Basic Research—Technology
Odontoblastic Differentiation, Inflammatory Response, and Angiogenic Potential of 4 Calcium Silicate–based Cements: Micromega MTA, ProRoot MTA, Retro MTA, and Experimental Calcium Silicate Cement Seok-Woo Chang, DDS, PhD,* Won-Jung Bae, MSD,† Jin-Kyu Yi, DMD, PhD,* Soojung Lee, DMD, PhD,‡ Deok-Won Lee, DMD, PhD,‡ Kee-Yeon Kum, DDS, PhD,‡ and Eun-Cheol Kim, DDS, PhD† Abstract Introudction: The aim of this study was to analyze the effects of different calcium silicate–based cements (CSCs) for pulp capping materials including MicroMega MTA (MMTA; MicroMega, Besanchon, France), Retro MTA (RMTA; BioMTA, Seoul, Korea), ProRoot MTA (PMTA; Dentsply, Tulsa, OK), and experimental CSC (ECSC) on odontoblastic differentiation, in vitro angiogenesis, and the inflammatory response in human dental pulp cells. Methods: Differentiation was evaluated by alkaline phosphatase activity, alizarin red staining, and reverse-transcriptase polymerase chain reaction (RT-PCR) for the marker genes. The levels of inflammatory mediators and cytokines were measured by RT-PCR and an enzyme-linked immunosorbent assay. In vitro angiogenesis was assessed by RT-PCR for angiogenic genes and an endothelial tube formation assay. Results: PMTA, MMTA, and ECSC increased the alkaline phosphatase activity and mineralization nodule formation and up-regulated messenger RNA (mRNA) expression of odontoblastic markers compared with RMTA. In addition, PMTA, MMTA, and ECSC upregulated the mRNA of angiogenic genes in human dental pulp cells and increased the capillary tube formation of endothelial cells compared with RMTA. However, all CSCs showed similar expression levels of inducible nitric oxide synthase and cyclooxygenase-2 protein as well as proinflammatory mediators such as nitric oxide, prostaglandin E2, tumor necrosis factor alpha, interleukin (IL)-1b, IL-6, and IL-8 mRNA. Conclusions: Taken together, our experimental results suggest that all CSCs are favorable materials for pulp capping, but PMTA, MMTA, and ECSC may be recommended over RMTA. (J Endod 2015;-:1–6)
Key Words Angiogenesis, dental pulp cells, differentiation, experimental calcium silicate cement, Micromega MTA, ProRoot MTA, Retro MTA
C
alcium silicate–based cements (CSCs), such as ProRoot mineral trioxide aggregate (PMTA; Dentsply, Tulsa, OK) and Portland cement, are mainly composed of hydrophilic particles of dicalcium and tricalcium silicate and tricalcium aluminate (1). MTA powder is essentially a mixture of Portland cement and bismuth (III) oxide and has been used successfully in dental applications for root perforation repair, 1-visit apexification, and pulp capping (2–4). We previously reported that MTA is superior to calcium hydroxide in terms of inducing the dentinogenic process in human pulp capping (5). However, MTA has some disadvantages, such as prolonged setting time, high cost, potential of discoloration, and poor handling (6). To reduce the setting time and extend its clinical use, new CSCs have been designed by adding different compounds (7, 8). Recently, MicroMega MTA (MMTA; MicroMega, Besanchon, France) was developed using tricalcium silicate, dicalcium silicate, tricalcium aluminate, bismuth oxide, calcium sulfate dehydrate, magnesium oxide, and calcium carbonate (8). The manufacturer proclaims that MMTA has a short setting time of 20 minutes because of the addition of calcium carbonate (CaCO3) (9). Moreover, we found that the biocompatibility, odontoblast differentiation, and inflammatory response of MMTA are all equal to those of PMTA (10). Retro MTA (RMTA; BioMTA, Seoul, Korea) is another newly introduced CSC. The manufacturer states that the composition of RMTA includes calcium carbonate (60%– 80%), silicon dioxide (5%–15%), aluminum oxide (5%–10%), and calcium zirconia complex (20%–30%) (11). According to the manufacturer, RMTA uses the calcium zirconia complex as a contrast media (radiopacifier). In addition, the manufacturer indicates that RMTA has a very short initial setting time of 180 seconds. Considering that the initial setting time of PMTA is 148 minutes (12), this is a substantially shorter time, and it can be clinically beneficial because a pulp capping material should set quickly to avoid being washed out by blood or tissue fluid (11). Experimental CSC (ECSC) is a provisionally manufactured Portland cement (Chonnam National University, Gwangju, Korea), which is produced in the laboratory by the formation and grinding of calcium silicate clinker and is mainly composed of tricalcium silicate and dicalcium silicate (13). A previous study reported that the setting time of
From the Departments of *Conservative Dentistry, †Oral and Maxillofacial Pathology and Research Center for Tooth and Periodontal Regeneration, and ‡Oral Physiology, School of Dentistry, Kyung Hee University, Seoul, Republic of Korea. Address requests for reprints to Dr Eun-Cheol Kim, Department of Oral and Maxillofacial Pathology and Research Center for Tooth and Periodontal Regeneration, School of Dentistry, Kyung Hee University, 1 Heogi-dong, Dongdaemun-gu, Seoul, 130-701, Republic of Korea. E-mail address: [email protected] 0099-2399/$ - see front matter Copyright ª 2015 American Association of Endodontists. http://dx.doi.org/10.1016/j.joen.2015.04.018
JOE — Volume -, Number -, - 2015
Effects of Various CSCs on Differentiation
1
Basic Research—Technology ECSC is 47 minutes, which is shorter than ProRoot MTA (13). Our previous report showed that ECSC contains 64.8% CaO and 21.6% SiO2, whereas PMTA contains 41.2% CaO and 19.4% SiO2 (14), indicating ECSC contains more silicon than PMTA. Although ECSC and PMTA showed similar cytotoxicity and cell morphology to the human osteosarcoma cell line MG-63 (13), the effects of ECSC on differentiation and its angiogenic potential for human dental pulp cells (HDPCs) are not known. Thus, the aim of this study was to investigate the biocompatibility, inflammatory response, and potential for odontogenic differentiation and in vitro angiogenesis of different CSCs, including PMTA, RMTA, MMTA, and ECSC compared with an intermediate restorative material (IRM; Dentsply Tulsa Dental, Tulsa, OK).
Materials and Methods Sample Preparation Under aseptic conditions, PMTA, RMTA, MMTA, and IRM were mixed with distilled water following the manufacturer’s instructions. ECSC was mixed with distilled water in a water-to-powder ratio of 1:3 (13). Each sample (6 mm in diameter and 2 mm in thickness) were left to incubate for 24 hours at 37 C in 100% humidity. The samples were placed in 24-well tissue culture plates, washed twice with phosphate-buffered solution, dried under laminar flow for 24 hours at room temperature, and sterilized by gamma radiation with 37.2 Gy before being used to culture cells. Cell Culture Immortalized HDPCs (courtesy of Professor Takashi Takata, Hiroshima University, Hiroshima, Japan) transfected with human telomerase catalytic component (15) were cultured in alpha-minimum essential medium supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 U/mL streptomycin in a humidified atmosphere of 5% CO2 at 37 C.
Alkaline Phosphatase Activity Assay Treated cells were washed with phosphate-buffered saline, and then the cell layers were scraped into a solution containing 20 mmol/L TrisHCl (pH = 8.0), 150 mmol/L NaCl, 1% Triton X-100 (Sigma-Aldrich, St Louis, MO), 0.02% NaN3, and 1 mg/mL aprotinin. The lysates were homogenized. Then, alkaline phosphatase (ALP) activity was assayed by spectrophotometric measurement (410 nm; Beckman Coulter, Fullerton, CA) of p-nitrophenol release at 37 C. To normalize protein expression to total cellular protein, a fraction of the lysate solution was used in a Bradford protein assay (n = 4). Alizarin Red Staining The cells were fixed in 70% ice-cold ethanol for 1 hour and rinsed with distilled water. The cells were then stained with 40 mmol/L alizarin red S (pH = 4.2) for 10 minutes under gentle agitation. RNA Isolation and Reverse-transcriptase Polymerase Chain Reaction The total RNA of the cells was extracted by using Trizol reagent (Life Technologies, Gaithersburg, MD) according to the manufacturer’s instructions. Then, 1 mg RNA was reverse transcribed for first-strand complementary DNA synthesis (Gibco BRL, Rockville, MD). The complementary DNA was amplified for 30 cycles in a DNA thermal cycler. The primer sequences are detailed in Table 1. The polymerase chain reaction products were resolved on a 1.5% agarose gel stained with ethidium bromide. Western Blot Analysis Cells were solubilized in a PRO-PREP protein extraction kit (Intron Biotechnology, Seongnam, Korea) for 20 minutes. An equal amount of protein for each sample was resolved by using 12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and then electrophoretically transferred onto a nitrocellulose membrane (Bio-Rad, Richmond, CA).
TABLE 1. Reverse-transcriptase Polymerase Chain Reaction Primers and Conditions Gene ON OPN OCN DSPP DMP-1 VEGF FGF-2 Ang-1 TNF-a IL-1b IL-6 IL-8 b-actin
Sequence (50 -30 )
Size (bp)
Temperature ( C)
Forward: GTGCAGCCTTTGTGTCCAAGCAGGA Reverse: CCGTAGAAGCGCCGATAGGCC Forward: CCCACAGACCCTTCCAAGTA Reverse: GGGGACAACTGGAGTGAAAA Forward: AGCCCTCACACTCCTCGCCCTAT Reverse: AGCCTGGTTCACCCCAGCTCA Forward: GCAAAAGTCCAGGACAGTGGGCC Reverse: GTCAAATTTCCACCTCAGTTGGCCA Forward: CACCAACACCACCCTTGGAGAGCA Reverse: TGCCCTTGTGGGGCACTCTCT Forward: CACCGCCTCGGCTTGTCACAT Reverse: CTGCTGTCTTGGGTGCATTGG Forward: GGCTTCTTCCTGCGCATCCA Reverse: GCTCTTAGCAGACATTGGAAGA Forward: GCTCCACACGTGGAACCGGA Reverse: GTGCAAGAAAGGAAAAAGGTCCGTG Forward: GGAAGACCCCTCCCAGATAG Reverse: CCCCAGGGACCTCTCTCTAA Forward: GGA TAT GGA GCA ACA AGT GG Reverse: ATG TAC CAG TTG GGG AAC TG Forward: TAG CCG CCC CAC ACA GAC AG Reverse: GGC TGG CAT TTG TGG TTG GG Forward: ATGACTTCCAAGCTGGCCGTGG Reverse: TGAATTCTCAGCCCTCTTCAAAAAC Forward: CATGGATGATGATATCGCCGCG Reverse: ACATGATCTGGGTCATCTTCTCG
196
62
244
60
301
60
342
61
346
65
404
58
354
60
140
59
413
52
288
60
408
60
297
62
371
55
Ang-1, angiopoietin 1; DMP-1, dentin matrix protein 1; DSPP, dentin sialophosphoprotein; FGF-2, fibroblast growth factor 2; IL, interleukin; OCN, osteocalcin; ON, osteonectin; OPN, osteopontin; TNF-a, tumor necrosis factor alpha.
2
Chang et al.
JOE — Volume -, Number -, - 2015
Basic Research—Technology The membrane was blocked with 5% skim milk and sequentially incubated with each primary antibody and secondary antibody followed by enhanced chemiluminescence detection (Amersham Pharmacia Biotech, Piscataway, NJ).
Enzyme-linked Immunosorbent Assay The nitric oxide (NO) and prostaglandin E2 (PGE2) concentrations in the culture supernatants were determined with an enzymelinked immunosorbent assay kit (R&D Systems, Minneapolis, MN) according to the manufacturer’s procedure. The plates were read at 450 nm on a microplate reader (Molecular Devices, Sunnyvale, CA).
In Vitro Angiogenesis Assay Human umbilical vein endothelial cells (HUVECs) obtained from American Type Culture Collection (Manassas, VA) were cultured in endothelial cell medium (ECM; ScienCell Research Laboratories, Carlsbad, CA) at 37 C under a 5% CO2 atmosphere. ECM Gel Solution (Cell Biolabs, San Diego, CA) of 50 mL was poured onto a 96-well culture plate and were allowed to solidify (37 C, 1 hour). HUVECs (1.5 104 cells/ well) were seeded on the ECM gel and cultured with condition medium obtained from CSC-treated HDPCs for 3 days. After 12 hours, tube formation was observed and quantified under a light microscope.
Statistical Analysis Differences among groups were analyzed using 1-way analysis of variance combined with the Bonferroni test. All values were expressed as mean standard deviation, and differences were considered significant at P < .05.
Results Effects of CSCs on Odontoblastic Differentiation of HDPCs To investigate the effects of CSCs on the odontoblastic differentiation of HDPCs, the ALP activity, formation of mineralized nodules,
and expression of odontoblast-related marker genes were measured. ALP activity and the formation of mineralized nodules were both increased with all CSCs but decreased with IRM (Fig. 1A and C). The most intense ALP activity and biomineralization were exhibited by the PMTA, MMTA, and ECSC groups at 7 and 14 days. In addition, all CSC materials were shown to up-regulate the messenger RNA (mRNA) expression of odontogenic markers such as osteonectin (ON), osteopontin (OPN), osteocalcin (OCN), dentin sialophosphoprotein (DSPP), and dentin matrix protein 1 (DMP-1) at 14 days (Fig. 1B). PMTA, MMTA, and ECSC showed similarly high levels of mRNA expression compared with the RMTA-treated groups. However, the expression of the marker genes in the IRM group were markedly less compared with the other groups.
Effects of CSCs on In Vitro Angiogenesis To examine the effects of CSCs on in vitro angiogenesis, mRNA expression of angiogenic factors in CSC-treated HDPCs and capillarylike structures formations in condition medium–treated HUVEC cells were examined (Fig. 2). The results showed that all CSCs increased the mRNA expression of vascular endothelial growth factor (VEGF), fibroblast growth factor 2, and angiopoietin 1 (Ang-1) (Fig. 2A) as well as the formation of anastomosed networks of human endothelial cell tubules (Fig. 2B). PMTA, MMTA, and ECSC induced a significant increase in the expression of angiogenic genes and capillary tube formation compared with RMTA (Fig. 2B and C). Effects of CSCs on Inflammatory Effects To evaluate the effect of CSCs on the inflammatory effects, the protein expression of inducible NO synthase and cyclooxygenase-2 (COX-2), which catalyzes the release of NO and PGE2, was examined in CSC-treated HDPCs. As shown in Figure 3A, the expressions of iNOS and COX-2 were similar among the CSCs; however, these levels were higher in the IRM group than in the CSC groups. The same results were obtained for the production of proinflammatory mediators NO and PGE2 (Fig. 3B and C). Moreover, mRNA
Figure 1. The effect of CSCs on odontoblastic differentiation in HDPCs. Differentiation was determined by (A) ALP activity, (B) mRNA expression by RT-PCR, and (C and D) mineralization nodule formation by alizarin red staining. (A–D) The cells were treated with an osteogenic supplement (OS) containing 50 mg/mL ascorbic acid and 10 mmol/L b-glycerophosphate. (D) The histogram shows the quantification of mineralization by densitometry and is presented as fold increase compared with nonstimulated control cells. These data are representative of 3 independent experiments. *Statistically significant difference compared with the control group (P < .05). #Statistically significant difference compared with each group (P < .05).
JOE — Volume -, Number -, - 2015
Effects of Various CSCs on Differentiation
3
Basic Research—Technology
Figure 2. The effects of CSCs on in vitro angiogenesis in HDPCs. (A) The mRNA expression levels of angiogenic genes were examined by RT-PCR from a 3-day culture of the HDPCs. Conditioned medium (CM) from the HDPCs was obtained by a 24-hour incubation period of CSCs. The angiogenic activity of CM was examined via a tube formation assay in HUVEC cells. (B) HUVEC cells were cultured in CM for 18 hours, and (C) the tube numbers were counted and quantified. Data are representative of 3 independent experiments. *Statistically significant difference compared with the control group (P < .05). #Statistically significant difference compared between each group (P < .05).
expression levels of proinflammatory cytokines tumor necrosis factor alpha, interleukin (IL)-1b, IL-6, and IL-8 were similar among the CSCs (Fig. 3D).
Discussion The differentiation and angiogenesis of progenitor cells into odontoblastlike cells are critical in the pulp healing process (16), and inducing differentiation and angiogenesis is required characteristics of pulp capping materials. We recently reported that odontoblastic differentiation of HDPCs was promoted by glutamine (17) and sodium triand hexametaphosphate (18). In addition, we showed that simvastatin and Emdogain (Biora AB, Malm€o, Sweden) improved cell growth and the differentiation of the bismuth oxide containing Portland cement in HDPCs (19). Moreover, the biocompatibility or inflammatory effects of pulp capping materials are important to avoid or limit pulp tissue irritation or degeneration. To our knowledge, this is the first study to examine the angiogenic and odontogenic potential of HDPCs with the newly developed RMTA, MMTA, and ECSC. ALP activity is most often used as an early marker of odontoblastic differentiation (20). In addition, the formation of mineral nodules and mRNA expression of DMP-1, DSPP, ON, OCN, and OPN have been used as markers of odontoblastic differentiation (21, 22). HDPCs in teeth can differentiate into odontoblasts when cultured in an osteogenic medium, even in the absence of dexamethasone, which is known to induce differentiation (23, 24). In the present study, PMTA, MMTA, and ECSC showed similar ALP activity, calcified nodule formation, and upregulation of odontoblastic markers such as ON, OPN, OCN, DSPP, and DMP-1 in HDPCs compared with RMTA and IRM at 7 and 14 days. Interestingly, RMTA showed the lowest odontogenic potential in the CSCs. These results are consistent with our previous study, which reported similar odontoblastic differentiation between MMTA and PMTA in HDPCs (10). The inorganic ions released from silicon4
Chang et al.
based materials have been found to influence cell proliferation and osteogenesis marker protein secretion (25). Angiogenesis is a key step in the dental pulp healing sequence that involves formation of the dentin bridge (16). This process is regulated by the interplay of angiogenic factors such as VEGF and fibroblast growth factor 2, which is essential for the odontoblast differentiation of immature pulp cells (20, 22). Ang-1 is another family of growth factors that plays an important role in vascular development (26). The secretion of angiogenic factors such as von Willebrand factor and Ang-1 can be promoted through the indirect contact of HDPCs with CSCs such as PMTA (27). HUVECs are a valuable model of in vitro angiogenesis because of their ability to form capillarylike structures called ‘‘tubes’’ in response to appropriate stimuli (28). Our results indicate that all CSCs upregulated angiogenic factors such as VEGF, fibroblast growth factor 2, and Ang-1 and enhanced the formation of capillarylike tubes, which suggests that all CSCs induce angiogenic activity in vitro. Moreover, PMTA, MMTA, and ECSC showed superior angiogenic gene expression levels as well as HUVEC capillary tube formation compared with RMTA. Therefore, PMTA, MMTA, and ECSC might be suitable pulp capping materials. MTA has been shown to be biocompatible and induces complete dentin bridge formation with no signs of inflammation in human pulp capping (5, 29). In contrast, PMTA has been shown to induce the up-regulation of proinflammatory cytokines as well as iNOS and COX2 in subcutaneous tissue in mice (30). PGE2 and nitrite are downstream products of arachidonic acid metabolism involving COX-2 and iNOS. PMTA significantly increased IL-1b and IL-8 secretion in human neutrophils (15). In this study, all CSCs exhibited similar expression levels of iNOS and COX2 as well as proinflammatory mediators such as NO, PGE2, tumor necrosis factor alpha, IL-1b, IL-6, and IL-8 compared with IRM, which suggests that all CSCs do not affect inflammatory mediators in HDPCs. This result was consistent with our previous report that cytokine JOE — Volume -, Number -, - 2015
Basic Research—Technology
Figure 3. The effects of CSCs on (A) iNOS and COX-2 expression, (B) NO, and (C) PGE2 levels, and (D) proinflammatory cytokine expression in HDPCs. The cells were cultured with each material for 72 hours. These findings are representative of 3 independent experiments. *Statistically significant difference compared with control (P < .05). #Statistically significant difference compared with each group (P < .05).
production or inflammatory response by CSCs such as PMTA and MMTA was not found in HDPCs (10). In summary, this study reports, for the first time, that PMTA, MMTA, and ECSC exhibit superior odontogenic differentiation and in vitro angiogenic potential compared with RMTA. These results suggest that PMTA, MMTA, and ECSC can be useful for dental pulp capping.
Acknowledgments Seok-Woo Chang and Won-Jung Bae contributed equally to this study. Supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MEST) (no. 2012R1A5A2051384). The authors deny any conflicts of interest related to this study.
References 1. MSDS. Available at: www.tulsadentalspecialties.com. Accessed December 29, 2014. 2. Lee SJ, Monsef M, Torabinejad M. Sealing ability of a mineral trioxide aggregate for repair of lateral root perforations. J Endod 1993;19:541–4. 3. Rafter M. Apexification: a review. Dent Traumatol 2005;21:1–8. 4. Park SJ, Heo SM, Hong SO, et al. Odontogenic effect of a fast-setting Pozzolan-based pulp capping material. J Endod 2014;40:1124–31. 5. Min KS, Park HJ, Lee SK, et al. Effect of mineral trioxide aggregate on dentin bridge formation and expression of dentin sialoprotein and heme oxygenase-1 in human dental pulp. J Endod 2008;34:666–70. 6. Wongkornchaowalit N, Lertchirakarn V. Setting time and flowability of accelerated Portland cement mixed with polycarboxylate superplasticizer. J Endod 2011;37: 387–9. 7. Chang SW, Lee SY, Ann HJ, et al. Effects of calcium silicate endodontic cements on biocompatibility and mineralization-inducing potentials in human dental pulp cells. J Endod 2014;40:1194–200.
JOE — Volume -, Number -, - 2015
8. Kum KY, Kim EC, Yoo YJ, et al. Trace metal contents of three tricalcium silicate materials: MTA Angelus, Micro Mega MTA and Bioaggregate. Int Endod J 2014;47: 704–10. 9. Available at: http://www.micro-mega.com. Accessed December 29, 2014. 10. Chang SW, Lee SY, Kum KY, Kim EC. Effects of ProRoot MTA, Bioaggregate, and Micromega MTA on odontoblastic differentiation in human dental pulp cells. J Endod 2014;40:113–8. 11. Available at: http://www.bioMTA.com. Accessed December 29, 2014. 12. Lovschall H, Illeman K, Schmidt OH, et al. Gillmore testing of initial setting time: iMTA, Dycal, Biodentine, and MTA. Presented at IADR/PER. September 10–13, 2014, Dubrovnik, Croatia. 13. Hwang YC, Kim DH, Hwang IN, et al. Chemical constitution, physical properties, and biocompatibility of experimentally manufactured Portland cement. J Endod 2011; 37:58–62. 14. Chang SW, Yoo HM, Park DS, et al. Ingredients and cytotoxicity of MTA and 3 kinds of Portland cements. Restor Dent Endod 2008;33:369–76. 15. Kitagawa M, Ueda H, Iizuka S, et al. Immortalization and characterization of human dental pulp cells with odontoblastic differentiation. Arch Oral Biol 2007;52:727–31. 16. Tran-Hung L, Mathieu S, About I. Role of human pulp fibroblasts in angiogenesis. J Dent Res 2006;85:819–23. 17. Kim DS, Jue SS, Lee SY, et al. Effects of glutamine on proliferation, migration, and differentiation of human dental pulp cells. J Endod 2014;40:1087–94. 18. Bae WJ, Jue SS, Kim SY, et al. Effects of sodium tri- and hexametaphosphate on proliferation, differentiation, and angiogenic potential of human dental pulp cells. J Endod 2015;41:896–902. 19. Lee SY, Min KS, Choi GW, et al. Effects of simvastain and enamel matrix derivative on Portland cement with bismuth oxide-induced growth and odontoblastic differentiation in human dental pulp cells. J Endod 2012;38:405–10. 20. Min KS, Lee YM, Hong SO, Kim EC. Simvastatin promotes odontoblastic differentiation and expression of angiogenic factors via heme oxygenase-1 in primary cultured human dental pulp cells. J Endod 2010;36:447–52. 21. Kim EC, Lee HJ, Kim Y. Lysyl oxidase and the lysyl oxidase-like protein modulate odontoblastic differentiation of human dental pulp cells. J Endod 2012;38:769–73. 22. Kim JJ, Kim SJ, Kim YS, et al. The role of SIRT1 on angiogenic and odontogenic potential in human dental pulp cells. J Endod 2012;38:899–906. 23. Kim YS, Min KS, Jeong DH, et al. Effects of fibroblast growth factor-2 on the expression and regulation of chemokines in human dental pulp cells. J Endod 2010;36: 1824–30.
Effects of Various CSCs on Differentiation
5
Basic Research—Technology 24. Lee SY, Kim SY, Park SH, et al. Effects of recombinant dentin sialoprotein in dental pulp cells. J Dent Res 2012;91:407–12. 25. Mladenovic Z, Johansson A, Willman B, et al. Soluble silica inhibits osteoclast formation and bone resorption in vitro. Acta Biomater 2014;10:406–18. 26. Miller TW, Isenberg JS, Roberts DD. Molecular regulation of tumor angiogenesis and perfusion via redox signaling. Chem Rev 2009;109:3099–124. 27. Chou MY, Kao CT, Hung CJ, et al. Role of the P38 pathway in calcium silicate cementinduced cell viability and angiogenesis-related proteins of human dental pulp cell in vitro. J Endod 2014;40:818–24.
6
Chang et al.
28. Matsui J, Wakabayashi T, Asada M, et al. Stem cell factor/c-kit signaling promotes the survival, migration, and capillary tube formation of human umbilical vein endothelial cells. J Biol Chem 2004;279:18600–7. 29. Nowicka A, Lipski M, Parafiniuk M, et al. Response of human dental pulp capped with biodentine and mineral trioxide aggregate. J Endod 2013;39: 743–7. 30. Reyes-Carmona JF, Santos AS, Figueiredo CP, et al. Host-mineral trioxide aggregate inflammatory molecular signaling and biomineralization ability. J Endod 2010;36: 1347–53.
JOE — Volume -, Number -, - 2015
Odontoblastic Differentiation, Inflammatory Response, and Angiogenic Potential of 4 Calcium Silicate–based Cements: Micromega MTA, ProRoot MTA, Retro MTA, and Experimental Calcium Silicate Cement Seok-Woo Chang, DDS, PhD,* Won-Jung Bae, MSD,† Jin-Kyu Yi, DMD, PhD,* Soojung Lee, DMD, PhD,‡ Deok-Won Lee, DMD, PhD,‡ Kee-Yeon Kum, DDS, PhD,‡ and Eun-Cheol Kim, DDS, PhD† Abstract Introudction: The aim of this study was to analyze the effects of different calcium silicate–based cements (CSCs) for pulp capping materials including MicroMega MTA (MMTA; MicroMega, Besanchon, France), Retro MTA (RMTA; BioMTA, Seoul, Korea), ProRoot MTA (PMTA; Dentsply, Tulsa, OK), and experimental CSC (ECSC) on odontoblastic differentiation, in vitro angiogenesis, and the inflammatory response in human dental pulp cells. Methods: Differentiation was evaluated by alkaline phosphatase activity, alizarin red staining, and reverse-transcriptase polymerase chain reaction (RT-PCR) for the marker genes. The levels of inflammatory mediators and cytokines were measured by RT-PCR and an enzyme-linked immunosorbent assay. In vitro angiogenesis was assessed by RT-PCR for angiogenic genes and an endothelial tube formation assay. Results: PMTA, MMTA, and ECSC increased the alkaline phosphatase activity and mineralization nodule formation and up-regulated messenger RNA (mRNA) expression of odontoblastic markers compared with RMTA. In addition, PMTA, MMTA, and ECSC upregulated the mRNA of angiogenic genes in human dental pulp cells and increased the capillary tube formation of endothelial cells compared with RMTA. However, all CSCs showed similar expression levels of inducible nitric oxide synthase and cyclooxygenase-2 protein as well as proinflammatory mediators such as nitric oxide, prostaglandin E2, tumor necrosis factor alpha, interleukin (IL)-1b, IL-6, and IL-8 mRNA. Conclusions: Taken together, our experimental results suggest that all CSCs are favorable materials for pulp capping, but PMTA, MMTA, and ECSC may be recommended over RMTA. (J Endod 2015;-:1–6)
Key Words Angiogenesis, dental pulp cells, differentiation, experimental calcium silicate cement, Micromega MTA, ProRoot MTA, Retro MTA
C
alcium silicate–based cements (CSCs), such as ProRoot mineral trioxide aggregate (PMTA; Dentsply, Tulsa, OK) and Portland cement, are mainly composed of hydrophilic particles of dicalcium and tricalcium silicate and tricalcium aluminate (1). MTA powder is essentially a mixture of Portland cement and bismuth (III) oxide and has been used successfully in dental applications for root perforation repair, 1-visit apexification, and pulp capping (2–4). We previously reported that MTA is superior to calcium hydroxide in terms of inducing the dentinogenic process in human pulp capping (5). However, MTA has some disadvantages, such as prolonged setting time, high cost, potential of discoloration, and poor handling (6). To reduce the setting time and extend its clinical use, new CSCs have been designed by adding different compounds (7, 8). Recently, MicroMega MTA (MMTA; MicroMega, Besanchon, France) was developed using tricalcium silicate, dicalcium silicate, tricalcium aluminate, bismuth oxide, calcium sulfate dehydrate, magnesium oxide, and calcium carbonate (8). The manufacturer proclaims that MMTA has a short setting time of 20 minutes because of the addition of calcium carbonate (CaCO3) (9). Moreover, we found that the biocompatibility, odontoblast differentiation, and inflammatory response of MMTA are all equal to those of PMTA (10). Retro MTA (RMTA; BioMTA, Seoul, Korea) is another newly introduced CSC. The manufacturer states that the composition of RMTA includes calcium carbonate (60%– 80%), silicon dioxide (5%–15%), aluminum oxide (5%–10%), and calcium zirconia complex (20%–30%) (11). According to the manufacturer, RMTA uses the calcium zirconia complex as a contrast media (radiopacifier). In addition, the manufacturer indicates that RMTA has a very short initial setting time of 180 seconds. Considering that the initial setting time of PMTA is 148 minutes (12), this is a substantially shorter time, and it can be clinically beneficial because a pulp capping material should set quickly to avoid being washed out by blood or tissue fluid (11). Experimental CSC (ECSC) is a provisionally manufactured Portland cement (Chonnam National University, Gwangju, Korea), which is produced in the laboratory by the formation and grinding of calcium silicate clinker and is mainly composed of tricalcium silicate and dicalcium silicate (13). A previous study reported that the setting time of
From the Departments of *Conservative Dentistry, †Oral and Maxillofacial Pathology and Research Center for Tooth and Periodontal Regeneration, and ‡Oral Physiology, School of Dentistry, Kyung Hee University, Seoul, Republic of Korea. Address requests for reprints to Dr Eun-Cheol Kim, Department of Oral and Maxillofacial Pathology and Research Center for Tooth and Periodontal Regeneration, School of Dentistry, Kyung Hee University, 1 Heogi-dong, Dongdaemun-gu, Seoul, 130-701, Republic of Korea. E-mail address: [email protected] 0099-2399/$ - see front matter Copyright ª 2015 American Association of Endodontists. http://dx.doi.org/10.1016/j.joen.2015.04.018
JOE — Volume -, Number -, - 2015
Effects of Various CSCs on Differentiation
1
Basic Research—Technology ECSC is 47 minutes, which is shorter than ProRoot MTA (13). Our previous report showed that ECSC contains 64.8% CaO and 21.6% SiO2, whereas PMTA contains 41.2% CaO and 19.4% SiO2 (14), indicating ECSC contains more silicon than PMTA. Although ECSC and PMTA showed similar cytotoxicity and cell morphology to the human osteosarcoma cell line MG-63 (13), the effects of ECSC on differentiation and its angiogenic potential for human dental pulp cells (HDPCs) are not known. Thus, the aim of this study was to investigate the biocompatibility, inflammatory response, and potential for odontogenic differentiation and in vitro angiogenesis of different CSCs, including PMTA, RMTA, MMTA, and ECSC compared with an intermediate restorative material (IRM; Dentsply Tulsa Dental, Tulsa, OK).
Materials and Methods Sample Preparation Under aseptic conditions, PMTA, RMTA, MMTA, and IRM were mixed with distilled water following the manufacturer’s instructions. ECSC was mixed with distilled water in a water-to-powder ratio of 1:3 (13). Each sample (6 mm in diameter and 2 mm in thickness) were left to incubate for 24 hours at 37 C in 100% humidity. The samples were placed in 24-well tissue culture plates, washed twice with phosphate-buffered solution, dried under laminar flow for 24 hours at room temperature, and sterilized by gamma radiation with 37.2 Gy before being used to culture cells. Cell Culture Immortalized HDPCs (courtesy of Professor Takashi Takata, Hiroshima University, Hiroshima, Japan) transfected with human telomerase catalytic component (15) were cultured in alpha-minimum essential medium supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 U/mL streptomycin in a humidified atmosphere of 5% CO2 at 37 C.
Alkaline Phosphatase Activity Assay Treated cells were washed with phosphate-buffered saline, and then the cell layers were scraped into a solution containing 20 mmol/L TrisHCl (pH = 8.0), 150 mmol/L NaCl, 1% Triton X-100 (Sigma-Aldrich, St Louis, MO), 0.02% NaN3, and 1 mg/mL aprotinin. The lysates were homogenized. Then, alkaline phosphatase (ALP) activity was assayed by spectrophotometric measurement (410 nm; Beckman Coulter, Fullerton, CA) of p-nitrophenol release at 37 C. To normalize protein expression to total cellular protein, a fraction of the lysate solution was used in a Bradford protein assay (n = 4). Alizarin Red Staining The cells were fixed in 70% ice-cold ethanol for 1 hour and rinsed with distilled water. The cells were then stained with 40 mmol/L alizarin red S (pH = 4.2) for 10 minutes under gentle agitation. RNA Isolation and Reverse-transcriptase Polymerase Chain Reaction The total RNA of the cells was extracted by using Trizol reagent (Life Technologies, Gaithersburg, MD) according to the manufacturer’s instructions. Then, 1 mg RNA was reverse transcribed for first-strand complementary DNA synthesis (Gibco BRL, Rockville, MD). The complementary DNA was amplified for 30 cycles in a DNA thermal cycler. The primer sequences are detailed in Table 1. The polymerase chain reaction products were resolved on a 1.5% agarose gel stained with ethidium bromide. Western Blot Analysis Cells were solubilized in a PRO-PREP protein extraction kit (Intron Biotechnology, Seongnam, Korea) for 20 minutes. An equal amount of protein for each sample was resolved by using 12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and then electrophoretically transferred onto a nitrocellulose membrane (Bio-Rad, Richmond, CA).
TABLE 1. Reverse-transcriptase Polymerase Chain Reaction Primers and Conditions Gene ON OPN OCN DSPP DMP-1 VEGF FGF-2 Ang-1 TNF-a IL-1b IL-6 IL-8 b-actin
Sequence (50 -30 )
Size (bp)
Temperature ( C)
Forward: GTGCAGCCTTTGTGTCCAAGCAGGA Reverse: CCGTAGAAGCGCCGATAGGCC Forward: CCCACAGACCCTTCCAAGTA Reverse: GGGGACAACTGGAGTGAAAA Forward: AGCCCTCACACTCCTCGCCCTAT Reverse: AGCCTGGTTCACCCCAGCTCA Forward: GCAAAAGTCCAGGACAGTGGGCC Reverse: GTCAAATTTCCACCTCAGTTGGCCA Forward: CACCAACACCACCCTTGGAGAGCA Reverse: TGCCCTTGTGGGGCACTCTCT Forward: CACCGCCTCGGCTTGTCACAT Reverse: CTGCTGTCTTGGGTGCATTGG Forward: GGCTTCTTCCTGCGCATCCA Reverse: GCTCTTAGCAGACATTGGAAGA Forward: GCTCCACACGTGGAACCGGA Reverse: GTGCAAGAAAGGAAAAAGGTCCGTG Forward: GGAAGACCCCTCCCAGATAG Reverse: CCCCAGGGACCTCTCTCTAA Forward: GGA TAT GGA GCA ACA AGT GG Reverse: ATG TAC CAG TTG GGG AAC TG Forward: TAG CCG CCC CAC ACA GAC AG Reverse: GGC TGG CAT TTG TGG TTG GG Forward: ATGACTTCCAAGCTGGCCGTGG Reverse: TGAATTCTCAGCCCTCTTCAAAAAC Forward: CATGGATGATGATATCGCCGCG Reverse: ACATGATCTGGGTCATCTTCTCG
196
62
244
60
301
60
342
61
346
65
404
58
354
60
140
59
413
52
288
60
408
60
297
62
371
55
Ang-1, angiopoietin 1; DMP-1, dentin matrix protein 1; DSPP, dentin sialophosphoprotein; FGF-2, fibroblast growth factor 2; IL, interleukin; OCN, osteocalcin; ON, osteonectin; OPN, osteopontin; TNF-a, tumor necrosis factor alpha.
2
Chang et al.
JOE — Volume -, Number -, - 2015
Basic Research—Technology The membrane was blocked with 5% skim milk and sequentially incubated with each primary antibody and secondary antibody followed by enhanced chemiluminescence detection (Amersham Pharmacia Biotech, Piscataway, NJ).
Enzyme-linked Immunosorbent Assay The nitric oxide (NO) and prostaglandin E2 (PGE2) concentrations in the culture supernatants were determined with an enzymelinked immunosorbent assay kit (R&D Systems, Minneapolis, MN) according to the manufacturer’s procedure. The plates were read at 450 nm on a microplate reader (Molecular Devices, Sunnyvale, CA).
In Vitro Angiogenesis Assay Human umbilical vein endothelial cells (HUVECs) obtained from American Type Culture Collection (Manassas, VA) were cultured in endothelial cell medium (ECM; ScienCell Research Laboratories, Carlsbad, CA) at 37 C under a 5% CO2 atmosphere. ECM Gel Solution (Cell Biolabs, San Diego, CA) of 50 mL was poured onto a 96-well culture plate and were allowed to solidify (37 C, 1 hour). HUVECs (1.5 104 cells/ well) were seeded on the ECM gel and cultured with condition medium obtained from CSC-treated HDPCs for 3 days. After 12 hours, tube formation was observed and quantified under a light microscope.
Statistical Analysis Differences among groups were analyzed using 1-way analysis of variance combined with the Bonferroni test. All values were expressed as mean standard deviation, and differences were considered significant at P < .05.
Results Effects of CSCs on Odontoblastic Differentiation of HDPCs To investigate the effects of CSCs on the odontoblastic differentiation of HDPCs, the ALP activity, formation of mineralized nodules,
and expression of odontoblast-related marker genes were measured. ALP activity and the formation of mineralized nodules were both increased with all CSCs but decreased with IRM (Fig. 1A and C). The most intense ALP activity and biomineralization were exhibited by the PMTA, MMTA, and ECSC groups at 7 and 14 days. In addition, all CSC materials were shown to up-regulate the messenger RNA (mRNA) expression of odontogenic markers such as osteonectin (ON), osteopontin (OPN), osteocalcin (OCN), dentin sialophosphoprotein (DSPP), and dentin matrix protein 1 (DMP-1) at 14 days (Fig. 1B). PMTA, MMTA, and ECSC showed similarly high levels of mRNA expression compared with the RMTA-treated groups. However, the expression of the marker genes in the IRM group were markedly less compared with the other groups.
Effects of CSCs on In Vitro Angiogenesis To examine the effects of CSCs on in vitro angiogenesis, mRNA expression of angiogenic factors in CSC-treated HDPCs and capillarylike structures formations in condition medium–treated HUVEC cells were examined (Fig. 2). The results showed that all CSCs increased the mRNA expression of vascular endothelial growth factor (VEGF), fibroblast growth factor 2, and angiopoietin 1 (Ang-1) (Fig. 2A) as well as the formation of anastomosed networks of human endothelial cell tubules (Fig. 2B). PMTA, MMTA, and ECSC induced a significant increase in the expression of angiogenic genes and capillary tube formation compared with RMTA (Fig. 2B and C). Effects of CSCs on Inflammatory Effects To evaluate the effect of CSCs on the inflammatory effects, the protein expression of inducible NO synthase and cyclooxygenase-2 (COX-2), which catalyzes the release of NO and PGE2, was examined in CSC-treated HDPCs. As shown in Figure 3A, the expressions of iNOS and COX-2 were similar among the CSCs; however, these levels were higher in the IRM group than in the CSC groups. The same results were obtained for the production of proinflammatory mediators NO and PGE2 (Fig. 3B and C). Moreover, mRNA
Figure 1. The effect of CSCs on odontoblastic differentiation in HDPCs. Differentiation was determined by (A) ALP activity, (B) mRNA expression by RT-PCR, and (C and D) mineralization nodule formation by alizarin red staining. (A–D) The cells were treated with an osteogenic supplement (OS) containing 50 mg/mL ascorbic acid and 10 mmol/L b-glycerophosphate. (D) The histogram shows the quantification of mineralization by densitometry and is presented as fold increase compared with nonstimulated control cells. These data are representative of 3 independent experiments. *Statistically significant difference compared with the control group (P < .05). #Statistically significant difference compared with each group (P < .05).
JOE — Volume -, Number -, - 2015
Effects of Various CSCs on Differentiation
3
Basic Research—Technology
Figure 2. The effects of CSCs on in vitro angiogenesis in HDPCs. (A) The mRNA expression levels of angiogenic genes were examined by RT-PCR from a 3-day culture of the HDPCs. Conditioned medium (CM) from the HDPCs was obtained by a 24-hour incubation period of CSCs. The angiogenic activity of CM was examined via a tube formation assay in HUVEC cells. (B) HUVEC cells were cultured in CM for 18 hours, and (C) the tube numbers were counted and quantified. Data are representative of 3 independent experiments. *Statistically significant difference compared with the control group (P < .05). #Statistically significant difference compared between each group (P < .05).
expression levels of proinflammatory cytokines tumor necrosis factor alpha, interleukin (IL)-1b, IL-6, and IL-8 were similar among the CSCs (Fig. 3D).
Discussion The differentiation and angiogenesis of progenitor cells into odontoblastlike cells are critical in the pulp healing process (16), and inducing differentiation and angiogenesis is required characteristics of pulp capping materials. We recently reported that odontoblastic differentiation of HDPCs was promoted by glutamine (17) and sodium triand hexametaphosphate (18). In addition, we showed that simvastatin and Emdogain (Biora AB, Malm€o, Sweden) improved cell growth and the differentiation of the bismuth oxide containing Portland cement in HDPCs (19). Moreover, the biocompatibility or inflammatory effects of pulp capping materials are important to avoid or limit pulp tissue irritation or degeneration. To our knowledge, this is the first study to examine the angiogenic and odontogenic potential of HDPCs with the newly developed RMTA, MMTA, and ECSC. ALP activity is most often used as an early marker of odontoblastic differentiation (20). In addition, the formation of mineral nodules and mRNA expression of DMP-1, DSPP, ON, OCN, and OPN have been used as markers of odontoblastic differentiation (21, 22). HDPCs in teeth can differentiate into odontoblasts when cultured in an osteogenic medium, even in the absence of dexamethasone, which is known to induce differentiation (23, 24). In the present study, PMTA, MMTA, and ECSC showed similar ALP activity, calcified nodule formation, and upregulation of odontoblastic markers such as ON, OPN, OCN, DSPP, and DMP-1 in HDPCs compared with RMTA and IRM at 7 and 14 days. Interestingly, RMTA showed the lowest odontogenic potential in the CSCs. These results are consistent with our previous study, which reported similar odontoblastic differentiation between MMTA and PMTA in HDPCs (10). The inorganic ions released from silicon4
Chang et al.
based materials have been found to influence cell proliferation and osteogenesis marker protein secretion (25). Angiogenesis is a key step in the dental pulp healing sequence that involves formation of the dentin bridge (16). This process is regulated by the interplay of angiogenic factors such as VEGF and fibroblast growth factor 2, which is essential for the odontoblast differentiation of immature pulp cells (20, 22). Ang-1 is another family of growth factors that plays an important role in vascular development (26). The secretion of angiogenic factors such as von Willebrand factor and Ang-1 can be promoted through the indirect contact of HDPCs with CSCs such as PMTA (27). HUVECs are a valuable model of in vitro angiogenesis because of their ability to form capillarylike structures called ‘‘tubes’’ in response to appropriate stimuli (28). Our results indicate that all CSCs upregulated angiogenic factors such as VEGF, fibroblast growth factor 2, and Ang-1 and enhanced the formation of capillarylike tubes, which suggests that all CSCs induce angiogenic activity in vitro. Moreover, PMTA, MMTA, and ECSC showed superior angiogenic gene expression levels as well as HUVEC capillary tube formation compared with RMTA. Therefore, PMTA, MMTA, and ECSC might be suitable pulp capping materials. MTA has been shown to be biocompatible and induces complete dentin bridge formation with no signs of inflammation in human pulp capping (5, 29). In contrast, PMTA has been shown to induce the up-regulation of proinflammatory cytokines as well as iNOS and COX2 in subcutaneous tissue in mice (30). PGE2 and nitrite are downstream products of arachidonic acid metabolism involving COX-2 and iNOS. PMTA significantly increased IL-1b and IL-8 secretion in human neutrophils (15). In this study, all CSCs exhibited similar expression levels of iNOS and COX2 as well as proinflammatory mediators such as NO, PGE2, tumor necrosis factor alpha, IL-1b, IL-6, and IL-8 compared with IRM, which suggests that all CSCs do not affect inflammatory mediators in HDPCs. This result was consistent with our previous report that cytokine JOE — Volume -, Number -, - 2015
Basic Research—Technology
Figure 3. The effects of CSCs on (A) iNOS and COX-2 expression, (B) NO, and (C) PGE2 levels, and (D) proinflammatory cytokine expression in HDPCs. The cells were cultured with each material for 72 hours. These findings are representative of 3 independent experiments. *Statistically significant difference compared with control (P < .05). #Statistically significant difference compared with each group (P < .05).
production or inflammatory response by CSCs such as PMTA and MMTA was not found in HDPCs (10). In summary, this study reports, for the first time, that PMTA, MMTA, and ECSC exhibit superior odontogenic differentiation and in vitro angiogenic potential compared with RMTA. These results suggest that PMTA, MMTA, and ECSC can be useful for dental pulp capping.
Acknowledgments Seok-Woo Chang and Won-Jung Bae contributed equally to this study. Supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MEST) (no. 2012R1A5A2051384). The authors deny any conflicts of interest related to this study.
References 1. MSDS. Available at: www.tulsadentalspecialties.com. Accessed December 29, 2014. 2. Lee SJ, Monsef M, Torabinejad M. Sealing ability of a mineral trioxide aggregate for repair of lateral root perforations. J Endod 1993;19:541–4. 3. Rafter M. Apexification: a review. Dent Traumatol 2005;21:1–8. 4. Park SJ, Heo SM, Hong SO, et al. Odontogenic effect of a fast-setting Pozzolan-based pulp capping material. J Endod 2014;40:1124–31. 5. Min KS, Park HJ, Lee SK, et al. Effect of mineral trioxide aggregate on dentin bridge formation and expression of dentin sialoprotein and heme oxygenase-1 in human dental pulp. J Endod 2008;34:666–70. 6. Wongkornchaowalit N, Lertchirakarn V. Setting time and flowability of accelerated Portland cement mixed with polycarboxylate superplasticizer. J Endod 2011;37: 387–9. 7. Chang SW, Lee SY, Ann HJ, et al. Effects of calcium silicate endodontic cements on biocompatibility and mineralization-inducing potentials in human dental pulp cells. J Endod 2014;40:1194–200.
JOE — Volume -, Number -, - 2015
8. Kum KY, Kim EC, Yoo YJ, et al. Trace metal contents of three tricalcium silicate materials: MTA Angelus, Micro Mega MTA and Bioaggregate. Int Endod J 2014;47: 704–10. 9. Available at: http://www.micro-mega.com. Accessed December 29, 2014. 10. Chang SW, Lee SY, Kum KY, Kim EC. Effects of ProRoot MTA, Bioaggregate, and Micromega MTA on odontoblastic differentiation in human dental pulp cells. J Endod 2014;40:113–8. 11. Available at: http://www.bioMTA.com. Accessed December 29, 2014. 12. Lovschall H, Illeman K, Schmidt OH, et al. Gillmore testing of initial setting time: iMTA, Dycal, Biodentine, and MTA. Presented at IADR/PER. September 10–13, 2014, Dubrovnik, Croatia. 13. Hwang YC, Kim DH, Hwang IN, et al. Chemical constitution, physical properties, and biocompatibility of experimentally manufactured Portland cement. J Endod 2011; 37:58–62. 14. Chang SW, Yoo HM, Park DS, et al. Ingredients and cytotoxicity of MTA and 3 kinds of Portland cements. Restor Dent Endod 2008;33:369–76. 15. Kitagawa M, Ueda H, Iizuka S, et al. Immortalization and characterization of human dental pulp cells with odontoblastic differentiation. Arch Oral Biol 2007;52:727–31. 16. Tran-Hung L, Mathieu S, About I. Role of human pulp fibroblasts in angiogenesis. J Dent Res 2006;85:819–23. 17. Kim DS, Jue SS, Lee SY, et al. Effects of glutamine on proliferation, migration, and differentiation of human dental pulp cells. J Endod 2014;40:1087–94. 18. Bae WJ, Jue SS, Kim SY, et al. Effects of sodium tri- and hexametaphosphate on proliferation, differentiation, and angiogenic potential of human dental pulp cells. J Endod 2015;41:896–902. 19. Lee SY, Min KS, Choi GW, et al. Effects of simvastain and enamel matrix derivative on Portland cement with bismuth oxide-induced growth and odontoblastic differentiation in human dental pulp cells. J Endod 2012;38:405–10. 20. Min KS, Lee YM, Hong SO, Kim EC. Simvastatin promotes odontoblastic differentiation and expression of angiogenic factors via heme oxygenase-1 in primary cultured human dental pulp cells. J Endod 2010;36:447–52. 21. Kim EC, Lee HJ, Kim Y. Lysyl oxidase and the lysyl oxidase-like protein modulate odontoblastic differentiation of human dental pulp cells. J Endod 2012;38:769–73. 22. Kim JJ, Kim SJ, Kim YS, et al. The role of SIRT1 on angiogenic and odontogenic potential in human dental pulp cells. J Endod 2012;38:899–906. 23. Kim YS, Min KS, Jeong DH, et al. Effects of fibroblast growth factor-2 on the expression and regulation of chemokines in human dental pulp cells. J Endod 2010;36: 1824–30.
Effects of Various CSCs on Differentiation
5
Basic Research—Technology 24. Lee SY, Kim SY, Park SH, et al. Effects of recombinant dentin sialoprotein in dental pulp cells. J Dent Res 2012;91:407–12. 25. Mladenovic Z, Johansson A, Willman B, et al. Soluble silica inhibits osteoclast formation and bone resorption in vitro. Acta Biomater 2014;10:406–18. 26. Miller TW, Isenberg JS, Roberts DD. Molecular regulation of tumor angiogenesis and perfusion via redox signaling. Chem Rev 2009;109:3099–124. 27. Chou MY, Kao CT, Hung CJ, et al. Role of the P38 pathway in calcium silicate cementinduced cell viability and angiogenesis-related proteins of human dental pulp cell in vitro. J Endod 2014;40:818–24.
6
Chang et al.
28. Matsui J, Wakabayashi T, Asada M, et al. Stem cell factor/c-kit signaling promotes the survival, migration, and capillary tube formation of human umbilical vein endothelial cells. J Biol Chem 2004;279:18600–7. 29. Nowicka A, Lipski M, Parafiniuk M, et al. Response of human dental pulp capped with biodentine and mineral trioxide aggregate. J Endod 2013;39: 743–7. 30. Reyes-Carmona JF, Santos AS, Figueiredo CP, et al. Host-mineral trioxide aggregate inflammatory molecular signaling and biomineralization ability. J Endod 2010;36: 1347–53.
JOE — Volume -, Number -, - 2015
