Scaml. J. Immunol. 36, 745-749. 1992
SHORT PAPER
0KT3-Induced Cytokine mRNA Expression in Human Peripheral Blood Mononuclear Cells Measured by Polymerase Chain Reaction E. K. PISA*. P PISA*t, M. HANSSON* & H. WIGZELL* "Department of Immunology. Karolinsk:i Institute and tDepartmenl of Medicine. Danderyds Hospital, Stockholm, Sweden
Pisa EK. Pisa P. Hansson M. Wigzell H. OKT3-lnduced Cytokine mRNA Expression in Human Peripheral Blood Mononuclear Cells Measured by Polymerase Chain Reaction. Scand J Immunol 1992:36:745 9 The kinetic profile of cytokine gene expression in normal human peripheral mononuclear cells (MNC) activated by an anti-CD3 monoclonal antibody was studied. The presence or absence of !0 different cytokine mRNA were measured in a polymerase chain reaction (PCR) assisted mRNA amplification assay. Afler 2 h of stimulation the mRNA for interleukin-lx (IL-lx). interleiikin-2 UL-2). inierleukin-3 (IL-3). tumour necrosis factor-a: jTNF-:*) and interferon--/ (IFN-y) were detectable and remained present during the whole time period studied (22 h). lnterleukin-6 (lL-6) and granulocytc macrophagc colony stimulating factor (GM-CSF) were detected after 4 h. while interleukin-IO (IL-IO) mRNA did not appear until after 7 h: they ail remained expressed al 22 h. A transient expression orinterleukin-4 (IL-4) mRNA was observed between 4 and 7 h of stimulation. No gene expression of granulocyte colony stimulating factor (G-CSF) was detected ai any time. These results show Ihat anti-CD3 slimubtion of M NC leads to a rapid sequential induction of different cytokine mRNA. some with a very transient expression. Eva K. Pi.sci. Dcpurimeni oj immunology, KaroUnsku in.siiluii'. Bo.\ 604 00. Iil4 0! Sweden
An immune response lo a given antigen involves the participation of a large number of distinct cell types. Their functions must be coordinated to assure an appropriate response in both magnitude and quality. This coordinating function is generally believed to be generated by activated T cells and by immune recognition induced eytokines [1]. Recently published data provide evidence that the different functions of human CD4^ and CD8^ T-cell subsets can be discriminated and predicted by analysis of their cylokine profile [2]. Thus, the pattern of cytokine expression may decide the outcome of a specific infectious challenge to the host defence. Although at present many of these soluble factors are cloned and available in recombinant form, their function in vivo and their place in the 'cytokine network' is still a matter of study [1. .3. 4]. Under physiological conditions, cytokines are transiently produced by more than one cell type and provide short range signalling. Depending on
Suxkholm.
the sequence o\' their action they may act either synergislically or antagonistically on multiple types of target cells [4, 5]. Recognizing these factors is further adding to the eomplexity. Commonly used bioassays to measure the biological activity of the secreted cytokines are often not sufficiently specific and are also influenced by the presence of inhibitory faetors if body fluids are assayed. Other assays, sueh as enzyme-linked immunosorbent assays or radioimmunoassays, measure the net amount of a secreted cytokine after production, absorption and degradation has taken place. Studying cytokine production at the mRNA level largely eireumvents these problems. However, a conventional Northern blot analysis requires a large amount of high quality RNA and thus does not provide the sensitivity needed. In order to be able to identify an abnormal pattern of cytokine production in a disease situation, we have studied the cytokine gene 745
746
E. K. Pi.sa et at.
expression and kinetic profile in normal human peripheral mononuclear cells (MNC) activated in vitro by an anti-CD3 murine monoclonal antibody. Using the polymerase chain reaction (PCR) assisted mRNA amplification assay we could detect a sequential induction ofdifferent cytokine mRNA. some with a very transient expression.
MATERIALS AND METHODS Cell culture and cylokinc induclioti. MNC were isolated from hlood oTIiealthy donors hy Kicoll Mypaque density gradient (Pharmacia. Uppsala, Sweden) centrifugation. Cells were washed twice in PBS und cultured (2x 10''per ml) for the indieated lime intervals in RPMI (Gibco Laboratories. Grand Island. NY. USA), supplemented with 2 mM L-Glutamine withoul scrum souree. The cells were stimulated with 25 ng/ml puritied OKT3 murine monoelonal antibody (American Type Culture Collection. Roekville. MD. USA) present in the culture during the whole eullure period. As a negative control, cells were cultured in medium alone, Al 0, 2. 4. 7 and 22 h. 1 X 10*' cells were harvested from stimulated and eontrol cultures, snap-frozen and kept in liquid nitrogen until further processing, P C R assisted m R N A amplifictition. (I) RN.4 preparalion. Total RNA preparation was performed esserttially as described [6], In brief, to I x 10'' frozen cell pellets 500 fl] of lysis solution were added, consisting of 4 M guanidino-thiocyanate (Fluka AG. Buehs. Switzerland). 25 niM Na citrate (pH 7). 0,5% sarcosyl (Fluka) and 100 mM 2-mercaptoethanol (Sigma Chemical Co.. St Louis. MO. USA), To the lysate was sequentially added 50 /il 2 M Na acetate. 500 fd water-saturated phenol (Fltika) and 200 /d chloroform-isoamyl alcohol (49:1) and thoroughly mixed by inversion after the addition of each reagent. The final suspension was shaken for 10 s and chilled on ice for 15 min. Samples were spun at 10.000^ for 20 min at -\-4 C. the aqueous phase was transferred to a clean Eppendorf tube and RNA was precipitated in an equal volume of 2propanol at - 2 0 C for 60 min. Precipitates were pelleted at 10,000^ at + 4 C. resuspended in 3{K)/(I lysis solution and ethanol precipitated at - 2 0 C overnight, subsequently pelleted and washed twice in 75"'JI. Promega. Madison. WI). 0,5 /il ! tnM random hexamer primers (Pharmacia). 0,5 fd murine Moloney leukaemia virus reverse transcriptase (200 U'/d. BRL), Tuhes were afterwards heated for 5 min at 95 C, cDNA from each sample was synthesized in one tube and then divided into separate tubes for the PCR, (3) Polymeruse chain reaciion. Forty fi\ of PCR mix was added to 10 fi\ of first strand cDNA, PCR mix
contained: 5/(1 10 x buffer(100 mM Tris-HCl. 500mM KCl. 0,1",, wt/vol gelatine. pH. S,3). 5 fd 20 mM MgCh. 8 fd dNTP (1,25 mM each Pharmacia). 11.75 /il sterile water. 5 fd of each primer (10 fiM) and 0,25 id of Taq polymerase (Cetus Corp,, Emergyville. CA), The reaction mixture was amplified using a Perkin-Flmer Thermal cycler for 30 cycles. The temperature profile used was: 94 C t min for denaturation. 58 C 1 min for annealing. 72 C 1 min for primer extension. PCR products were separated on ethidium bromide-stained 1.6'tii agarose gel (Pharmacia). Cytokine specific primers were synthesized on a DNA Synthesizer (Applied Biosystem. Foster City. CA. USA), Sequences (Table I) are specitic as aseertained by computer assisted search of updated versions of GenBank. All primers were RNA specific and non-reactive with DNA. Phytohaemagglutinin stimulated MNC expressed all cytokines tested for and thus served as a positive control to ascertain that each primer set yielded a correct sized PCR product (data nol shown). For amplification of eaeh eytokine mRNA 10 fd cDNA. representing total RNA from 5 x IO'' cells, was used.
RESULTS AND
DISCUSSION
MNC froni healthy blood donors were polycionally activated by the murine anti-CD3 monoclonal antibody. 0KT3, The kinetics of cytokine mRNA expression was studied. Anti-CD3 antibody was chosen as the stimulus, since it binds to the T-cell reeeptor CD3 complex and therefore may more closely resemble an antigen-specific stimulation of MNC than eg, lectins. phorbol esters or ealcium ionophores. At 0. 2.4. 7 and 22 h, cells were harvested, total RNA was isolated and reverse transcribed into eDNA. and subsequently amplified using cytokine mRNA specifie primers (Fig, I). Total RNA representing 5x10* cells was used for amplifieation of each cytokine mRNA, In cells freshly isolated after venipuncture. mRNA for TNF-a could be visualized as a faint band on the ethidium gel (Fig, I). In the unstimulated and stimulated cell cultures we omitted the serum source to minimize exogenous stimulation. Even so, in the unstimulated cetl cultures the TNF-a mRNA was present throughout the whole experiment; this presumably represents in vivo activated cells in the circulating peripheral blood pool [8], In the unstimulated control cultures, IL\i mRNA and IL-6 mRNA appeared after 4 h and 7 h ofculture. respectively (data not shown). These re.sults support the observation that plastie adherence of monocytes is sufficient to induee cytokine production in these cells [9-11]. In the anti-CD3-stimulated eell cultures, mRNA for
OKT3-InducedmRNA
Expression Measured by PCR
141
TABLL I. Oligontjcleottde primer sequences
Cytokine
Primer 5'-3'
Amplified Fragment (bp)
5'IL-la 3' IL-lct
GCCAATGACTCAGAGGAAGA TCTCAGGCATCTCCTTCAGC
328
5 3' 5' 3' 5 3'
TGTACAGGATGCAACTCCTG CAATGGTTGCTGTCTCATCAG CTCCTGCTCCAACTCCTGGT AGGCTCAAAGTCGTCTGTTG CCTCTGTTCTTCCTGCTAGC CCGTTTCAGGAATCGGATCA
402
IL-2 IL-2 IL-3 IL-3 IL-4 IL 4
425 300
5 IL-6 3' IL-6
TGAACTCCTTCTCCACAAGC ATCCAGATTGGAAGCATCCA
315
5' IL-10* 3' IL-10* 5TNF-a 3' TNF-a 5' IFN--/ 3' IFN-y
CTGAGAACCAAGACCCAGACATCAAGG CAATAAGGTTTCTCAAGGGGCTGGGTC TGAGCACTGAAAGCATGATC TTATCTCTCAGCTCCACGCC TCTGCATCGTTTTGGGTTCT CAGCTTTTCGAAGTCATCTC
35!
5 3' 5' 3'
TGCAGAGCCTGCTGCTCTTG CAAGCAGAAAGTCCTTCAGG CAGAGCCCCATGAAGCTGAT TATGGAGTTGGCTCAAGCAG
GM-CSF GM-CSF G CSF G-CSF
5' ^-aetin 3'^-actin
ATGGATGATGATATCGCCGCG CTAGAAGCATTTGCGGTGGAC
363 320 390 319 1126
* Ref. 7.
IL-la, IL-2. IL-3 and IFN-y was detectable already after 2 h. The rapid induction of these cytokine mRNA probably reflects the activation ofmemoryT cells [12] and the expression of these genes remained present throughout the entire period studied. IL-4 mRNA had a transient expression between 4 and 7 h. Lewis et al. reported IL-4 production to be restricted to a small population of polyclonally stimulated T cells, correlating with dramatically lower production of IL-4 mRNA and protein than of IL-2 and IFN-y [13]. Since receptors for iL-4are present on most haematopoetic cell types [14. 15] this might be a mechanism of restricting the plciotrophic effects of IL-4 to appropriate responder cells. lL-6 and GM-CSF mRNA were observed after 4-h stimulation and were subsequently present during the remaining time interval. This is In agreement with the finding of intracellular lL-6 protein in monocytes after 6 h of anli-C'D3stimuiated MNC [8]. One might speculate that the earlier expression of IL-6 mRNA in the stimulated cultures, as compared with the control cultures, is caused by the activation of Fc receptor positive monocytes through the cross-linking of
the igG anti-CD? antibodies on the T-cell surface [16]. IL-10 mRNA appeared after 7 h of stimulation and was still seen after 22 h. This relatively late expression of IL-10 compared with the other lymphokines was also reported for stimulation of monocytes by lipopolysaccharides [17]. The inhibitory properties of IL-10 on inflammation and cytokine secretion [18. 19] may explain the weaker signals for lL-2. IL-3 and GM-CSF observed at the 22-h time-point. During the entire time interval studied no G-CSF mRNA was ever detected. It has been reported by several authors that different stimuli of MNC each induce a distinct pattern of cytokine expression [20-22]. Recently it has been shown in skin biopsies from patients with leprosy that distinct patterns of cytokine expression correlated with resistance or susceptibility to the infection [23]. These results indicate that different patterns of cylokine gene expression may represent activation of different subpopulations of immunologically competent cells, which consequently may have a profound effect on the outcome of the immune response to an invading micro-organism [2]. To understand the mechanisms controlling the pattern of cyto-
748
E. K. Pisa et al.
0 HOURS
2 HOURS
4 HOURS
7 HOURS
22
HOURS
FIG. I. PCR assisled mRNA amplification of normal human MNC after anti-CD3 stimulation. Five independent donors gave similar results. From top to boUom: cells harvested 0, 2, 4. 7 and 22 h after activation.
kine gene expression will be of importance for designing immunization strategics, immunotherapy and in immunosuppression. Kor this
purpose, sensitive assays are needed to monitor the low and sometimes transient expression of cytokines. The present results show that the
0KT3-liuliifedmRNA kinetics of cytokine expression in activated MNC can be measured by PCR assisted mRNA amplification assay. In disease situations where T-cell activation is expected eg, tumour biopsies, rheumatoid tissue or infectious infiltrates, this is the method of choice for measuring cytokine gene expression.
11
12
13
ACKNOWLEDGMENTS This study was supported by grants from the Swedish Cancer Society, Schering-Plough AB. Sweden and the Swedish Societv of Medicine.
14
15
16
REFERENCES 1 Paul WE. Pleiotropy and redundancy: T cell-derived lymphokines iti the immune response. Cell 1989:57:521-4. 2 Salgame P, Abrams JS, Claybcrgcr Ccf
SHORT PAPER
0KT3-Induced Cytokine mRNA Expression in Human Peripheral Blood Mononuclear Cells Measured by Polymerase Chain Reaction E. K. PISA*. P PISA*t, M. HANSSON* & H. WIGZELL* "Department of Immunology. Karolinsk:i Institute and tDepartmenl of Medicine. Danderyds Hospital, Stockholm, Sweden
Pisa EK. Pisa P. Hansson M. Wigzell H. OKT3-lnduced Cytokine mRNA Expression in Human Peripheral Blood Mononuclear Cells Measured by Polymerase Chain Reaction. Scand J Immunol 1992:36:745 9 The kinetic profile of cytokine gene expression in normal human peripheral mononuclear cells (MNC) activated by an anti-CD3 monoclonal antibody was studied. The presence or absence of !0 different cytokine mRNA were measured in a polymerase chain reaction (PCR) assisted mRNA amplification assay. Afler 2 h of stimulation the mRNA for interleukin-lx (IL-lx). interleiikin-2 UL-2). inierleukin-3 (IL-3). tumour necrosis factor-a: jTNF-:*) and interferon--/ (IFN-y) were detectable and remained present during the whole time period studied (22 h). lnterleukin-6 (lL-6) and granulocytc macrophagc colony stimulating factor (GM-CSF) were detected after 4 h. while interleukin-IO (IL-IO) mRNA did not appear until after 7 h: they ail remained expressed al 22 h. A transient expression orinterleukin-4 (IL-4) mRNA was observed between 4 and 7 h of stimulation. No gene expression of granulocyte colony stimulating factor (G-CSF) was detected ai any time. These results show Ihat anti-CD3 slimubtion of M NC leads to a rapid sequential induction of different cytokine mRNA. some with a very transient expression. Eva K. Pi.sci. Dcpurimeni oj immunology, KaroUnsku in.siiluii'. Bo.\ 604 00. Iil4 0! Sweden
An immune response lo a given antigen involves the participation of a large number of distinct cell types. Their functions must be coordinated to assure an appropriate response in both magnitude and quality. This coordinating function is generally believed to be generated by activated T cells and by immune recognition induced eytokines [1]. Recently published data provide evidence that the different functions of human CD4^ and CD8^ T-cell subsets can be discriminated and predicted by analysis of their cylokine profile [2]. Thus, the pattern of cytokine expression may decide the outcome of a specific infectious challenge to the host defence. Although at present many of these soluble factors are cloned and available in recombinant form, their function in vivo and their place in the 'cytokine network' is still a matter of study [1. .3. 4]. Under physiological conditions, cytokines are transiently produced by more than one cell type and provide short range signalling. Depending on
Suxkholm.
the sequence o\' their action they may act either synergislically or antagonistically on multiple types of target cells [4, 5]. Recognizing these factors is further adding to the eomplexity. Commonly used bioassays to measure the biological activity of the secreted cytokines are often not sufficiently specific and are also influenced by the presence of inhibitory faetors if body fluids are assayed. Other assays, sueh as enzyme-linked immunosorbent assays or radioimmunoassays, measure the net amount of a secreted cytokine after production, absorption and degradation has taken place. Studying cytokine production at the mRNA level largely eireumvents these problems. However, a conventional Northern blot analysis requires a large amount of high quality RNA and thus does not provide the sensitivity needed. In order to be able to identify an abnormal pattern of cytokine production in a disease situation, we have studied the cytokine gene 745
746
E. K. Pi.sa et at.
expression and kinetic profile in normal human peripheral mononuclear cells (MNC) activated in vitro by an anti-CD3 murine monoclonal antibody. Using the polymerase chain reaction (PCR) assisted mRNA amplification assay we could detect a sequential induction ofdifferent cytokine mRNA. some with a very transient expression.
MATERIALS AND METHODS Cell culture and cylokinc induclioti. MNC were isolated from hlood oTIiealthy donors hy Kicoll Mypaque density gradient (Pharmacia. Uppsala, Sweden) centrifugation. Cells were washed twice in PBS und cultured (2x 10''per ml) for the indieated lime intervals in RPMI (Gibco Laboratories. Grand Island. NY. USA), supplemented with 2 mM L-Glutamine withoul scrum souree. The cells were stimulated with 25 ng/ml puritied OKT3 murine monoelonal antibody (American Type Culture Collection. Roekville. MD. USA) present in the culture during the whole eullure period. As a negative control, cells were cultured in medium alone, Al 0, 2. 4. 7 and 22 h. 1 X 10*' cells were harvested from stimulated and eontrol cultures, snap-frozen and kept in liquid nitrogen until further processing, P C R assisted m R N A amplifictition. (I) RN.4 preparalion. Total RNA preparation was performed esserttially as described [6], In brief, to I x 10'' frozen cell pellets 500 fl] of lysis solution were added, consisting of 4 M guanidino-thiocyanate (Fluka AG. Buehs. Switzerland). 25 niM Na citrate (pH 7). 0,5% sarcosyl (Fluka) and 100 mM 2-mercaptoethanol (Sigma Chemical Co.. St Louis. MO. USA), To the lysate was sequentially added 50 /il 2 M Na acetate. 500 fd water-saturated phenol (Fltika) and 200 /d chloroform-isoamyl alcohol (49:1) and thoroughly mixed by inversion after the addition of each reagent. The final suspension was shaken for 10 s and chilled on ice for 15 min. Samples were spun at 10.000^ for 20 min at -\-4 C. the aqueous phase was transferred to a clean Eppendorf tube and RNA was precipitated in an equal volume of 2propanol at - 2 0 C for 60 min. Precipitates were pelleted at 10,000^ at + 4 C. resuspended in 3{K)/(I lysis solution and ethanol precipitated at - 2 0 C overnight, subsequently pelleted and washed twice in 75"'JI. Promega. Madison. WI). 0,5 /il ! tnM random hexamer primers (Pharmacia). 0,5 fd murine Moloney leukaemia virus reverse transcriptase (200 U'/d. BRL), Tuhes were afterwards heated for 5 min at 95 C, cDNA from each sample was synthesized in one tube and then divided into separate tubes for the PCR, (3) Polymeruse chain reaciion. Forty fi\ of PCR mix was added to 10 fi\ of first strand cDNA, PCR mix
contained: 5/(1 10 x buffer(100 mM Tris-HCl. 500mM KCl. 0,1",, wt/vol gelatine. pH. S,3). 5 fd 20 mM MgCh. 8 fd dNTP (1,25 mM each Pharmacia). 11.75 /il sterile water. 5 fd of each primer (10 fiM) and 0,25 id of Taq polymerase (Cetus Corp,, Emergyville. CA), The reaction mixture was amplified using a Perkin-Flmer Thermal cycler for 30 cycles. The temperature profile used was: 94 C t min for denaturation. 58 C 1 min for annealing. 72 C 1 min for primer extension. PCR products were separated on ethidium bromide-stained 1.6'tii agarose gel (Pharmacia). Cytokine specific primers were synthesized on a DNA Synthesizer (Applied Biosystem. Foster City. CA. USA), Sequences (Table I) are specitic as aseertained by computer assisted search of updated versions of GenBank. All primers were RNA specific and non-reactive with DNA. Phytohaemagglutinin stimulated MNC expressed all cytokines tested for and thus served as a positive control to ascertain that each primer set yielded a correct sized PCR product (data nol shown). For amplification of eaeh eytokine mRNA 10 fd cDNA. representing total RNA from 5 x IO'' cells, was used.
RESULTS AND
DISCUSSION
MNC froni healthy blood donors were polycionally activated by the murine anti-CD3 monoclonal antibody. 0KT3, The kinetics of cytokine mRNA expression was studied. Anti-CD3 antibody was chosen as the stimulus, since it binds to the T-cell reeeptor CD3 complex and therefore may more closely resemble an antigen-specific stimulation of MNC than eg, lectins. phorbol esters or ealcium ionophores. At 0. 2.4. 7 and 22 h, cells were harvested, total RNA was isolated and reverse transcribed into eDNA. and subsequently amplified using cytokine mRNA specifie primers (Fig, I). Total RNA representing 5x10* cells was used for amplifieation of each cytokine mRNA, In cells freshly isolated after venipuncture. mRNA for TNF-a could be visualized as a faint band on the ethidium gel (Fig, I). In the unstimulated and stimulated cell cultures we omitted the serum source to minimize exogenous stimulation. Even so, in the unstimulated cetl cultures the TNF-a mRNA was present throughout the whole experiment; this presumably represents in vivo activated cells in the circulating peripheral blood pool [8], In the unstimulated control cultures, IL\i mRNA and IL-6 mRNA appeared after 4 h and 7 h ofculture. respectively (data not shown). These re.sults support the observation that plastie adherence of monocytes is sufficient to induee cytokine production in these cells [9-11]. In the anti-CD3-stimulated eell cultures, mRNA for
OKT3-InducedmRNA
Expression Measured by PCR
141
TABLL I. Oligontjcleottde primer sequences
Cytokine
Primer 5'-3'
Amplified Fragment (bp)
5'IL-la 3' IL-lct
GCCAATGACTCAGAGGAAGA TCTCAGGCATCTCCTTCAGC
328
5 3' 5' 3' 5 3'
TGTACAGGATGCAACTCCTG CAATGGTTGCTGTCTCATCAG CTCCTGCTCCAACTCCTGGT AGGCTCAAAGTCGTCTGTTG CCTCTGTTCTTCCTGCTAGC CCGTTTCAGGAATCGGATCA
402
IL-2 IL-2 IL-3 IL-3 IL-4 IL 4
425 300
5 IL-6 3' IL-6
TGAACTCCTTCTCCACAAGC ATCCAGATTGGAAGCATCCA
315
5' IL-10* 3' IL-10* 5TNF-a 3' TNF-a 5' IFN--/ 3' IFN-y
CTGAGAACCAAGACCCAGACATCAAGG CAATAAGGTTTCTCAAGGGGCTGGGTC TGAGCACTGAAAGCATGATC TTATCTCTCAGCTCCACGCC TCTGCATCGTTTTGGGTTCT CAGCTTTTCGAAGTCATCTC
35!
5 3' 5' 3'
TGCAGAGCCTGCTGCTCTTG CAAGCAGAAAGTCCTTCAGG CAGAGCCCCATGAAGCTGAT TATGGAGTTGGCTCAAGCAG
GM-CSF GM-CSF G CSF G-CSF
5' ^-aetin 3'^-actin
ATGGATGATGATATCGCCGCG CTAGAAGCATTTGCGGTGGAC
363 320 390 319 1126
* Ref. 7.
IL-la, IL-2. IL-3 and IFN-y was detectable already after 2 h. The rapid induction of these cytokine mRNA probably reflects the activation ofmemoryT cells [12] and the expression of these genes remained present throughout the entire period studied. IL-4 mRNA had a transient expression between 4 and 7 h. Lewis et al. reported IL-4 production to be restricted to a small population of polyclonally stimulated T cells, correlating with dramatically lower production of IL-4 mRNA and protein than of IL-2 and IFN-y [13]. Since receptors for iL-4are present on most haematopoetic cell types [14. 15] this might be a mechanism of restricting the plciotrophic effects of IL-4 to appropriate responder cells. lL-6 and GM-CSF mRNA were observed after 4-h stimulation and were subsequently present during the remaining time interval. This is In agreement with the finding of intracellular lL-6 protein in monocytes after 6 h of anli-C'D3stimuiated MNC [8]. One might speculate that the earlier expression of IL-6 mRNA in the stimulated cultures, as compared with the control cultures, is caused by the activation of Fc receptor positive monocytes through the cross-linking of
the igG anti-CD? antibodies on the T-cell surface [16]. IL-10 mRNA appeared after 7 h of stimulation and was still seen after 22 h. This relatively late expression of IL-10 compared with the other lymphokines was also reported for stimulation of monocytes by lipopolysaccharides [17]. The inhibitory properties of IL-10 on inflammation and cytokine secretion [18. 19] may explain the weaker signals for lL-2. IL-3 and GM-CSF observed at the 22-h time-point. During the entire time interval studied no G-CSF mRNA was ever detected. It has been reported by several authors that different stimuli of MNC each induce a distinct pattern of cytokine expression [20-22]. Recently it has been shown in skin biopsies from patients with leprosy that distinct patterns of cytokine expression correlated with resistance or susceptibility to the infection [23]. These results indicate that different patterns of cylokine gene expression may represent activation of different subpopulations of immunologically competent cells, which consequently may have a profound effect on the outcome of the immune response to an invading micro-organism [2]. To understand the mechanisms controlling the pattern of cyto-
748
E. K. Pisa et al.
0 HOURS
2 HOURS
4 HOURS
7 HOURS
22
HOURS
FIG. I. PCR assisled mRNA amplification of normal human MNC after anti-CD3 stimulation. Five independent donors gave similar results. From top to boUom: cells harvested 0, 2, 4. 7 and 22 h after activation.
kine gene expression will be of importance for designing immunization strategics, immunotherapy and in immunosuppression. Kor this
purpose, sensitive assays are needed to monitor the low and sometimes transient expression of cytokines. The present results show that the
0KT3-liuliifedmRNA kinetics of cytokine expression in activated MNC can be measured by PCR assisted mRNA amplification assay. In disease situations where T-cell activation is expected eg, tumour biopsies, rheumatoid tissue or infectious infiltrates, this is the method of choice for measuring cytokine gene expression.
11
12
13
ACKNOWLEDGMENTS This study was supported by grants from the Swedish Cancer Society, Schering-Plough AB. Sweden and the Swedish Societv of Medicine.
14
15
16
REFERENCES 1 Paul WE. Pleiotropy and redundancy: T cell-derived lymphokines iti the immune response. Cell 1989:57:521-4. 2 Salgame P, Abrams JS, Claybcrgcr Ccf
