or inadequately labelled in vivo.
ACKNOWLEDGEMENTS I am grateful to Dr. E. Humphries for help with the polynucleotide
kinase method and to Dr. T. Harris for the communication of results con-
cerning the application of the technique described in this paper to other picornavirus RNAs. The two-dimensional polyacrylamide gel analyses were performed in the laboratory of Dr. P. Fellner (Searle Research Lab-
oratories) and I thank Dr. J. Smith and Mr. C. Newton for help with some of these analyses. I am also indebted to Dr. T. Harris for the provision of
purified BE-RNA and to Dr. M. Doel for the provision of purified ovalbumin mRNA. Mr. P. Bennett provided excellent technical assistance during the preparation and purification of the VSV serotypes. I should also like to
2994
Nucleic Acids Research express my gratitude to Drs. B. Griffin, P. Fellner and R. Weiss for
reviewing the manuscript and for their encouragement throughout this work. *
On leave of absence from Searle Research Laboratories, Lane End Road, High Wycombe, Bucks, UK REFERENCES
1. 2.
3.
4. 5.
6. 7.
Billeter, M.A., Parsons, J.T. and Coffin, J.M. (1974) Proc.Natl. Acad.Sci. USA 71, 3560-3564. Joho, R.H., Billeter, M.A., and Weissman, C. (1975)Proc.Natl. Acad.Sci.USA 72, 4772-4776. Wang, L.H., Duesberg, P., Beemon, K. and Vogt, P.K. (1975) J.Virol. 16, 1051-1070. Coffin, J.M. and Billeter, M.A. (1976) J.Mol.Biol. 100, 293-318. Frisby, D .P., Newton, C., Carey, N.H., Fellner, P., Newman, J.F.E., Harris, T.J.R. and Brown, F. (1976) Virology 71, 379-388. Frisby, D.P., Smith, J., Jeffers, V. and Porter, A.G. (1976) Nucleic Acids Research 3, 2789-2809. Lee, Y.F. and Wimmer, E. (1976) Nucleic Acids Research 3
1647-1658. 10. 11.
Harris, T.J.R. and Brown, F. (1976) J.gen.Virol. 33, 493-501. Kennedy, S.I.T. (1976) J.Mol.Biol. 108, 491-511. Harris, T.J.R. and Brown, F. (1977) J.gen.Virol. 34, 87-105. Harris, T.J.R., Doel, T.R. and Brown, F. (1977) J.gen.Virol. 35,
12.
299-315. Wengler, G., Wengler, G. and Filipe, A.R. (1977) Virology 78,
8. 9.
124-134. 13. 14. 15.
16. 17. 18. 19.
20. 21.
22. 23. 24.
Sz6kely, M. and Sanger, F. (1969) J.Mol.Biol. 43, 607-617. Simsek, M., Ziegenmeyer, J., Heckman, J. and Raj Bhandary,U.L. (1973) Proc.Natl.Acad.Sci.USA 70, 1041-1045. Simsek, M., Raj Bhandary, U.L. Boisnard, M., and Petrissant, G. (1974) Nature 247, 518-520. Szeto, K.S. and Soll, D. (1974) Nucleic Acids Research 1, 1733-1738. Fuke, M. and Busch, H. (1977) Nucleic Acids Research 4, 339-352. DeWachter,R., and Fiers, W. (1972) Analyt.Biochem. 49, 184-197. Porter, A.G., Carey, N.H. and Fellner, P. (1974) Nature 248, 675-678. Brown, F., Newman, J., Stott, J., Porter, A., Frisby, D., Newton, C., Carey, N. and Fellner, P. (1974) Nature 251, 341-344. Earley, E., Peralta, P.H. and Johnson, K.M. (1967) Proc.Soc.Exp. Biol.Med. 125, 741-747. Frisby, D., Cotter, R. and Richards, B. (1977) J.gen.Virol. In Press. Brown, F. and Cartwright, B. (1963) Nature, London 19 1168-1170. Panet, A., van de Sande, J.H., Loewen, P.C., Khorana, H.G., Raae, A. J., Lillehaug, J.R. and Kleppe, K. (1973) Biochemistry, 12, 5045-5050. 2995
Nucleic Acids Research 25.
26. 27.
28. 29. 30. 31.
32. 33.
2996
Lee, Y.F., Nomoto, A., Detjen, B.M. and Wimmer, E. (1977) Proc.Natl.Acad.Sci.USA 74, 59-63. Flanagan, J.B., Pettersson, R.F., Ambros,V., Hewlett, M.J., and Baltimore, D. (1977) Proc.Natl.Acad.Sci.USA 74, 961-965. Woo, S.L., Rosen, J.M., Liarakos, C.D., Choi, Y.C., Busch, H., Means, R., O'Malley, B.W. and Robberson, D.L. (1975) J.Biol. Chem. 250, 7027 -7039. Cheng, C.C., Brownlee, G.G., Carey, N.H., Doel, M.T., Gillam, S., and Smith, M. (1976) J.Mol.Biol. 1Q7, 527-547. Gross, H.J., Domdey, H. and Sanger, H.L. (1977) Nucleic Acids Research 4, 2021-2028. Marotta, C.A., Forget, B.G., Weissman, S.M., Verma, I.M., McCaffrey, R.P. and Baltimore, D. (1974) Proc.Natl.Acad.Sci.USA 71, 2300-2304. Paddock, G.V., Ponn, R., Heindell, H.C., Isaacson, J., and Salser, W. (1977) J.Biol.Chem. 252, 3446-3458. Sanger, F. and Coulson, A.R. (1975) J.Mol.Biol. 94, 441-451. Maxam, A.M. and Gilbert, W. (1977) Proc.Natl.Acad.Sci.USA 74, 560-564.
