Phytomedicine 21 (2014) 448–452
Contents lists available at ScienceDirect
Phytomedicine journal homepage: www.elsevier.de/phymed
Short communication
Ocimum sanctum essential oil inhibits virulence attributes in Candida albicans Amber Khan a , Aijaz Ahmad c,1 , Immaculata Xess b , Luqman A. Khan a , Nikhat Manzoor a,∗ a b c
Medical Mycology Lab, Department of Biosciences, Jamia Millia Islamia, New Delhi, India Department of Microbiology, All India Institute of Medical Sciences, New Delhi, India Department of Pharmaceutical Sciences, Tshwane University of Technology, Arcadia Campus, Pretoria 0001, South Africa
a r t i c l e
i n f o
Article history: Received 27 May 2013 Received in revised form 18 September 2013 Accepted 17 October 2013 Keywords: Ocimum sanctum Essential oil Candida albicans Virulence Morphological transition Proteinase Phospholipase
a b s t r a c t Candida albicans is an opportunistic human fungal pathogen which causes disease mainly in immunocompromised patients. Activity of hydrolytic enzymes is essential for virulence of C. albicans and so is the capacity of these cells to undergo transition from yeast to mycelial form of growth. Ocimum sanctum is cultivated worldwide for its essential oil which exhibits medicinal properties. This work evaluates the anti-virulence activity of O. sanctum essential oil (OSEO) on 22 strains of C. albicans (including a standard strain ATCC 90028) isolated from both HIV positive and HIV negative patients. Candida isolates were exposed to sub-MICs of OSEO. In vitro secretion of proteinases and phospholipases was evaluated by plate assay containing BSA and egg yolk respectively. Morphological transition from yeast to filamentous form was monitored microscopically in LSM. For genetic analysis, respective genes associated with morphological transition (HWP1), proteinase (SAP1) and phospholipase (PLB2) were also investigated by Real Time PCR (qRT-PCR). Results were analyzed using Student’s t-test. OSEO inhibits morphological transition in C. albicans and had a significant inhibitory effect on extracellular secretion of proteinases and phospholipases. Expression profile of respective selected genes associated with C. albicans virulence by qRT-PCR showed a reduced expression of HWP1, SAP1 and PLB2 genes in cells treated with sub-inhibitory concentrations of OSEO. This work suggests that OSEO inhibits morphological transition in C. albicans and decreases the secretion of hydrolytic enzymes involved in the early stage of infection as well as down regulates the associated genes. Further studies will assess the clinical application of OSEO and its constituents in the treatment of fungal infections. © 2013 Elsevier GmbH. All rights reserved.
Introduction Candida albicans is an opportunistic fungal pathogen whose ability to become virulent is primarily determined by the immune status of the host. Major determinants of virulence are dimorphic switching (Yang, 2003), secretion of hydrolytic enzymes such as proteinases and phospholipases. These enzymes are responsible for adhesion, tissue damage and invasion of host tissues. Therefore, screening for compounds that inhibit hyphal growth and secretion of hydrolytic enzymes will lead to the development of new antifungal therapies. Plant-derived substances have recently gained tremendous attention due to their versatile applications. However, scientific information still falls short of their influences on microbial
∗ Corresponding author at: Department of Biosciences, Jamia Millia Islamia, New Delhi 110025, India. Tel.: +91 11 2698 1717x3410; fax: +91 11 2698 0229. E-mail address: [email protected] (N. Manzoor). 1 Present address. 0944-7113/$ – see front matter © 2013 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.phymed.2013.10.028
physiology and pathogenicity. Ocimum sanctum is widely used in the management of various diseases and its antifungal effects have been reported (Devkatte et al., 2005; Kumar et al., 2010). We have reported the chemical composition and antifungal efficacy of Ocimum sanctum essential oil (OSEO) against various Candida isolates (Khan et al., 2010a,b). In the present work we have investigated the effect of sub-inhibitory concentrations of previously used OSEO (methyl chavicol as lead component, Khan et al., 2010b,c) on virulence attributes of C. albicans. We studied the effect of OSEO on morphological transition and hydrolytic enzyme secretion in C. albicans isolated from various infection sites from both HIV positive and HIV negative patients. Materials and methods Essential oil used in the present study was obtained from leaves of Ocimum sanctum by hydrodistillation and characterized using detailed GC–MS analysis as reported earlier (Khan et al., 2010b). All inorganic chemicals were of analytical grade and procured from E. Merck (India).
A. Khan et al. / Phytomedicine 21 (2014) 448–452
449
Table 1 Primers and annealing temperatures used for RT-PCR for genes associated with pathogenicity of C. albicans. Gene
Primer sequence (5 →3 ) Forward primer
Reverse primer
ACT1 HWP1 SAP1 PLB2
TTTAAGAATTGATTTGGCT ATGACTCCAGCTGGTTC TCAATCAATTTACTCTTCCATTTTAACA GTGGGATCTTGCAGAGTTCAAGC
GAAGATTGAGAAGAAGTTT TAGATCAAGAATGCAGC CCA GTA GCA TTA ACA GGA GTT TTA ACA CTCAAAGCTCTCCCATAGACATCTG
Strains and culture conditions Selection of strains: 35 clinical strains of C. albicans used in our previous study (Khan et al., 2010b) were investigated for hydrolytic enzyme secretions and hyphal formation. Strains showing ability to induce germ tubes in Lee’s simplified media (LSM) at pH 6.5 and possessing very strong proteinase and phospholipase activity with Pz value < 0.6 were selected for the present study. Twenty two strains were thus investigated for the effect of sub-inhibitory concentrations (1/2 MIC, 1/4 MIC and 1/8 MIC) of OSEO on them. Yeast to hyphal transition To initiate hyphal development, Candida cells were grown in LSM. For zinc depletion and synchronous population growth, cells were grown in fresh plastic Erlenmeyer flasks and maintained for 48 h at 25 ◦ C. To induce hyphae formation, stationary phase G1 -singlets were transferred to fresh Lee’s media at 37 ◦ C at pH 6.5. Desired concentrations of OSEO (0.1 l/ml, 0.05 l/ml and 0.025 l/ml) were added to LSM. Every half hour, pH of medium was adjusted to 6.5 and cells were observed microscopically using Motic AE31 (Germany) by taking aliquots after every 30 min (Yousuf et al., 2011). Proteinase assay Proteinase activity was assayed as described previously (Yousuf et al., 2011). Briefly, Candida strains were exposed to different concentrations of OSEO (0.1 l/ml, 0.05 l/ml and 0.025 l/ml) for 5 min. Cells without any treatment serve as control. 2 l aliquots were placed on top of proteinase agar plate (0.1% yeast nitrogen base w/o amino acids; 0.145% ammonium sulfate; 2% glucose with 0.2% (w/v) BSA fraction V mixed into agar at ∼40 ◦ C). After incubation at 37 ◦ C for 3–4 days, plates were examined for proteinase secretion by measuring clear zones around the colonies. A Pz value of 1.0 depicts no enzyme activity. Pz =
diameter of the colony + zone of clearance diameter of the colony
Phospholipase assay Candida strains were assayed for extracellular phospholipase activity as described previously (Yousuf et al., 2011). Briefly, Candida cells were exposed to different concentrations of OSEO for 5 min. 2 l aliquots were overlaid, on phospholipase agar plates (1% peptone; 3% glucose; 5.73% NaCl; 0.055% CaCl2 with 10% (v/v) egg yolk emulsion [HiMedia]). After incubation for 2–4 days at 37 ◦ C, phospholipase secretion was determined by measuring precipitation zones around colonies. Zone of precipitation (Pz) was measured as described above. RNA extraction and qRT-PCR RNA extraction and gene expressions of HWP1, SAP1 and PLB2 genes in C. albicans (cells were exposed to 0.05 l/ml of OSEO or 1%
Annealing temp (◦ C)
48 59 60 54
DMSO (solvent control)) were performed as described previously (Ahmad et al., 2013). ACT1, a housekeeping gene, was used as an endogenous control. Primer sequences and annealing temperatures used for qRT-PCR are shown in Table 1. All qRT-PCR experiments were done in duplicate for all treated cell samples from two independent biological experiments.
Statistical analysis Student’s t-test was used to compare effect of OSEO with control in all the experiments. All experiments were performed in triplicate and results were determined as mean ± standard deviation.
Results OSEO used in the present study is high in methyl chavicol concentration followed by linalool (GC–MS characterized oil composition, Khan et al., 2010b). Indian O. sanctum has been distinguished into three chemotypes i.e., eugenol, methyl eugenol and caryophyllene (Verma et al., 2013) as variations in compositions due to geographical, seasonal and soil characteristics are very common (Bowes and Zheljazkov, 2004; Kumar et al., 2010, 2013). Even the method of harvesting and age of leaves at harvesting time (Kothari et al., 2004; Lewinsohn et al., 2000) plays a crucial role in EO composition. OSEO rich in methyl chavicol showed synergy with azoles (Khan et al., 2010c).
Yeast to hyphal transition Yeast to hyphal transition in C. albicans is strongly dependent on pH besides other factors. In control cells (untreated) at pH 6.5, germ tubes were visible only after 30 min. More than 90% cells were seen undergoing yeast to hyphal transition after 210 min (Fig. 1A). Sub-MICs of OSEO at sub-inhibitory concentrations showed potent inhibitory activity against yeast to hyphal transition. At ½ MIC (0.1 l/l) germ tubes were seen after 150 min of incubation when only
Contents lists available at ScienceDirect
Phytomedicine journal homepage: www.elsevier.de/phymed
Short communication
Ocimum sanctum essential oil inhibits virulence attributes in Candida albicans Amber Khan a , Aijaz Ahmad c,1 , Immaculata Xess b , Luqman A. Khan a , Nikhat Manzoor a,∗ a b c
Medical Mycology Lab, Department of Biosciences, Jamia Millia Islamia, New Delhi, India Department of Microbiology, All India Institute of Medical Sciences, New Delhi, India Department of Pharmaceutical Sciences, Tshwane University of Technology, Arcadia Campus, Pretoria 0001, South Africa
a r t i c l e
i n f o
Article history: Received 27 May 2013 Received in revised form 18 September 2013 Accepted 17 October 2013 Keywords: Ocimum sanctum Essential oil Candida albicans Virulence Morphological transition Proteinase Phospholipase
a b s t r a c t Candida albicans is an opportunistic human fungal pathogen which causes disease mainly in immunocompromised patients. Activity of hydrolytic enzymes is essential for virulence of C. albicans and so is the capacity of these cells to undergo transition from yeast to mycelial form of growth. Ocimum sanctum is cultivated worldwide for its essential oil which exhibits medicinal properties. This work evaluates the anti-virulence activity of O. sanctum essential oil (OSEO) on 22 strains of C. albicans (including a standard strain ATCC 90028) isolated from both HIV positive and HIV negative patients. Candida isolates were exposed to sub-MICs of OSEO. In vitro secretion of proteinases and phospholipases was evaluated by plate assay containing BSA and egg yolk respectively. Morphological transition from yeast to filamentous form was monitored microscopically in LSM. For genetic analysis, respective genes associated with morphological transition (HWP1), proteinase (SAP1) and phospholipase (PLB2) were also investigated by Real Time PCR (qRT-PCR). Results were analyzed using Student’s t-test. OSEO inhibits morphological transition in C. albicans and had a significant inhibitory effect on extracellular secretion of proteinases and phospholipases. Expression profile of respective selected genes associated with C. albicans virulence by qRT-PCR showed a reduced expression of HWP1, SAP1 and PLB2 genes in cells treated with sub-inhibitory concentrations of OSEO. This work suggests that OSEO inhibits morphological transition in C. albicans and decreases the secretion of hydrolytic enzymes involved in the early stage of infection as well as down regulates the associated genes. Further studies will assess the clinical application of OSEO and its constituents in the treatment of fungal infections. © 2013 Elsevier GmbH. All rights reserved.
Introduction Candida albicans is an opportunistic fungal pathogen whose ability to become virulent is primarily determined by the immune status of the host. Major determinants of virulence are dimorphic switching (Yang, 2003), secretion of hydrolytic enzymes such as proteinases and phospholipases. These enzymes are responsible for adhesion, tissue damage and invasion of host tissues. Therefore, screening for compounds that inhibit hyphal growth and secretion of hydrolytic enzymes will lead to the development of new antifungal therapies. Plant-derived substances have recently gained tremendous attention due to their versatile applications. However, scientific information still falls short of their influences on microbial
∗ Corresponding author at: Department of Biosciences, Jamia Millia Islamia, New Delhi 110025, India. Tel.: +91 11 2698 1717x3410; fax: +91 11 2698 0229. E-mail address: [email protected] (N. Manzoor). 1 Present address. 0944-7113/$ – see front matter © 2013 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.phymed.2013.10.028
physiology and pathogenicity. Ocimum sanctum is widely used in the management of various diseases and its antifungal effects have been reported (Devkatte et al., 2005; Kumar et al., 2010). We have reported the chemical composition and antifungal efficacy of Ocimum sanctum essential oil (OSEO) against various Candida isolates (Khan et al., 2010a,b). In the present work we have investigated the effect of sub-inhibitory concentrations of previously used OSEO (methyl chavicol as lead component, Khan et al., 2010b,c) on virulence attributes of C. albicans. We studied the effect of OSEO on morphological transition and hydrolytic enzyme secretion in C. albicans isolated from various infection sites from both HIV positive and HIV negative patients. Materials and methods Essential oil used in the present study was obtained from leaves of Ocimum sanctum by hydrodistillation and characterized using detailed GC–MS analysis as reported earlier (Khan et al., 2010b). All inorganic chemicals were of analytical grade and procured from E. Merck (India).
A. Khan et al. / Phytomedicine 21 (2014) 448–452
449
Table 1 Primers and annealing temperatures used for RT-PCR for genes associated with pathogenicity of C. albicans. Gene
Primer sequence (5 →3 ) Forward primer
Reverse primer
ACT1 HWP1 SAP1 PLB2
TTTAAGAATTGATTTGGCT ATGACTCCAGCTGGTTC TCAATCAATTTACTCTTCCATTTTAACA GTGGGATCTTGCAGAGTTCAAGC
GAAGATTGAGAAGAAGTTT TAGATCAAGAATGCAGC CCA GTA GCA TTA ACA GGA GTT TTA ACA CTCAAAGCTCTCCCATAGACATCTG
Strains and culture conditions Selection of strains: 35 clinical strains of C. albicans used in our previous study (Khan et al., 2010b) were investigated for hydrolytic enzyme secretions and hyphal formation. Strains showing ability to induce germ tubes in Lee’s simplified media (LSM) at pH 6.5 and possessing very strong proteinase and phospholipase activity with Pz value < 0.6 were selected for the present study. Twenty two strains were thus investigated for the effect of sub-inhibitory concentrations (1/2 MIC, 1/4 MIC and 1/8 MIC) of OSEO on them. Yeast to hyphal transition To initiate hyphal development, Candida cells were grown in LSM. For zinc depletion and synchronous population growth, cells were grown in fresh plastic Erlenmeyer flasks and maintained for 48 h at 25 ◦ C. To induce hyphae formation, stationary phase G1 -singlets were transferred to fresh Lee’s media at 37 ◦ C at pH 6.5. Desired concentrations of OSEO (0.1 l/ml, 0.05 l/ml and 0.025 l/ml) were added to LSM. Every half hour, pH of medium was adjusted to 6.5 and cells were observed microscopically using Motic AE31 (Germany) by taking aliquots after every 30 min (Yousuf et al., 2011). Proteinase assay Proteinase activity was assayed as described previously (Yousuf et al., 2011). Briefly, Candida strains were exposed to different concentrations of OSEO (0.1 l/ml, 0.05 l/ml and 0.025 l/ml) for 5 min. Cells without any treatment serve as control. 2 l aliquots were placed on top of proteinase agar plate (0.1% yeast nitrogen base w/o amino acids; 0.145% ammonium sulfate; 2% glucose with 0.2% (w/v) BSA fraction V mixed into agar at ∼40 ◦ C). After incubation at 37 ◦ C for 3–4 days, plates were examined for proteinase secretion by measuring clear zones around the colonies. A Pz value of 1.0 depicts no enzyme activity. Pz =
diameter of the colony + zone of clearance diameter of the colony
Phospholipase assay Candida strains were assayed for extracellular phospholipase activity as described previously (Yousuf et al., 2011). Briefly, Candida cells were exposed to different concentrations of OSEO for 5 min. 2 l aliquots were overlaid, on phospholipase agar plates (1% peptone; 3% glucose; 5.73% NaCl; 0.055% CaCl2 with 10% (v/v) egg yolk emulsion [HiMedia]). After incubation for 2–4 days at 37 ◦ C, phospholipase secretion was determined by measuring precipitation zones around colonies. Zone of precipitation (Pz) was measured as described above. RNA extraction and qRT-PCR RNA extraction and gene expressions of HWP1, SAP1 and PLB2 genes in C. albicans (cells were exposed to 0.05 l/ml of OSEO or 1%
Annealing temp (◦ C)
48 59 60 54
DMSO (solvent control)) were performed as described previously (Ahmad et al., 2013). ACT1, a housekeeping gene, was used as an endogenous control. Primer sequences and annealing temperatures used for qRT-PCR are shown in Table 1. All qRT-PCR experiments were done in duplicate for all treated cell samples from two independent biological experiments.
Statistical analysis Student’s t-test was used to compare effect of OSEO with control in all the experiments. All experiments were performed in triplicate and results were determined as mean ± standard deviation.
Results OSEO used in the present study is high in methyl chavicol concentration followed by linalool (GC–MS characterized oil composition, Khan et al., 2010b). Indian O. sanctum has been distinguished into three chemotypes i.e., eugenol, methyl eugenol and caryophyllene (Verma et al., 2013) as variations in compositions due to geographical, seasonal and soil characteristics are very common (Bowes and Zheljazkov, 2004; Kumar et al., 2010, 2013). Even the method of harvesting and age of leaves at harvesting time (Kothari et al., 2004; Lewinsohn et al., 2000) plays a crucial role in EO composition. OSEO rich in methyl chavicol showed synergy with azoles (Khan et al., 2010c).
Yeast to hyphal transition Yeast to hyphal transition in C. albicans is strongly dependent on pH besides other factors. In control cells (untreated) at pH 6.5, germ tubes were visible only after 30 min. More than 90% cells were seen undergoing yeast to hyphal transition after 210 min (Fig. 1A). Sub-MICs of OSEO at sub-inhibitory concentrations showed potent inhibitory activity against yeast to hyphal transition. At ½ MIC (0.1 l/l) germ tubes were seen after 150 min of incubation when only
