Gene. 114 (1992) 285-288 © 1992 Elsevier Science Publishers B.V. All rights reserved. 0378-1119/92/$05.00
285
GENE 06465
Novel vectors for expression of cDNA encoding epitope-tagged proteins in mammalian cells (Recombinant DNA; monoclonal antibodies; polymerase chain reactions; plasmids; phage T7 promoter; immunoprecipiration) Uttam K. Pati Division of Oncology. Department of Surgery. Yale University School of Medicine. New Haven. CT 06510 (USA) Received by R.E. Yasbin: I April 1991 Revised/Accepted: 10 January/15 January 1992 Received at publishers: 25 February 1992
SUMMARY
Two composite constructs, pNHA and pCHA, are described. These plasmids axe designed for the expression of cDNA in mammalian cells to produce proteins which are tagged with the hemagglutinin epitope sequence, YPYDVPDYA (HA 1). The insertion of eDNA into the multiple cloning sites of these vectors has the advantage of 'tagging' the produced protein at either the N terminus or C terminus. To demonstrate the utility of these vectors, pNHA, containing a full-length eDNA (pNHRP33), was expressed in HeLa cells to produce a HAl-tagged peptide. The resulting peptide was purified from the whole-cell extracts by immunoprecipitation with an antibody to the tag (mAbI2CAS). The mRNA was transcribed from a T7 promoter of the pNHRP33 construct, translated in a rabbit reticulocyte assay, and the protein product was purified using mAbI2CA5 for the HA! epitope. Among other possibilities, these vectors can be used to: (1) study protein-protein interactions in a mammalian transcriptioa unit, (2)co-purify associated transcription factors, and (3)purify produced proteins when antibodies are not available.
INTRODUCTION
Subunit recognition is a primary event in a multi-subunit protein assembly process. To study protein-protein recogCorrespondenceto: Dr. U.K. Pati at his present address: 2702, Research and Education Building,Medical College of Georgia, Augusta, GA 30912 (USA) Tel. (404)721-7667; Fax (404)721-7915. Abbreviations: aa, amino acid(s); Ap, ampicillin; BGH, bovine growth hormone; bp, base pair(s); CMV, cytomegalovirus; DMEM, Dulbecco's modified Eagle's medium; DTT, dithiothreitol; HAl, hemagglutinin epitope sequence YPYDVPDYA; hRPB33, human RNA polymerase B 33-kDa subunit; kb, kilobase(s) or 1000 bp; mAb, monoclonal antibody; MCS, multiple cloning site(s); Nm, neomycin; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; ori, origin of DNA replication; p, promoter; PAGE, polyacrylamide-gelelectrophoresis; PCR, polymerase chain reaction; PMSF, phenylmethylsulfonylfluoride; polIl, polymerase 11; R resistance/resistant; SDS, sodium dodecyl sulfate; TE, l0 mM Tris/! mM EDTA, pH 7.5.
nition patterns and to analyze the association of subunits in a complex system, it is desirable to co-express epitopetagged cDNAs in mammalian cells, and then to analyze the associated protein products by immuno-affinity techniques. The DNA fragment encoding a short epitope HA1 (influenza virus hemagglutinin peptide YPYDVPDYA) was successfully linked to a eDNA (Niman et al., 1983; Field et al., 1988) and the protein product was immunoprecipirated by an mAb, 12CA5 (BAbCo, La Jolla, CA) to the tag. This mAb also immunoprecipitated an HAl-tagged yeast RNA polIl subunit yRPB3 along with other polll subunits (Kolodziej et al., 1990). This paper describes the construction of two composite constructs, pNHA and pCHA, derived from a 5.4-kb CMV expression vector (Seed, 1987) (Invitrogen, San Diego, CA). These constructs retain important features such as a high-copy ColE1 ori, the CMV promoter, the Nm g (G418
286 HeLa cells, and the expressed protein products were purified by immunoprecipitation with mAbI2CAS.
resistance) and Ap g genes, and the M I 3 ori (to produce single-stranded DNA for mutagenesis), except that the MCS was replaced by a new one which includes the first ATG codon (with or without the Kozak consensus sequence (5'-TAACCACC), and the HAl epitope-encoding nt sequence, pNHA has a MCS which contains restriction sites BstXl, Notl, Xbal, and Apal, whereas the pCHA vector contains restriction sites Ybal, Nhel, Clal, and Hpal (Fig. 1). The cloning of cDNAs at these sites and their subsequent expression in HeLa cells result in the synthesis of proteins which are tagged at the N or C terminus. The vector pNHA, containing a full-length eDNA encoding the human RNA polll subunit hRPB33, was expressed in
EXPERIMENTAL AND DISCUSSION
(a) Construction of pNHRP33 The primers 33-1 (5'-ATCCATCACACTGGATGCCGTACGCCAACCAG-3') and 33-2 (5'-ATTCTAGATCAATTTATGGTTAGCACATC-3'), which annealed at opposite ends of the coding region ofhRPB33 cDNA (subcloned to the EcoRl site of pBluescript plasmid) (Pati and Weissman, 1990) were amplified by PCR (95°C, 1 min; 550C, 1 min; 72°C, 1.5 min; 1.5 mM Mg"+, 40 cycles).
3
2
1 M
....
i4P
;,= '~
:
(1) HtndI[I + BstXI
( .c/cMv 1 R~L.
A,° ~
(2)w / caselteI
~_..
kDa --106 -80
(1) H,~III + A#aI
.,,i',m"
_=
.,
casette2
" "
--32.5 --27.5
(. ,=o J
APR~ . ~ . ~ ~ orl
Fig. I.
mR
or/
Fig. 2.
Fig. I. Schematic diagram showing the construction of pNHA and pCHA. These composite constructs are derived from a 5.4-kb Rc/CMV expression vector (Seed, 1987) (Invitrogen, San Diego, CA) which retain important features such as the CMVp, a high-copy ColEi ori, the SP6 and T7p, the Nm a and Ap e" :;enes, and the M 13 ori for mutagenesis. Messages are polyadenylated with the BGH polyadenylation signal. The MCS in pNHA and pCHA contains the first ATG codon, the HAl epitope-encoding nt, and new restriction sites. A stop codon is supplied in pCHA vector. The vector Rc/CMV was digested with Hi~ldlll+BstXl or Hindlll+Apal. The digested DNA was loaded onto an agarose gel and the fragments were purified by Geneclean (BId 10 !, La Jolla, CA). The oligos (I) and (2) (5'-AGCTTATGTACCCATACGATGTTCCAGATTACGCTCCATCACA-3 °, and 3'-AATACATGGGTATGCTACAAGGTCTAATGCGAGGTA-5') were synthesized, and annealed to each other (60 mM Tris pH 7.4/10 mM MgCI2/5 mM DTT/ I mM spermidine, 90 ° C, 2 rain, followed by slow cooling) to prepare a DNA casett¢ (casctte I). The DNA casette was ligated to Hindlll+BstXl-digested Rc/CMV vector. In a similar manner, the oligos (3) and (4) (5'-AGCTTATGTCTAGAGCTAGCATCGATGTTAACTACCCATACGATGTTCCAGATTACGCTTGAGGGCC-3' and 3'-ATACAGATCTCGATCGTAGCTACAATTGATGGGTATGCTACAAGGTCTAATGCGAACTC5') ,, ~.re annealed, and the resulting casctte (casette 2) was ligatcd to H#~dlll+Apal.digested Rc/CMV vector. Fig. 2. Immunoprecipitation of N-terminus-tagged hRPB33 with mAbI2CA5 in HeLa cell extract and in rabbit reticulocyte translation mixture. The labeled whole-cell extract and the translation mixture from the rabbit reticulocyte system were immunoprecipitated with mAb 12CA5. The immunoprecipitated materials were boiled in SDS sample buffer (2% SDS/10% glycerol/80 mM Tris pH 6.8/2 mM PMSF) and loaded onto a 0.1% SDS-10% polyacrylamide gel. After electrophoresis, the gel was soaked in 0.5 M Na.salicylate for 30 rain, dried, and exposed to x-ray film. M, markers. Lanes: !, immunoprecipitation of [3sS]Met-Cys-labeled HeLa whole-cell extract expressing pNHRP33, 2, immunoprecipitation of HeLa whole-cell extract expressing pNHRP33 supplied with a Kozak (1987) sequence 5'-TAACCACC before the first ATG codon; 3, immunoprecipitation of [-~Ss]cysteine-labeled h RPB33 from the total translated product of pNHRP33.
287 The amplified DNA was purified by Geneclean (BIO 101, La Jolla, CA), digested with BstXl+Xbal, and subcloned in pNHA vector digested with BstXl+Xbal. The ligated mixture was transformed in competent cells, and the recombinant was selected in Ap. A large-scale preparation of the plasmid was carried over a Qiagen maxi prep column (Qiagen, Studio City, CA).
(b) In vitro transcription and translation Plasmid pNHRP33 was linearized with Xbal, and capped run-off transcripts were generated using T7 RNA polymerase (Nielsen and Shapiro, 1986). Transcription was monitored by 1% agarose gel electrophoresis. The transcript was treated with RNase-free DNase, extracted with phenol/chloroform mixture and ethanol-precipitated in the presence of ammonium acetate. The purified transcript was translated in a rabbit reticulocyte system [nuclease-treated rabbit reticulocyte lysate (Gibco BRL, Gaithersburg, MD) translation buffer contains 25 mM Hepes, pH 7.2/40 mM KCI/10 mM creatine phosphate/50/~g calf liver tRNA per ml/500 #M of each aa minus cysteine (Sigma)] in the presence of 10-15 #Ci/ml [35S]cysteine, and the translated product was immunoprecipitated with mAbl2CA5 as described in section e. The immunoprecipitated material was visualized as a 34-kDa band after electrophoresis on a 0.|% SDS-10% polyacrylamide gel and fluorography (Autofluor, National Diagnostics) (Fig. 2). In a similar manner, we immunoprecipitated Ku peptides ('Ku' is derived from the prototype patient's name) (Mimori et al., 1990) as a hetero dimer from a translation mixture of N terminus tagged Ku70 and Ku80 (M. Hirakata, U.K.P. and J.A. Hardin, unpublished results).
(c) Transfection of HeLa cells with lipofectin HeLa cells were plated in a 60-mm tissue culture dish in 5 ml DMEM and were incubated at 37°C until they were 50% confluent. Qiagen column-purified pNHRP33 (5 #g) in 50 #1 of water was added into 30 #g of lipofectin reagent (Gibco BRL, Gaithersburg, MD) (Feigner et al., 1987) in 50 #1 of water in a polystyrene snap cap tube. The complex was allowed to form with gentle agitation, and was allowed to stand for 15 min at room temperature. The cells were washed twice in 5 ml of serum-free DMEM. An additional 5 ml of serum-free medium was added to the cells followed by the slow addition of lipofectin reagent-DNA complex. The cells were incubated for 20 h at 37°C in a humidified, 5% CO2 environment. After 20 h, the serum-free medium was removed and the cells were supplemented with DMEM containing 10% fetal bovine serum. The cells were further incubated for 72 h after which colonies were selected in 700 #g G418/ml. Typically, more than 30 resistant colonies were isolated after a threeweek period.
(d) Specific amplification of DNA from HeLa cells by PCR The integration of a eDNA into HeLa cells was analyzed by PCR in the following way. HeLa cells containing pNHRP33 (106 cells) were suspended in 500 pl of TE buffer containing 1% SDS and proteinase K (100/~g/ml). The mixture was incubated for 2 h at 45 oC followed by sequential extraction with buffered phenol (x 3), phenol:chloroform (1:1) ( x 2), and chloroform. The genomic DNA was ethanol-precipitated in the presence of 0.3 M Na.acetate. A mixture of the primer CMV-I (5'-TGACGTCAATGGGAGTTTGTT-3', designed from the CMV promoter) and 33-2 (see section b) was amplified over 200 ng of genomic DNA in a PCR reaction (94°C, 2 min; 94°C, 1 rain; 54°C, 30 s; 72°C, 1 min; 25 cycles; 72°C, 5 min; 1.5 mM Mg 2 +), and the PCR product was analyzed on agarose gel. Identical bands were detected on agarose gel when the same primers were used over pNHRP33 in a control PCR reaction, whereas no band was detected using control HeLa cell DNA.
(e.) lmmunoprecipitation with mAbI2CA5 The HeLa cells (e.pprox. 5 x 107 cells) containing the recombinant pNHRP33 were labeled with [35S]methionine-cysteine (Du Pont, Wilmington, DE) at 10 pCi/ml of cells in DMEM (minus methionine and cysteine, ICN Biomedicals Inc., Irvine, CA) overnight. The cells were washed with TBS (10 mM Tris pH 7.5/150 mM NaCI) three times, suspended in 2 ml of IPP buffer (10 mM Tris pH 7.5/0.5 M NaCI/0.1% NP-40), and sonicated for 40 s on ice (x 3). The sonicated extract was centrifuged at 14 x 103 rpm for 30 min at 4°C. Aliquots of the supernatant were used immediately or frozen at -80 ° C. Protein A sepharose (2 mg) in 500 ~! of IPP buffer was incubated with 5 #1 of 12CA5 ascites fluid (from Dr. I.A., Wilson, Scripp's Clinic, La Jolla, CA) at 4°C overnight. The resins were washed ( x 3) with 1 ml of IPP buffer and were incubated with 100 #1 of cell extract in 500 #1 of IPP buffer for 4 h at 4°C. The beads were further washed ( x 3) with IPP buffer, suspended in 15 pl of SDS-sample buffer, boiled for 5 min, and loaded onto a 0.1% SDS-12% polyacrylamide gel. The SDSpolyacrylamide gel was soaked in 0.5 M Na.salicylate for 30 min, dried and exposed to x-ray film. The N terminus tagged hRPB33 was detected as a 34-kDa protein band on the gel (Fig. 2). No significant difference in band density was observed (Fig. 2) when a consensus Kozak (1987) sequence TAACCACC was introduced before the first ATG codon of hRPB33 eDNA.
(f) Conclusions (1) The eDNA encoding human polll subunit hRPB33 was successfully expressed in pNHA, and the HA 1-tagged protein product was immuno-precipitated with m Ab!2CA5 to the tag. The in vitro translation product and the HeLa
288
cell synthesized protein of pNHRP33 are identical on SDS-polyacrylamide gel (Fig. 2). (2) The vectors pNHA and pCHA will be useful to study protein-protein interactions in the field of eukaryotic transcriptional regulation processes, cDNAs encoding transcriptionally regulatory proteins can be co-expressed in these vectors, and associated transcription factors may be co-purified by immunoaffmity techniques. The small size of the epitope at the N or C terminus of the synthesized proteins is unlikely to interfere in the protein-protein interaction process. (3) These vectors can be used to express cDNAs in mammalian cells and the produced peptides can be purified when antibodies are not available. The elution of fusion peptides from the antibody column with the HA1 peptide should be possible under mild conditions. (4) The versatility of the MCS of pNHA and pCHA allows the peptide to be tagged either at the N or C terminus (in case any of the termini is sterically inaccessible to the mAb), for specific protein-protein interaction studies.
ACKNOW LEDG EM ENTS
I am grateful to Dr. Ian A. Wilson, Scripps Clinic, La Jolla, CA, for a kind gift of the mAbI2CA5.
REFERENCES Feigner, P.L., Gadek, T.R., Holm, M., Roman, R., Chan, H.W., Wenz, M., Northrop, J.P., Ringold, G.M. and Danielsen, M.: Lipofection: a highly efficient, lipid-mediated DNA-transfection procedure. Proc. Natl. Acad. Sci. USA 84 (1987) 7413-7417. Field, J., Nikawa, J.l., Brock, D., MacDonald, B., Rodgers, L., Wilson, I.A., Lerner, R.A. and Wigler, M.: Purification of a ras-responsive adenylyl cyclase complex from Sacc~aromycescerevisiae by use of an epitope addition method. Mol. Cell. Biol. 8 (1988) 2159-2165. Kolodziej, P.A., Woychic, N., Liao, S-M. and Young, R.A.: RNA polll subunit composition, stoichiometry, and phosphorylation. Moi. Cell. Biol. 10 (1990) 1915-1920, Kozak, M.: An analysis of 5'-noncoding sequences for 699 vertebrate messenger RNAs. Nucleic Acids Res. 15 (1987) 8125-8148. Mimori, T., Ohosone, Y., Hama, N., Suwa, A. Akizuki, M., Homma, M., Griffith, A.J. and Hardin, J.A.: Isolation and characterization of eDNA encoding the 80-kDa subunit protein ofthe human autoantigen Ku(p70/pS0) recognized by autoantibodies from patients with scleroderma-polymyositis overlap syndrome. Proc. Natl. Aead. Sci. USA 87 (1990) 1771-1781. Nielsen, D. and Shapiro, D.J.: Preparation of capped RNA transcripts using T7 RNA polymerase. Nucleic Acids Res. 14 (1986) 5936. Niman, H.L., Houghten, H.L., Walker, L.E., Reisfeld, R.A., Wilson, R.A., Hogle, J.M. and Lerner, R.A.: Generation of protein reactive antibodies by short peptides is an event of high frequency: implications for the structural basis of immune recognition. Proc. Natl. Acad. Sci. USA 80 (1983) 4949-4953. Pati, U.K. and Weissman, S.M.: The amino acid sequence of the human RNA polymerase !! subunit hRPB33 is highly conserved among eukaryotes. J. Biol. Chem. 265 (1990) 8400-8403. Seed, B.: An LFA-3 eDNA encodes a phospholipid-linked membrane protein homologous to its receptor CD2. Nature 329 (1987) 840-842.
285
GENE 06465
Novel vectors for expression of cDNA encoding epitope-tagged proteins in mammalian cells (Recombinant DNA; monoclonal antibodies; polymerase chain reactions; plasmids; phage T7 promoter; immunoprecipiration) Uttam K. Pati Division of Oncology. Department of Surgery. Yale University School of Medicine. New Haven. CT 06510 (USA) Received by R.E. Yasbin: I April 1991 Revised/Accepted: 10 January/15 January 1992 Received at publishers: 25 February 1992
SUMMARY
Two composite constructs, pNHA and pCHA, are described. These plasmids axe designed for the expression of cDNA in mammalian cells to produce proteins which are tagged with the hemagglutinin epitope sequence, YPYDVPDYA (HA 1). The insertion of eDNA into the multiple cloning sites of these vectors has the advantage of 'tagging' the produced protein at either the N terminus or C terminus. To demonstrate the utility of these vectors, pNHA, containing a full-length eDNA (pNHRP33), was expressed in HeLa cells to produce a HAl-tagged peptide. The resulting peptide was purified from the whole-cell extracts by immunoprecipitation with an antibody to the tag (mAbI2CAS). The mRNA was transcribed from a T7 promoter of the pNHRP33 construct, translated in a rabbit reticulocyte assay, and the protein product was purified using mAbI2CA5 for the HA! epitope. Among other possibilities, these vectors can be used to: (1) study protein-protein interactions in a mammalian transcriptioa unit, (2)co-purify associated transcription factors, and (3)purify produced proteins when antibodies are not available.
INTRODUCTION
Subunit recognition is a primary event in a multi-subunit protein assembly process. To study protein-protein recogCorrespondenceto: Dr. U.K. Pati at his present address: 2702, Research and Education Building,Medical College of Georgia, Augusta, GA 30912 (USA) Tel. (404)721-7667; Fax (404)721-7915. Abbreviations: aa, amino acid(s); Ap, ampicillin; BGH, bovine growth hormone; bp, base pair(s); CMV, cytomegalovirus; DMEM, Dulbecco's modified Eagle's medium; DTT, dithiothreitol; HAl, hemagglutinin epitope sequence YPYDVPDYA; hRPB33, human RNA polymerase B 33-kDa subunit; kb, kilobase(s) or 1000 bp; mAb, monoclonal antibody; MCS, multiple cloning site(s); Nm, neomycin; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; ori, origin of DNA replication; p, promoter; PAGE, polyacrylamide-gelelectrophoresis; PCR, polymerase chain reaction; PMSF, phenylmethylsulfonylfluoride; polIl, polymerase 11; R resistance/resistant; SDS, sodium dodecyl sulfate; TE, l0 mM Tris/! mM EDTA, pH 7.5.
nition patterns and to analyze the association of subunits in a complex system, it is desirable to co-express epitopetagged cDNAs in mammalian cells, and then to analyze the associated protein products by immuno-affinity techniques. The DNA fragment encoding a short epitope HA1 (influenza virus hemagglutinin peptide YPYDVPDYA) was successfully linked to a eDNA (Niman et al., 1983; Field et al., 1988) and the protein product was immunoprecipirated by an mAb, 12CA5 (BAbCo, La Jolla, CA) to the tag. This mAb also immunoprecipitated an HAl-tagged yeast RNA polIl subunit yRPB3 along with other polll subunits (Kolodziej et al., 1990). This paper describes the construction of two composite constructs, pNHA and pCHA, derived from a 5.4-kb CMV expression vector (Seed, 1987) (Invitrogen, San Diego, CA). These constructs retain important features such as a high-copy ColE1 ori, the CMV promoter, the Nm g (G418
286 HeLa cells, and the expressed protein products were purified by immunoprecipitation with mAbI2CAS.
resistance) and Ap g genes, and the M I 3 ori (to produce single-stranded DNA for mutagenesis), except that the MCS was replaced by a new one which includes the first ATG codon (with or without the Kozak consensus sequence (5'-TAACCACC), and the HAl epitope-encoding nt sequence, pNHA has a MCS which contains restriction sites BstXl, Notl, Xbal, and Apal, whereas the pCHA vector contains restriction sites Ybal, Nhel, Clal, and Hpal (Fig. 1). The cloning of cDNAs at these sites and their subsequent expression in HeLa cells result in the synthesis of proteins which are tagged at the N or C terminus. The vector pNHA, containing a full-length eDNA encoding the human RNA polll subunit hRPB33, was expressed in
EXPERIMENTAL AND DISCUSSION
(a) Construction of pNHRP33 The primers 33-1 (5'-ATCCATCACACTGGATGCCGTACGCCAACCAG-3') and 33-2 (5'-ATTCTAGATCAATTTATGGTTAGCACATC-3'), which annealed at opposite ends of the coding region ofhRPB33 cDNA (subcloned to the EcoRl site of pBluescript plasmid) (Pati and Weissman, 1990) were amplified by PCR (95°C, 1 min; 550C, 1 min; 72°C, 1.5 min; 1.5 mM Mg"+, 40 cycles).
3
2
1 M
....
i4P
;,= '~
:
(1) HtndI[I + BstXI
( .c/cMv 1 R~L.
A,° ~
(2)w / caselteI
~_..
kDa --106 -80
(1) H,~III + A#aI
.,,i',m"
_=
.,
casette2
" "
--32.5 --27.5
(. ,=o J
APR~ . ~ . ~ ~ orl
Fig. I.
mR
or/
Fig. 2.
Fig. I. Schematic diagram showing the construction of pNHA and pCHA. These composite constructs are derived from a 5.4-kb Rc/CMV expression vector (Seed, 1987) (Invitrogen, San Diego, CA) which retain important features such as the CMVp, a high-copy ColEi ori, the SP6 and T7p, the Nm a and Ap e" :;enes, and the M 13 ori for mutagenesis. Messages are polyadenylated with the BGH polyadenylation signal. The MCS in pNHA and pCHA contains the first ATG codon, the HAl epitope-encoding nt, and new restriction sites. A stop codon is supplied in pCHA vector. The vector Rc/CMV was digested with Hi~ldlll+BstXl or Hindlll+Apal. The digested DNA was loaded onto an agarose gel and the fragments were purified by Geneclean (BId 10 !, La Jolla, CA). The oligos (I) and (2) (5'-AGCTTATGTACCCATACGATGTTCCAGATTACGCTCCATCACA-3 °, and 3'-AATACATGGGTATGCTACAAGGTCTAATGCGAGGTA-5') were synthesized, and annealed to each other (60 mM Tris pH 7.4/10 mM MgCI2/5 mM DTT/ I mM spermidine, 90 ° C, 2 rain, followed by slow cooling) to prepare a DNA casett¢ (casctte I). The DNA casette was ligated to Hindlll+BstXl-digested Rc/CMV vector. In a similar manner, the oligos (3) and (4) (5'-AGCTTATGTCTAGAGCTAGCATCGATGTTAACTACCCATACGATGTTCCAGATTACGCTTGAGGGCC-3' and 3'-ATACAGATCTCGATCGTAGCTACAATTGATGGGTATGCTACAAGGTCTAATGCGAACTC5') ,, ~.re annealed, and the resulting casctte (casette 2) was ligatcd to H#~dlll+Apal.digested Rc/CMV vector. Fig. 2. Immunoprecipitation of N-terminus-tagged hRPB33 with mAbI2CA5 in HeLa cell extract and in rabbit reticulocyte translation mixture. The labeled whole-cell extract and the translation mixture from the rabbit reticulocyte system were immunoprecipitated with mAb 12CA5. The immunoprecipitated materials were boiled in SDS sample buffer (2% SDS/10% glycerol/80 mM Tris pH 6.8/2 mM PMSF) and loaded onto a 0.1% SDS-10% polyacrylamide gel. After electrophoresis, the gel was soaked in 0.5 M Na.salicylate for 30 rain, dried, and exposed to x-ray film. M, markers. Lanes: !, immunoprecipitation of [3sS]Met-Cys-labeled HeLa whole-cell extract expressing pNHRP33, 2, immunoprecipitation of HeLa whole-cell extract expressing pNHRP33 supplied with a Kozak (1987) sequence 5'-TAACCACC before the first ATG codon; 3, immunoprecipitation of [-~Ss]cysteine-labeled h RPB33 from the total translated product of pNHRP33.
287 The amplified DNA was purified by Geneclean (BIO 101, La Jolla, CA), digested with BstXl+Xbal, and subcloned in pNHA vector digested with BstXl+Xbal. The ligated mixture was transformed in competent cells, and the recombinant was selected in Ap. A large-scale preparation of the plasmid was carried over a Qiagen maxi prep column (Qiagen, Studio City, CA).
(b) In vitro transcription and translation Plasmid pNHRP33 was linearized with Xbal, and capped run-off transcripts were generated using T7 RNA polymerase (Nielsen and Shapiro, 1986). Transcription was monitored by 1% agarose gel electrophoresis. The transcript was treated with RNase-free DNase, extracted with phenol/chloroform mixture and ethanol-precipitated in the presence of ammonium acetate. The purified transcript was translated in a rabbit reticulocyte system [nuclease-treated rabbit reticulocyte lysate (Gibco BRL, Gaithersburg, MD) translation buffer contains 25 mM Hepes, pH 7.2/40 mM KCI/10 mM creatine phosphate/50/~g calf liver tRNA per ml/500 #M of each aa minus cysteine (Sigma)] in the presence of 10-15 #Ci/ml [35S]cysteine, and the translated product was immunoprecipitated with mAbl2CA5 as described in section e. The immunoprecipitated material was visualized as a 34-kDa band after electrophoresis on a 0.|% SDS-10% polyacrylamide gel and fluorography (Autofluor, National Diagnostics) (Fig. 2). In a similar manner, we immunoprecipitated Ku peptides ('Ku' is derived from the prototype patient's name) (Mimori et al., 1990) as a hetero dimer from a translation mixture of N terminus tagged Ku70 and Ku80 (M. Hirakata, U.K.P. and J.A. Hardin, unpublished results).
(c) Transfection of HeLa cells with lipofectin HeLa cells were plated in a 60-mm tissue culture dish in 5 ml DMEM and were incubated at 37°C until they were 50% confluent. Qiagen column-purified pNHRP33 (5 #g) in 50 #1 of water was added into 30 #g of lipofectin reagent (Gibco BRL, Gaithersburg, MD) (Feigner et al., 1987) in 50 #1 of water in a polystyrene snap cap tube. The complex was allowed to form with gentle agitation, and was allowed to stand for 15 min at room temperature. The cells were washed twice in 5 ml of serum-free DMEM. An additional 5 ml of serum-free medium was added to the cells followed by the slow addition of lipofectin reagent-DNA complex. The cells were incubated for 20 h at 37°C in a humidified, 5% CO2 environment. After 20 h, the serum-free medium was removed and the cells were supplemented with DMEM containing 10% fetal bovine serum. The cells were further incubated for 72 h after which colonies were selected in 700 #g G418/ml. Typically, more than 30 resistant colonies were isolated after a threeweek period.
(d) Specific amplification of DNA from HeLa cells by PCR The integration of a eDNA into HeLa cells was analyzed by PCR in the following way. HeLa cells containing pNHRP33 (106 cells) were suspended in 500 pl of TE buffer containing 1% SDS and proteinase K (100/~g/ml). The mixture was incubated for 2 h at 45 oC followed by sequential extraction with buffered phenol (x 3), phenol:chloroform (1:1) ( x 2), and chloroform. The genomic DNA was ethanol-precipitated in the presence of 0.3 M Na.acetate. A mixture of the primer CMV-I (5'-TGACGTCAATGGGAGTTTGTT-3', designed from the CMV promoter) and 33-2 (see section b) was amplified over 200 ng of genomic DNA in a PCR reaction (94°C, 2 min; 94°C, 1 rain; 54°C, 30 s; 72°C, 1 min; 25 cycles; 72°C, 5 min; 1.5 mM Mg 2 +), and the PCR product was analyzed on agarose gel. Identical bands were detected on agarose gel when the same primers were used over pNHRP33 in a control PCR reaction, whereas no band was detected using control HeLa cell DNA.
(e.) lmmunoprecipitation with mAbI2CA5 The HeLa cells (e.pprox. 5 x 107 cells) containing the recombinant pNHRP33 were labeled with [35S]methionine-cysteine (Du Pont, Wilmington, DE) at 10 pCi/ml of cells in DMEM (minus methionine and cysteine, ICN Biomedicals Inc., Irvine, CA) overnight. The cells were washed with TBS (10 mM Tris pH 7.5/150 mM NaCI) three times, suspended in 2 ml of IPP buffer (10 mM Tris pH 7.5/0.5 M NaCI/0.1% NP-40), and sonicated for 40 s on ice (x 3). The sonicated extract was centrifuged at 14 x 103 rpm for 30 min at 4°C. Aliquots of the supernatant were used immediately or frozen at -80 ° C. Protein A sepharose (2 mg) in 500 ~! of IPP buffer was incubated with 5 #1 of 12CA5 ascites fluid (from Dr. I.A., Wilson, Scripp's Clinic, La Jolla, CA) at 4°C overnight. The resins were washed ( x 3) with 1 ml of IPP buffer and were incubated with 100 #1 of cell extract in 500 #1 of IPP buffer for 4 h at 4°C. The beads were further washed ( x 3) with IPP buffer, suspended in 15 pl of SDS-sample buffer, boiled for 5 min, and loaded onto a 0.1% SDS-12% polyacrylamide gel. The SDSpolyacrylamide gel was soaked in 0.5 M Na.salicylate for 30 min, dried and exposed to x-ray film. The N terminus tagged hRPB33 was detected as a 34-kDa protein band on the gel (Fig. 2). No significant difference in band density was observed (Fig. 2) when a consensus Kozak (1987) sequence TAACCACC was introduced before the first ATG codon of hRPB33 eDNA.
(f) Conclusions (1) The eDNA encoding human polll subunit hRPB33 was successfully expressed in pNHA, and the HA 1-tagged protein product was immuno-precipitated with m Ab!2CA5 to the tag. The in vitro translation product and the HeLa
288
cell synthesized protein of pNHRP33 are identical on SDS-polyacrylamide gel (Fig. 2). (2) The vectors pNHA and pCHA will be useful to study protein-protein interactions in the field of eukaryotic transcriptional regulation processes, cDNAs encoding transcriptionally regulatory proteins can be co-expressed in these vectors, and associated transcription factors may be co-purified by immunoaffmity techniques. The small size of the epitope at the N or C terminus of the synthesized proteins is unlikely to interfere in the protein-protein interaction process. (3) These vectors can be used to express cDNAs in mammalian cells and the produced peptides can be purified when antibodies are not available. The elution of fusion peptides from the antibody column with the HA1 peptide should be possible under mild conditions. (4) The versatility of the MCS of pNHA and pCHA allows the peptide to be tagged either at the N or C terminus (in case any of the termini is sterically inaccessible to the mAb), for specific protein-protein interaction studies.
ACKNOW LEDG EM ENTS
I am grateful to Dr. Ian A. Wilson, Scripps Clinic, La Jolla, CA, for a kind gift of the mAbI2CA5.
REFERENCES Feigner, P.L., Gadek, T.R., Holm, M., Roman, R., Chan, H.W., Wenz, M., Northrop, J.P., Ringold, G.M. and Danielsen, M.: Lipofection: a highly efficient, lipid-mediated DNA-transfection procedure. Proc. Natl. Acad. Sci. USA 84 (1987) 7413-7417. Field, J., Nikawa, J.l., Brock, D., MacDonald, B., Rodgers, L., Wilson, I.A., Lerner, R.A. and Wigler, M.: Purification of a ras-responsive adenylyl cyclase complex from Sacc~aromycescerevisiae by use of an epitope addition method. Mol. Cell. Biol. 8 (1988) 2159-2165. Kolodziej, P.A., Woychic, N., Liao, S-M. and Young, R.A.: RNA polll subunit composition, stoichiometry, and phosphorylation. Moi. Cell. Biol. 10 (1990) 1915-1920, Kozak, M.: An analysis of 5'-noncoding sequences for 699 vertebrate messenger RNAs. Nucleic Acids Res. 15 (1987) 8125-8148. Mimori, T., Ohosone, Y., Hama, N., Suwa, A. Akizuki, M., Homma, M., Griffith, A.J. and Hardin, J.A.: Isolation and characterization of eDNA encoding the 80-kDa subunit protein ofthe human autoantigen Ku(p70/pS0) recognized by autoantibodies from patients with scleroderma-polymyositis overlap syndrome. Proc. Natl. Aead. Sci. USA 87 (1990) 1771-1781. Nielsen, D. and Shapiro, D.J.: Preparation of capped RNA transcripts using T7 RNA polymerase. Nucleic Acids Res. 14 (1986) 5936. Niman, H.L., Houghten, H.L., Walker, L.E., Reisfeld, R.A., Wilson, R.A., Hogle, J.M. and Lerner, R.A.: Generation of protein reactive antibodies by short peptides is an event of high frequency: implications for the structural basis of immune recognition. Proc. Natl. Acad. Sci. USA 80 (1983) 4949-4953. Pati, U.K. and Weissman, S.M.: The amino acid sequence of the human RNA polymerase !! subunit hRPB33 is highly conserved among eukaryotes. J. Biol. Chem. 265 (1990) 8400-8403. Seed, B.: An LFA-3 eDNA encodes a phospholipid-linked membrane protein homologous to its receptor CD2. Nature 329 (1987) 840-842.
