Vol. 56, No. 11

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 1990, p. 3420-3428

0099-2240/90/113420-09$02.00/0 Copyright © 1990, American Society for Microbiology

Novel Cloning Vectors for Bacillus thuringiensis JAMES A. BAUM,* DOLORES M. COYLE, M. PEARCE GILBERT, CHRISTINE S. JANY, AND CYNTHIA GAWRON-BURKE Ecogen Inc., 2005 Cabot Boulevard West, Langhorne, Pennsylvania 19047-1810 Received 28 June 1990/Accepted 22 August 1990

Seven replication origins from resident plasmids of Bacillus thuringienis subsp. kurstaki HD263 and HD73 cloned in Escherichia coli. Three of these replication origins, originating from plasmids of 43, 44, and 60 MDa, were used to construct a set of compatible shuttle vectors that exhibit structural and segregational stability in the Cry- strain B. thuringiensis HD73-26. These shuttle vectors, pEG597, pEG853, and pEG854, were designed with rare restriction sites that permit various adaptations, including the construction of small recombinant plasmids lacking antibiotic resistance genes. The crylA(c) and cryllA insecticidal crystal protein genes were inserted into these vectors to demonstrate crystal protein production in B. thuringiensis. Introduction of a cloned crylA(c) gene from strain HD263 into a B. thuringiensis subsp. aizawai strain exhibiting good insecticidal activity against Spodoptera exigua resulted in a recombinant strain with an improved spectrum of insecticidal activity. Shuttle vectors of this sort should be valuable in future genetic studies of B. thuringiensis as well as in the development of B. thuringiensis strains for use as microbial pesticides. were

approach will depend

The gram-positive soil bacterium Bacillus thuringiensis produces proteinaceous parasporal crystals that are toxic to a select variety of insect species. Over two dozen varieties of B. thuringiensis representing different flagellar antigens (5) and insecticidal activities against lepidopteran, dipteran, or coleopteran larvae have been identified (11). Since its introduction as a product in the early 1960s, B. thuringiensis has become the major biological pesticide in use worldwide, with several subspecies currently being used as active ingredients (3). The components of the parasporal crystals, often referred to as delta-endotoxins or insecticidal crystal proteins (ICPs), represent a diverse group of proteins that differ extensively in structure and insecticidal activity (11). The composition of ICPs found in B. thuringiensis strains varies considerably; even strains of the same serotype can exhibit substantial differences in insecticidal activity. ICPs are encoded by genes typically found on large plasmids (>30 MDa) (10, 13), some of which can be transferred conjugatively. Conjugal transfer of ICP-encoding plasmids has been successfully employed at the commercial level to construct B. thuringiensis strains with improved insecticidal activities (3). Although it provides a "natural" means of altering the ICP gene composition of B. thuringiensis, the use of conjugation is limited to mobilizable genes and strains that are amenable to conjugation and by plasmid incompatibility. A recombinant DNA approach to B. thuringiensis strain construction offers a greater degree of flexibility than that afforded by conjugation. Numerous ICP genes have been cloned, and their products have been assessed for insecticidal activity (11). In addition, an efficient transformation system for B. thuringiensis has been developed by employing electroporation (15, 17, 23). Thus, it should be possible to manipulate the production, regulation, and activity of ICPs by molecular genetic techniques and to construct improved B. thuringiensis strains for use as microbial pesticides. The success of this

*

on

the availability of suitable cloning

vectors.

In this report, we describe the cloning of seven replication origins derived from resident plasmids of B. thuringiensis subsp. kurstaki HD263 and HD73 and the construction of cloning vectors based on three of these replication origins. These vectors have features that should prove useful in the development of commercial strains of B. thuringiensis and in future genetic studies of this important organism. MATERIALS AND METHODS Bacterial strains and plasmids. B. thuringiensis subsp. kuirstaki HD263 and HD73 were obtained from the collection of Dulmage (8). Strain HD73-26 is a cured derivative of HD73 that contains a cryptic 4.9-MDa plasmid (7). Strain HD73-26-10 is an HD73-26 transconjugant strain containing a crylA(c) ICP-encoding 44-MDa plasmid from HD263 as well as the 4.9-MDa plasmid. Strain HD263-6 is a cured derivative of HD263 lacking the 44-MDa plasmid (2). B.

thuringiensis subsp. aizawai EG6346 is a cured derivative of strain EG6345 that contains several non-crylA ICP genes. Strain EG6345 contains, in addition to the ICP genes found in EG6346, a cryIA(b) gene located on a 45-MDa plasmid. Both EG6345 and EG6346 were obtained from the Ecogen strain collection. Escherichia coli TG1 (Amersham Corp.), XL-1 Blue (Stratagene Corp.), and GM2163 (kindly provided by New England BioLabs Inc.) were used as host strains for subcloning. Plasmids pTZ18u and pTZ19u (U.S. Biochemical Corp.) were used as cloning vectors. Plasmid pMI1101, which harbors the chloramphenicol acetyltransferase gene (cat) from pC194 (12), was a gift from Michelle Igo. DNA manipulations. Standard recombinant DNA procedures were performed as described by Maniatis et al. (19). Plasmids from B. thuringiensis HD73-26-10 and HD263-6 were isolated as described by Kronstad et al. (13). Plasmids from E. coli were prepared by a small-scale alkaline lysis procedure (19). For Southern blot analysis, DNAs were resolved on 1% agarose gels (Tris-phosphate buffer [19]) and transferred to Zeta-probe membranes (Bio-Rad Corp.) by using the alkaline blotting procedure recommended by the

Corresponding author. 3420

VOL. 56, 1990

~ ~. .

NOVEL CLONING VECTORS FOR B. THURINGIENSIS

manufacturer. Hybridization probes were prepared by using the random primer method of Feinberg and Vogelstein (9). Transformants of B. thuringiensis HD73-26 harboring recombinant plasmids were analyzed on 0.8% agarose gels by using a modified Eckhardt lysis procedure (10). For restriction enzyme analysis, B. thuringiensis transformants were grown for 6 h at 30°C in brain heart infusion (Difco) containing 0.5% glycerol. The cells were pelleted in a microfuge, frozen on dry ice, and thawed at room temperature. DNA was extracted from the cell pellets by using the E. coli alkaline lysis procedure. DNAs were sequenced according to the dideoxy chain termination method (22) with [cx-355]dATP and the Sequenase DNA sequencing kit (U.S. Biochemical Corp.). Sequencing templates were prepared from double-stranded DNA by procedures outlined in the Sequenase manual. Synthetic oligonucleotides were generated on an Applied Biosystems 380B DNA Synthesizer and purified by the oligonucleotide purification cartridge method recommended by the manufacturer. Transformation of B. thuringiensis. Transformation was performed by the electroporation procedure of Mettus and Macaluso (20) with the Bio-Rad Gene Pulser apparatus. Electroporated cells were grown in Luria broth containing 0.2 ,ug of chloramphenicol per ml for 1 to 2 h at 37°C before plating on NSM plates (23 g of Bacto nutrient agar per liter, 1 mM MgCl2, 0.7 mM CaCl2, 0.05 mM MnCl2) containing 5 ,ug of chloramphenicol per ml. Cloning of an ICP gene from HD263. A cryIA(c) gene located on the 44-MDa plasmid of B. thuringiensis HD263 was cloned in E. coli by using the bacteriophage cloning vector Lambda-Dash (Stratagene). Plasmid DNA from the transconjugant strain HD73-26-10, which harbors the 44MDa plasmid, was partially digested with MboI to yield DNA fragments in the 15- to 30-kb range. This DNA was then dephosphorylated with calf intestinal alkaline phosphatase (Boehringer Mannheim Corp.), ligated to BamHIdigested bacteriophage vector DNA, and packaged into phage particles by using packaging extracts prepared from E. coli BH2688 and BH2690 (19). Strain NM539 (Stratagene) was used as the host strain for phage propagation. Clones harboring the crylA(c) gene were identified by plaque hybridization with a 720-bp EcoRI fragment from the cryIA(a) gene of HD263 as a probe (unpublished data, this laboratory). The identity of the cryIA(c) gene was confirmed by restriction endonuclease mapping. ICP preparation and SDS-PAGE. B. thuringiensis strains were grown in M55 medium, which contained the following (per liter): 1.5 g of potato dextrose broth, 2.65 g of nutrient broth, 0.1 g of L-methionine, 330 [lI of 1 M MgCl2, 10 ,ul of 0.5 M MnCl2, and 50 ml of 20x M55 salts [176 g of NaCl, 100 g of K2HPO4, 100 g of KH2PO4, 13.3 g of (NH4)2SO4, and 4.2 g of citric acid per liter, 20 puM CuCI2 2H20, 20 p.M Na2MoO4, 20 puM Zn-sodium citrate)]. Strains were grown at 30°C for 3 days until fully sporulated and lysed. Sporecrystal preparations were examined by phase-contrast microscopy and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Samples (100 ,ul) from the lysed cultures were centrifuged for 5 min in a microfuge, and the pellets were washed once with 1 ml of 10 mM Tris hydrochloride (7.5)-l mM EDTA-1 mM EGTA. The sporecrystal suspensions were centrifuged again, and the resultant pellets were dried and suspended in 100 pul of 2x Laemmli buffer at 95°C for 5 min (14). Crystal proteins were resolved on either 7.5 or 10% gels. Crystal protein concentrations were determined by densitometry with a Molecular Dynam-

500 bp

plac cat EI -

_

ori

amp

........4.~~~~~pTZ1 8u

3421

f

-

E

S BSmEStKSmBXbSPSpH

FIG. 1. Linear restriction map of replicon cloning vector pEG588. An EcoRI fragment from pMI1101 harboring the chloramphenicol acetytransferase (cat) gene of pC194 (dark-shaded box) was inserted into the EcoRI site of the E. coli vector pTZ18u (light-shaded box) as shown. Restriction sites: B, BamHI; E, EcoRI; H, Hindlll; K, KpnI; P, PstI; S, Sall; S, SmaI; Sp, SphI; St, SstI; Xb, XbaI. Other abbreviations: f, fl phage replication origin; ori, replication origin of pTZ18u; amp, beta-lactamase gene; cat, chloramphenicol acetyltransferase gene.

ics model 300A computing densitometer and purified CryIA(c) and CryllA proteins as standards. Western blot analysis. Crystal proteins resolved on 7.5% SDS-polyacrylamide gels were transferred to nitrocellulose filters (Millipore HATF, 0.45-,um pore size) by electrophoresis in 12 mM Tris-96 mM glycine-20% (vol/vol) methanol. The filters were blocked by incubation in 5% (wt/vol) nonfat dry milk-10 mM Tris hydrochloride (pH 7.5)-0.9% (wt/vol) NaCl-0.09% (wt/vol) sodium azide for 1 h at room temperature. After a 10-min rinse in 0.3% Tween 80, the filters were incubated with CryIA(c) protein-specific antibodies at a 1:200 dilution in TBSN (10 mM Tris hydrochloride, 0.9% NaCl, 0.1% [wt/vol] globulin-free bovine serum albumin, 0.09% sodium azide, 0.05% [vol/vol] Triton X-405) for 1 h. After subsequent washes with TBSN, TBSN-0.05% SDS, and TBSN, the filters were incubated for several hours with a second antibody consisting of anti-mouse alkaline phosphatase-conjugated immunoglobulin G (Sigma Chemical Co.) at a 1:1,000 dilution in TBSN. After thorough washing with TBSN and double-distilled water, the alkaline phosphatase-specific color reaction was developed with 5-bromo4-chloro-3-indoyl phosphate and Nitro Blue Tetrazolium (Sigma). Bioassay. Activity against lepidopteran larvae was determined by topically applying 100 p1l of serially diluted sporecrystal preparations to 3 ml of an agar-based artificial diet in a plastic feeding cup (600-mm2 surface). One neonate larva was placed in each cup and scored for mortality after 7 days. Fifty percent lethal concentrations were determined by probit analysis as described by Daum (4) by an eight-dose testing procedure with 30 larvae per dose. The assays were performed in duplicate. RESULTS

Cloning of B. thuringiensis replication origins. To facilitate the cloning of B. thuringiensis plasmid replication origins, a plasmid was constructed that requires such sequences to replicate in B. thuringiensis. Briefly, a 1.5-kb EcoRI fragment from pMI1101 containing the cat gene of pC194 (12) was inserted into the EcoRI site of the E. coli cloning vector pTZ18u to provide a selectable marker that is functional in B. thuringiensis. The resultant construct, pEG588, containing the desired orientation of the cat gene is shown in Fig. 1. This plasmid, as expected, would not replicate in B. thuringiensis (data not shown). The resident plasmids of B. thuringiensis HD263 were

3422

BAUM ET AL.

APPL. ENVIRON. MICROBIOL.

TABLE 1. B. thuringiensis plasmid replication origin clones Clone

Clone

pEG588-2 pEG588-20a pEG588-4a pEG588-23a pEG599b pEG851'

pEG588-14a

Resident

plasmid" (MDa) 4.9 5.2 5.4 7.5 43 44 60

Insert size (kb)

6.8 6.0 6.2 5.4 2.8

2.25 2.3

a Resident B. thuringiensis plasmid from which the replication origin was derived. Only representative replication origin clones are listed. b Subcloned from pEG588-13a (Fig. 3). ' Subcloned from pEG588-8 (Fig. 3). S

$

S

07

FIG. 2. Southern blot analysis of resident plasmids in B. thuringiensis HD263-6 (A) and HD73-26-10 (B). CsCl gradient-purified plasmid DNAs were resolved by agarose gel electrophoresis and transferred to nylon membranes for hybridization analysis. The replication origin clones listed in Table 1, representing seven different B. thuringiensis plasmid replication origins, were used as hybridization probes: 1, pEG851; 2, pEG599; 3, pEG588-14a; 4, pEG588-23a; 5, pEG588-20a; 6, pEG588-4a; 7, pEG588-2. Final membrane washes were performed in 0.3x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-0.1% SDS at 65°C. L, linear DNA fragments; M, linear lambda DNA.

chosen as the source of plasmid replication origins. Strain HD263 contains resident plasmids of 130, 110, 60, 44, 43, 7.5, 5.4, 5.2, and 4.9 MDa (2). This strain also contains several ICP genes of the cryIA and cryII class, several of which have been cloned and characterized in our laboratory (6, 20; this report). To clone the replication origin from the 44-MDa plasmid of HD263, plasmid DNA from HD73-26-10 (a transconjugant strain harboring this plasmid and a 4.9MDa plasmid) was digested with MboI to yield DNA fragments in the 2- to 15-kb range. An equimolar concentration of this DNA was ligated to BamHI-digested pEG588, and the entire ligation reaction was used to transform the Cry- strain B. thuringiensis HD73-26 to chloramphenicol resistance (Cm'). Twenty-one Cmr transformants were recovered and analyzed on agarose gels for the presence of novel plasmids by using a modified Eckhardt lysis procedure (10). The novel recombinant plasmids were designated pEG588-1 through pEG588-21. The smallest B. thuringiensis replication origin insert among the 21 clones, isolated from plasmid pEG588-8 (see Fig. 3), was used as a hybridization probe for Southern blot analysis. Recombinant plasmids from 18 transformants hybridized strongly to the pEG588-8 probe (data not shown). A subclone of the replication origin fragment of pEG588-8, designated pEG851, was subsequently shown to hybridize to the 44-MDa plasmid in strain HD73-26-10 (Fig. 2). The three remaining Cmr transformants contained novel plasmids, designated pEG588-2, pEG588-18, and pEG588-21, that hybridized strongly on Southern blots to a hybridization probe consisting of the 4.9-MDa plasmid of strain HD73-26 (data not shown). These HD73-26 transformants also showed a reduction in, or absence of, the resident 4.9-MDa plasmid of strain HD73-26, suggesting that the novel plasmids exhibit some degree of incompatibility with the 4.9-MDa plasmid (data not shown). The replication origin fragment in pEG588-2 was subsequently shown to hybridize to the 4.9-MDa plasmid of strains HD73-26-10 and HD263-6 (Fig. 2). The replication origins of other plasmids derived from strain HD263 were obtained in similar fashion by using

plasmid DNA isolated from strain HD263-6, a cured derivative of HD263 lacking the 44-MDa plasmid. A total of 24 replication origin clones (pEG588-la through pEG588-24a) were obtained from HD263-6, and these were compiled into six distinct homology groups based on Southern blot analyses with replication origin inserts from several recombinant plasmids as hybridization probes (data not shown). Subsequently, the resident B. thuringiensis plasmid from which each homology group was derived was identified by Southern blot analysis of HD263-6 and HD73-26-10 plasmids by using the smallest replication origin insert of each homology group as a hybridization probe (Table 1, Fig. 2). Included in this analysis were the replication origin inserts in pEG851 and pEG588-2, derived from the 44- and 4.9-MDa plasmids, respectively. Interestingly, the replication origin fragments from the 4.9-, 7.5-, 43-, 44-, and 60-MDa plasmids showed no homology with other B. thuringiensis plasmids. The recombinant plasmid containing the replication origin fragment from the 5.4-MDa plasmid (pEG588-4a) showed partial homology to the 4.9-MDa plasmid but not vice versa. In addition, the recombinant plasmid containing the replication origin fragment from the 5.2-MDa plasmid (pEG588-20a) showed strong homology to the 43-MDa plasmid but not vice versa. Construction of B. thuringiensis-E. coli shuttle vectors. The smallest replication origin inserts obtained from the 43-, 44-, and 60-MDa plasmids of B. thuringiensis HD263 were contained on plasmids pEG588-13a, pEG588-8, and pEG58814a, respectively (Fig. 3). The replication origins from the 43- and 44-MDa plasmids were subsequently localized to smaller restriction fragments by subcloning directly into B. thuringiensis HD73-26. Plasmid pEG599, containing the replication origin from the 43-MDa plasmid (ori 43), consisted of a 2.8-kb XbaI fragment from pEG588-13a inserted into the XbaI site of pEG588 (Table 1, Fig. 3). Plasmid pEG851, containing the replication origin from the 44-MDa plasmid (ori 44), consisted of the 3.75-kb EcoRI-HindIII fragment of pEG588-8 inserted into pTZ19u (cleaved at the EcoRI and HindIII sites), thereby replacing the multiple cloning site of pTZ19u with a DNA fragment containing the cat gene and the B. thuringiensis replication origin (Table 1, Fig. 3). Plasmids pEG851, pEG599, and pEG588-14a were found to replicate stably in B. thuringiensis HD73-26: recombinants harboring these plasmids yielded 96 to 100% Cmr colonies after 18 generations in the absence of selection. Because of their apparent stability and the small size of their inserts, these three plasmids were selected for development as a set of compatible shuttle vectors. Figure 4 illustrates the strategy used to construct a B.

NOVEL CLONING VECTORS FOR B. THURINGIENSIS

VOL. 56, 1990

3423

1 kb

E

cat

*~s

pEG588-8

f

H

.4-

I

.

I,

6MEMEEmisw

I

*

Sp

cat

pEG851

XbS PSpH

s

*plac

ori 44

1.

cat s B

ori

amp

f

60

::......

E

f

.....

E

pTZ1 9u

H

sp

pTZ1 8u

~~~~~~~~~~~~~~~~~.

~

1

_

E

plac

amp

-

I.........................................

amp

plac

pEG588-14a I

I

H XbS PSpH

sp E

E

pTZI 8u

E

pEG588-1 3a cat E

-

S

P

H

H

Xb

E

I

I

I

I

I

I

plac

amp

f

I ZI.

Sp

Xb S P Sp H plac

amp 4

E

pTZ18U

ori 43

f

-40

Sp

E

cat

!~~

_

pEG599

pTZl 8u

~

I

B'S

E E Xb B Sm K St E Sm HD263. For clarity, the strain of plasmids 60-MDa and 44-, 43-, the from clones origin replication of maps restriction Linear 3. FIG. replication origins have been labeled ori 44 (44-MDa plasmid), ori 60 (60-MDa plasmid), and ori 43 (43-MDa plasmid). Light-shaded boxes represent pTZ18u or pTZ19u sequences. Dark-shaded boxes represent the cat gene fragment from pMI1101. Open boxes represent replication origin fragments from B. thuringiensis. Abbreviations for restriction endonuclease sites are given in the legend to Fig. 1. Plasmids pEG851 and pEG599 are subclones derived from plasmids pEG588-8 and pEG588-13a, respectively. H

Sp PS Xb

thuringiensis-E. coli shuttle vector based on the replication origin of the 44-MDa plasmid (ori 44). An SphI site located downstream of the cat gene on pEG851 was removed by digesting plasmid DNA with SphI, using T4 polymerase to remove the 3' overhangs, and ligating the blunt ends together. Subsequently, the EcoRI site was replaced with an NotI site by cleaving the plasmid with EcoRI and inserting an NotI linker with EcoRI-compatible ends. Finally, a multiple cloning site (MCS) was inserted at the unique HindIII site to yield the shuttle vector pEG597. The sequence and orientation of the MCS were confirmed by DNA sequence analysis. The pair of NotI sites in pEG597 allows for subsequent deletion of the pTZ19u segment from the vector, thereby converting the shuttle vector into a B. thuringiensis plasmid with a single antibiotic resistance gene. The pair of Sall sites enables recovery of a DNA fragment containing the B. thuringiensis replication origin and any gene inserted into the multiple cloning site. This feature provides a means of constructing an ICP-encoding plasmid composed entirely of B. thuringiensis DNA or, alternatively, a B. thuringiensis plasmid combined with a different selectable or nonselectable marker gene (see Discussion). The strategy used to construct shuttle vectors based on the replication origins isolated from the 60-MDa (ori 60) and 43-MDa (ori 43) plasmids is illustrated in Fig. 5. The replication origin from the 60-MDa plasmid is contained on a 2.3-kb fragment flanked by SalI sites in plasmid pEG588-14a (Fig. 3). In the process of cloning ori 60, the BamHI site present in pEG588 was restored at one end of the cloned

insert. The 2.3-kb Sall fragment was ligated to the 4.36-kb SalI fragment of pEG597 (Fig. 4), containing the cat gene and pTZ19u, to yield pEG852 (Fig. 5). An SfiI site was inserted at the XbaI site by using an SfiI-XbaI linker that restores the XbaI site on one side of the inserted linker. The desired orientation shown in Fig. 5 was selected by DNA sequence analysis. Subsequently, an MCS was inserted at the unique BamHI site to yield the shuttle vector pEG853. The orientation of the MCS was selected by restriction enzyme analysis and confirmed by sequence analysis. Subsequently, the 2.8-kb XbaI fragment from pEG599 (Fig. 3) was inserted in place of the 2.3-kb XbaI fragment of pEG853, thus replacing ori 60 with ori 43 to yield the shuttle vector pEG854 (Fig. 5). Plasmid pEG854 contained all of the restriction site modifications present in pEG853. In addition to the pairs of NotI and Sall sites found in pEG597, plasmids pEG853 and pEG854 also contained a pair of Sfil sites flanking the B. thuringiensis replication origin fragment and multiple cloning site. The pair of XbaI sites flanking the B. thuringiensis replication origin segment could be used to construct additional shuttle vectors, as illustrated by the construction of pEG854 (Fig. 5). The characteristics of shuttle vectors pEG597, pEG853, and pEG854 are listed in Table 2. Expression of crystal protein genes in B. thuyingiensis. To demonstrate the utility of vectors pEG597, pEG853, and pEG854 for expressing ICP genes in B. thuringiensis, two distinct crystal protein genes were inserted into each of the three plasmids. The first gene, cryIIA, previously referred to as cryBI (6), encodes the P2 delta-endotoxin or CrylIA ICP

3424

BAUM ET AL.

1 kb

~~~~.

cat > S

pEG851

E

orl

APPL. ENVIRON. MICROBIOL.

< Etlac

44

4.-

^ amp

H

Sp

f

......

pTZ19u

E

Sph I T4 POLYMERASE + dNTPs T4 LIGASE

E

H

S

E

I Eco RI INSERT Not I LINKER

N

H

S

N

I Hind III INSERT MCS

cat

orl 44

pEG597

plac

4-

'

amp-

4

f

.......................

N

l

S

ZpTZ1 9u

N

B X P St Sp Sm H E S N FIG. 4. Construction of shuttle vector pEG597. The figure depicts the strategy used to remove the SphI (Sp) site, replace the EcoRI (E) site with a Notl (N) site, and insert an MCS as described in Results. The sequence of the MCS (top strand), starting with the BamHI site, is 5' GGATCCCTCGAGCTGCAGGAGCTCGCATGCCCCGGGAAGCTTGAATTCGTCGACGCGGCCGC 3'. X, XhoI. Abbreviations for the remaining restriction endonuclease sites are given in the legend to Fig. 1.

that exhibits insecticidal activity against both lepidopteran and dipteran larvae (6, 24). The second gene, cryIA(c), encodes the P1 delta-endotoxin or CryIA(c) ICP, which exhibits relatively potent insecticidal activity against a variety of lepidopteran insect pests (11). The cryIIA gene, located on a 4.0-kb BamHI-HindIII fragment in pEG201 (6), was inserted into the BamHI and Hindlll sites of pEG597 to generate pEG864 (Table 2). The same gene was inserted as a 4.0-kb BamHI-HpaI fragment into the BamHI and HpaI sites of pEG853 and pEG854 to yield plasmids pEG858 and pEG862, respectively. The cryIA(c) gene, located on a 5.0-kb SphI-SalI fragment isolated from a bacteriophage clone of HD73-26-10 plasmid DNA (see Materials and Methods), was inserted into all three vectors at the SphI and XhoI sites to yield plasmids pEG863, pEG857, and pEG861. The six constructs are listed in Table 2. The ICP-encoding plasmids (Table 2) were introduced into the Cry- strain HD73-26 by electroporation, and the trans-

formants were examined for crystal protein production. Transformants were first characterized by restriction enzyme analysis of plasmid DNAs to confirm the structural stability of the recombinant plasmids (data not shown). Subsequently, the transformants were grown for 3 days at 30°C in M55 medium in the presence or absence of 5 ,ug of chloramphenicol per ml. Crystals harvested from the lysed cultures were viewed by phase-contrast microscopy and analyzed by SDS-PAGE (Fig. 6A). HD73-26 recombinants harboring either pEG858, pEG862, or pEG864 produced large rounded or cuboidal crystals, often larger than the spore, that yielded a -70-kDa protein on SDS gels. This protein comigrated with purified CrylIA crystal protein. Similarly, HD73-26 recombinants harboring either pEG857, pEG861, or pEG863 produced bipyramidal crystals typical of cryIA-type crystal proteins. The crystal protein from these recombinant strains comigrated with purified CryIA(c) crystal protein on SDS gels at an apparent molecular mass of -133 kDa (Fig. 6A).

~. . .

NOVEL CLONING VECTORS FOR B. THURINGIENSIS

VOL. 56, 1990

1 kb

S Xb

orl

B S l

60

+4Wac 60 plor

cat pEG852

f

amp

~...

SXb

N

SSfXb

-

pTZ19u

EBSN

H

N

INSERT Sfi I LINKER

EBSN

H

l

Xba I

I

N

3425

N

Bam H I

INSERT MCS

j

ptac

orl 60

cat

4.,-,

-

pEG853

S Sf Xb

N

H

f

amp 4

-

-..

pTZ19u

E

N

Xb P KSm AvBX St C Hp Sp Eg Sf SN (MCS) Xba I REPLACE ORI 60 FRAGMENT WITH Xba I FRAGMENT FROM pEG599 CONTAINING ORI 43

cat

orl 43

pEG854

plac .4...........

N

amp ~-

f -~

......................

N

S Sf Xb

Xb P KSmAvBX St CHp Sp Eg SfSN FIG. 5. Construction of shuttle vectors pEG853 and pEG854. The 2.3-kb Sall fragment (ori 60) from pEG588-14a was ligated to the 4.35-kb SalI fragment (pTZ19u-cat) from pEG597 to give pEG852. An Sfil (Sf) site was inserted at the XbaI (Xb) site, and an MCS was inserted at the BamHI (B) site as shown to give pEG853. Removal of ori 60 by XbaI digestion and insertion of the 2.8-kb XbaI fragment (ori 43) from pEG599 (Fig. 3) yielded pEG854. The sequence of the multiple cloning site (top strand), starting with the XbaI site, is 5' TCTAGACTG CAGGTACCCGGGCCTAGGATCCCTCGAGCTCATCGATGTTAACGCATGCGGCCGATCGGGCCGATCCGTCGACGCGGCCGC 3'. Av, AvrII; C, Clal; Eg, EagI; Hp, HpaI. Abbreviations for the remaining restriction sites are given in the legend to Fig. 1.

Plasmid pEG863 (Table 2) contained both the replication origin and the cryIA(c) gene from the 44-MDa plasmid of strain HD263. Strains HD73-26(pEG863) and HD73-26-10 (containing the 44-MDa plasmid) were used to compare the levels of CryIA(c) protein produced by identical genes located on related native and recombinant plasmids in the same host background. SDS-PAGE of crystal preparations from strains HD73-26(pEG863) and HD73-26-10 indicated that pEG863 and the 44-MDa plasmid yielded similar levels of CryIA(c) protein (Fig. 6B). Production of crystal protein in the recombinant strains

not noticeably affected by the presence or absence of chloramphenicol, suggesting that the ICP-encoding plasmids replicate stably. In subsequent stability tests, HD73-26 recombinants containing ICP-encoding plasmids derived from pEG597 yielded 70 to 80% Cmr colonies after 18 generations in the absence of selection, whereas recombinants containing ICP-encoding plasmids derived from pEG853 or pEG854 yielded 97 to 99% Cmr colonies after 18 generations in the absence of selection. Introduction of crylA(c) into a complex strain background. An ICP-encoding recombinant plasmid was introduced into a

was

3426

BAUM ET AL.

APPL. ENVIRON. MICROBIOL.

TABLE 2. Shuttle vectors and derivatives Plasmid

Size (kb)

Relevant characteristics

pEG597 pEG853 pEG854 pEG863 pEG864 pEG857 pEG858 pEG861 pEG862

6.6 6.6 7.2 11.6 10.6 11.6 10.6 12.2 11.2

Contains ori 44 Contains ori 60 Contains ori 43 pEG597 + cryIA(c), ori 44 pEG597 + cryIIA, ori 44 pEG853 + cryIA(c), ori 60 pEG853 + cryIIA, ori 60 pEG854 + cryIA(c), ori 43 pEG854 + cryIIA, ori 43

B. thuringiensis strain harboring multiple ICP genes to examine the effect of the cloned ICP gene on insecticidal activity. Specifically, plasmid pEG863 [containing crylA(c)] was introduced into strain EG6346, a novel B. thuringiensis strain that exhibits good insecticidal activity against Spodoptera exigua but lacks cryIA-type genes. For comparison, the related strain EG6345 (see Materials and Methods) was also tested in the bioassay. Spore-crystal preparations of EG6345, EG6346, and the recombinant strain EG6346 (pEG863) were prepared from lysed M55 cultures and examined by SDS-PAGE (Fig. 7A) and Western blot analysis (Fig. 7B). Western blot analysis with CryIA(c) protein-specific antibodies confirmed that CryIA(c) protein was produced in the recombinant strain EG6346(pEG863) but not in strains EG6345 and EG6346 (Fig. 7B). Interestingly, CryIA(c) production appeared to be higher in the recombinant strain HD73-26(pEG863). The spore-crystal preps were used directly in quantitative bioassays against a variety of insect species (Table 3). Introduction of pEG863 into EG6346 enhanced the insecticidal activity of the strain against Heliothis zea, Heliothis virescens, Trichoplusia ni, Ostrinia

-

A

D073-26 RECOMBRIA

FIG.

6.

a

40 t4c

SDS-PAGE analysis of spore-crystal preparations from

HD73-26 recombinant strains

harboring crystal protein genes. (A) recombinant plasmids produce a CryIA-type protein, whereas strains harboring cryIIA -containing recombinant plasmids produce a CrylIA-type protein. Recombinant strains are designated according to ICP-encoding plasmids as listed in Table 2. Purified P1 [CrylA(c)] and P2 (CryIlA) crystal proteins were included as standards. M55 cultures were Strains

harboring

cryIA(c)-containing

grown in the presence per

ml.

(+) or absence (-) of 5 p.g of chloramphenicol (B) Strains HD73-26(pEG863) and HD73-26-10 produce

comparable levels of CryIA(c) toxin. Strain HD73-26-10 is a transconjugant strain of HD73-26 harboring the cryIA(c)-containing 44MDa plasmid of strain HD263.

nubilalis, and Plutella xylostella and maintained the activity of the strain against S. exigua. Overall, the insecticidal activity of the recombinant strain was also significantly better than that of the cryIA(b)-containing strain EG6345. DISCUSSION In this report we describe the cloning of seven plasmid replication origins from B. thuringiensis subsp. kurstaki HD263 and HD73 and the construction of B. thuringiensis-E. coli shuttle vectors pEG597, pEG853, and pEG854, containing replication origins from the resident 44-, 60-, and 43-MDa plasmids of strain HD263, respectively. These shuttle vectors were designed to facilitate the manipulation of cloned ICP genes and plasmid replication origins in B. thuringiensis. For example, restriction sites for NotI, Sall, and Sfil were introduced into the plasmids to allow for the systematic excision of non-B. thuringiensis DNA after the cloning of ICP genes in E. coli and before the transformation of B. thuringiensis. Restriction sites for NotI and Sfil are well suited for this purpose, since they should be exceptionally rare in the B. thuringiensis genome (30% G+C). Deletion of the pTZ19u portion of the vectors by NotI digestion and self-ligation provides a convenient and reliable means of constructing small B. thuringiensis plasmids containing a single selectable marker gene, cat. The cat gene can be used to monitor or maintain the stability of ICP-encoding recombinant plasmids during fermentation. However, a desirable feature of live recombinant B. thuringiensis strains destined for use as biopesticides would presumably be the absence of DNA from other biological sources, particularly antibiotic resistance genes. To this end, self-ligated Sfil or Sall fragments containing a B. thuringiensis replication origin and an ICP gene (inserted into the multiple cloning site) could be introduced into B. thuringiensis by cotransformation with an unstable selectable plasmid, resulting in small ICP-encoding plasmids devoid of foreign DNA. At the very least, DNA fragments containing an ICP gene and a B. thuringiensis replication origin could be combined with alternative marker genes. Other features of the vectors are worth noting. The positions of the XbaI sites in pEG853 and pEG854 permit the substitution of B. thuringiensis replication origin fragments, thereby facilitating the construction of additional vectors. The lac promoter from pTZ19u is oriented in such a way that, with the proper manipulations, cloned ICP genes can be expressed in E. coli as well as in B. thuringiensis. This feature could be useful for genetic studies of ICP structure and function. Adjacent to the lac promoter is the T7 RNA polymerase promoter, useful for the in vitro synthesis of RNA. In addition, the fl replication origin can be used in E. coli to generate single-stranded DNA suitable for DNA sequence analysis and site-directed mutagenesis. Finally, since the three replication origins were derived from compatible plasmids, they could provide the means for constructing complex B. thuringiensis strains de novo. Shuttle vectors containing cryIA(c) or cryIIA yielded significant amounts of crystal protein when introduced into the Cry- strain HD73-26. In the case of the cryIIA-containing plasmids, the amount of CryllA protein produced (0.17 to 0.25 ,ug of protein per ,ul of M55 culture lysate) was fourto fivefold higher than that normally obtained with B. thuringiensis HD263. Comparable results have been obtained with cryIIA-containing recombinant plasmids that employ the replication origin from pBC16 (J. Chambers, A. Jelen, and C. Gawron-Burke, unpublished data). CryIA(c) protein

VOL. 56, 1990

|X:E-

C,,

CI

w 0

04

P0:C

NOVEL CLONING VECTORS FOR B. THURINGIENSIS

V0

4D

et

0

c0

co

3427

0o

e

CE) .: iiS 0t .a... 0* .... 'A

0

B

w

FIG. 7. SDS-PAGE (A) and Western blot (B) analyses of duplicate spore-crystal preparations from B. thuringiensis EG6345, EG6346, and EG6346(pEG863). (A) Three protein bands are detected in crystal preparations from strain EG6345, and two protein bands are detected in crystal preparations from the related strain EG6346. (B) Western blot analysis using antibodies specific for the CryIA(c) protein demonstrates expression of the cryIA(c) gene in strain EG6346(pEG863).

production in the HD73-26 recombinant strains was estimated to be 0.2 to 0.3 j.ig of protein per p,l of M55 culture lysate, approximately twofold lower than the amount of CryIA protein produced by strains such as HD1 or HD263, which harbor multiple cryIA-type genes. The comparable levels of CryIA(c) protein produced by the recombinant plasmid pEG863 and the cryIA(c)-containing 44-MDa plasmid in strain HD73-26 suggest that ICP-encoding recombinant plasmids may, in some instances, behave similarly to ICP-encoding native (resident) plasmids in B. thuringiensis. The expression of ICP genes on the shuttle vectors still appears to be linked to sporulation in B. thuringiensis, since crystal protein could only be observed by microscopy in sporulating cultures. Mettus and Macaluso (20) have shown that the expression of cryIA and crylIA genes introduced into B. thuringiensis on recombinant plasmids is sporulation dependent, provided transcription is directed by the native ICP gene promoter. Experiments employing translational fusions between crylIIA or crylA(c) and lacZ suggest that the sporulation-linked regulation of these genes is maintained on shuttle vectors, provided there is no transcription from vector-borne promoters proceeding through the cry gene (Baum and Jelen, unpublished data). Western immunoblot analysis indicates that the production of CryIA(c) protein in strain HD73-26(pEG863) is greater than that in strain EG6346(pEG863). This may be due to the additional ICP genes contained in EG6346 that pre-

sumably compete with cryIA(c) for transcriptional and/or translational factors. It is known, for instance, that the promoter regions of some crystal protein genes are highly conserved and appear to require a specific RNA polymerase containing a new sigma subunit (1, 11). Although the level of CryIA(c) production in strain EG6346(pEG863) is lower than that observed in strain HD73-26(pEG863), the EG6346 recombinant strain exhibits significant improvements in insecticidal activity over the recipient strain, EG6346. Other shuttle vectors employing plasmid replication origins from B. thuringiensis have been described in the literature. Small cryptic plasmids from B. thuringiensis have been cloned directly into E. coli (16, 18, 21), resulting in bifunctional vectors, but the size of many of these constructs limits their usefulness as shuttle vectors. Lereclus et al. (15) have reported the construction of a shuttle vector for B. thuringiensis by employing a replication origin fragment from the small cryptic plasmid pHT1030 of B. thuringiensis subsp. thuringiensis. Shuttle vectors based on pHT1030 (e.g., pHT3101) appear to exhibit segregational stability in Bacillus subtilis (16). The shuttle vectors described in this report have features that should facilitate the development of improved B. thuringiensis-based microbial insecticides. The vectors can be used to construct B. thuringiensis strains with novel combinations of ICP genes, resulting in improved insecticidal activities against a broader spectrum of target pests. The

TABLE 3. Insecticidal activity of native and recombinant B. thuringiensis strainsa

LC50, ng of ICP/cm2 (95% confidence interval)

Strain

EG6345 EG6346

EG6346(pEG863) a

Heliothis zea

S. exigua

Ostrinia nubilalis

Heliothis virescens

48.0 (39.5-59.7) 54.2 (44.2-68.7) 21.6 (17.6-27.5)

9.3 (5.0-15.0) 15.1 (12.1-18.9) 8.9 (7.3-10.9)

2.0 (1.4-2.8) 6.1 (4.8-7.9) 1.5 (0.9-3.1)

>7.6 >6.1 2.6 (1.8-4.1)

Bioassays were performed on spore-crystal preparations from M55 liquid cultures.

Trichoplusia

ni

16.0 (8.3-28.3) 22.3 (8.1-67.6) 5.2 (4.2-6.3)

Plutella xylostella

>7.6 >6.1 1.0 (0.4-1.5)

3428

BAUM ET AL.

segregational stability of these vectors, and the apparent sporulation-linked regulation of ICP genes contained on such vectors, will permit detailed studies of ICP gene regulation in the native host. Last, further investigations of the B. thuringiensis plasmid replication origins will shed light on the mechanisms of plasmid replication and maintenance in this commercially important organism. ACKNOWLEDGMENTS We thank R. Gene Groat and James Mattison for supplying us with CryIA(c)-specific antibodies, Amy Jelen for assistance with the Western blot analysis, and William Donovan for his critical reading of the manuscript. LITERATURE CITED 1. Brown, K. L., and H. R. Whiteley. 1988. Isolation of a Bacillus thuringiensis RNA polymerase capable of transcribing crystal protein genes. Proc. Natl. Acad. Sci. USA 85:4166-4170. 2. Carlton, B. C., and J. M. Gonzalez, Jr. 1985. Plasmids and delta-endotoxin production in different subspecies of Bacillus thuringiensis, p. 246-252. In J. A. Hoch and P. Setlow (ed.), Molecular biology of microbial differentiation. American Society for Microbiology, Washington, D.C. 3. Currier, T. C., and C. Gawron-Burke. 1989. Commercial development of Bacillus thuringiensis bioinsecticide products, p. 111-143. In J. P. Nakas and C. Hagedorn (ed.), Biotechnology of plant-microbe interactions. McGraw-Hill Book Co., New York. 4. Daum, R. J. 1970. Revision of two computer programs for probit analysis. Bull. Entomol. Soc. Am. 16:10-15. 5. de Barjac, H. 1981. Identification of H-serotypes of Bacillus thuringiensis, p. 35-43. In H. D. Burges (ed.), Microbial control of pests and plant diseases 1970-1980. Academic Press, Inc., New York. 6. Donovan, W. P., C. C. Dankocsik, M. P. Gilbert, and C. Gawron-Burke. 1988. Amino acid sequence and entomocidal activity of the P2 crystal protein. J. Biol. Chem. 263:561-567. 7. Donovan, W. P., J. M. Gonzalez, Jr., M. P. Gilbert, and C. Dankocsik. 1988. Isolation and characterization of EG2158, a new strain of Bacillus thuringiensis toxic to coleopteran larvae, and nucleotide sequence of the toxin gene. Mol. Gen. Genet. 214:365-372. 8. Dulmage, H. T., C. C. Beegle, H. de Barjac, D. Reich, G. Donaldson, and J. Krywienczyk. 1982. Bacillus thuringiensis cultures available from the U.S. Department of Agriculture. U.S.D.A.-A.R.S. agricultural reviews and manuals, ARM-S-30/ Oct. U.S. Department of Agriculture, Agricultural Research Service, New Orleans. 9. Feinberg, A. P., and B. Vogelstein. 1984. A technique for

APPL. ENVIRON. MICROBIOL.

10.

11. 12. 13. 14. 15. 16.

17.

18. 19.

20. 21. 22. 23.

24.

radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 137:266-267. Gonzalez, J. M., Jr., H. T. Dulmage, and B. C. Carlton. 1981. Correlation between specific plasmids and delta endotoxin production in Bacillus thuringiensis. Plasmid 5:351-365. Hofte, H., and H. R. Whiteley. 1989. Insecticidal crystal proteins of Bacillus thuringiensis. Microbiol. Rev. 53:242-255. Horinouchi, S., and B. Weisblum. 1982. Nucleotide sequence and functional map of pC194, a plasmid that specifies inducible chloramphenicol resistance. J. Bacteriol. 150:815-825. Kronstad, J. W., H. E. Schnepf, and H. R. Whiteley. 1983. Diversity of locations for Bacillus thuringiensis crystal protein genes. J. Bacteriol. 154:419-428. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of T4 bacteriophage. Nature (London) 227:680-685. Lereclus, D., 0. Arantes, J. Chaufaux, and M.-M. Lecadet. 1989. Transformation and expression of a cloned endotoxin gene in Bacillus thuringiensis. FEMS Microbiol. Lett. 60:211-218. Lereclus, D., S. Guo, V. Sanchis, and M.-M. Lecadet. 1988. Characterization of two Bacillus thuringiensis plasmids whose replication is thermosensitive in B. subtilis. FEMS Microbiol. Lett. 49:417-422. Mahillon, J., W. Chungjatupornchai, J. Decock, S. Dierickx, F. Michiels, M. Peferoen, and H. Joos. 1989. Transformation of Bacillus thuringiensis by electroporation. FEMS Microbiol. Lett. 60:205-210. Mahillon, J., F. Hespel, A.-M. Pierssens, and J. Delcour. 1988. Cloning and partial characterization of three small cryptic plasmids from Bacillus thuringiensis. Plasmid 19:169-173. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. Mettus, A.-M., and A. Macaluso. 1990. Expression of Bacillus thuringiensis 8-endotoxin genes during vegetative growth. Appl. Environ. Microbiol. 56:1128-1134. Miteva, V. I., and R. T. Grigorova. 1988. Construction of a bifunctional genetically labelled plasmid for Bacillus thuringiensis subsp. israelensis. Arch. Microbiol. 150:496-498. Sanger, F., S. Nicklen, and A. Coulson. 1977. DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. Schurter, W., M. Geiser, and D. Mathe. 1989. Efficient transformation of Bacillus thuringiensis and Bacillus cereus via electroporation: transformation of acrystalliferous strains with a cloned delta-endotoxin gene. Mol. Gen. Genet. 218:177-181. Widner, W. R., and H. R. Whiteley. 1989. Two highly related insecticidal crystal proteins of Bacillus thuringiensis subsp. kurstaki possess different host range specificities. J. Bacteriol. 171:965-974.