Molecular and Cellular Endocrinology 407 (2015) 18–25
Contents lists available at ScienceDirect
Molecular and Cellular Endocrinology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / m c e
Novel activating mutation of human calcium-sensing receptor in a family with autosomal dominant hypocalcaemia Natalia Baran a,b,*, Michael ter Braak c, Rainer Saffrich b, Joachim Woelfle d, Udo Schmitz a a
Department of Endocrinology and Diabetology, University of Bonn, Sigmund-Freud-Str. 25, 53127 Bonn, Germany Department of Medicine V, University of Heidelberg, INF 410, 69120 Heidelberg, Germany Institut of Pharmacology, University of Essen, Hufelandstr. 55, 45122 Essen, Germany d Pediatric Endocrinology Division, University of Bonn, Adenauerallee 119, 53113 Bonn, Germany b c
A R T I C L E
I N F O
Article history: Received 7 November 2013 Received in revised form 13 January 2015 Accepted 19 February 2015 Available online 9 March 2015 Keywords: ADH CaR MAPK Hypocalcaemia Activating mutation
A B S T R A C T
Introduction: Autosomal dominant hypocalcaemia (ADH) is caused by activating mutations in the calcium sensing receptor gene (CaR) and characterised by mostly asymptomatic mild to moderate hypocalcaemia with low, inappropriately serum concentration of PTH. Objective: The purpose of the present study was to biochemically and functionally characterise a novel mutation of CaR. Patients: A female proband presenting with hypocalcaemia was diagnosed to have “idiopathic hypoparathyroidism” at the age of 10 with a history of muscle pain and cramps. Further examinations demonstrated hypocalcaemia in nine additional family members, affecting three generations. Main outcome measure: P136L CaR mutation was predicted to cause gain of function of CaR. Results: Affected family members showed relevant hypocalcaemia (mean ± SD; 1.91 ± 0.1mmol/l). Patient history included mild seizures and recurrent nephrolithiasis. Genetic analysis confirmed that hypocalcaemia cosegregated with a heterozygous mutation at codon 136 (CCC → CTC/Pro → Leu) in exon 3 of CaR confirming the diagnosis of ADH. For in vitro studies P136L mutant CaR was generated by sitedirected mutagenesis and examined in transiently transfected HEK293 cells. Extracellular calcium stimulation of transiently transfected HEK293 cells showed significantly increased intracellular Ca2+ mobilisation and MAPK activity for mutant P136L CaR compared to wild type CaR. Conclusions: The present study gives insight about a novel activating mutation of CaR and confirms that the novel P136L-CaR mutation is responsible for ADH in this family. © 2015 Elsevier Ireland Ltd. All rights reserved.
1. Introduction CaR is a cell surface receptor for divalent cations. It is abundantly expressed in parathyroid glands, kidneys, and is also found in a wide variety of other tissues (Brown, 1997; Brown and MacLeod, 2001; Brown et al., 1998a, 1998b, 1999; Nemeth and Scarpa, 1987; Pearce et al., 1996a; Shoback et al., 1988). Stimulation of CaR plays a pivotal role in regulation of extracellular calcium homeostasis (Brown, 1997; Brown and MacLeod, 2001; Brown et al., 1998a, 1998b, 1999; Nemeth and Scarpa, 1987; Pearce et al., 1996a; Shoback et al., 1988). Furthermore, CaR regulation has been implicated in a variety of physiological and pathological processes in humans, such as hormone secretion, control of ion channels, or regulation of cell cycle events with proliferation, differentiation and apoptosis (Brown and MacLeod, 2001; Brown et al., 1994b; Kifor et al., 2001; Nagase et al.,
* Corresponding author. Department of Medicine V, University of Heidelberg, INF 410, 69120 Heidelberg, Germany. Tel.: +49 6221 56 38053; fax: +49 6221 56 5775. E-mail address: [email protected] (N. Baran). http://dx.doi.org/10.1016/j.mce.2015.02.021 0303-7207/© 2015 Elsevier Ireland Ltd. All rights reserved.
2002; Tfelt-Hansen et al., 2003b, 2004). Autosomal dominant hypocalcaemia (ADH) is a familial syndrome characterised by the presence of inappropriately low parathyroid hormone levels with varying degrees of hypocalcaemia, hyperphosphatemia, and relative hypercalciuria (D’Souza-Li et al., 2002; Hendy et al., 2000; Okazaki et al., 1999; Pearce and Brown, 1996; Pearce et al., 1996b). ADH might be complicated by nephrolithiasis, nephrocalcinosis, and calcification of cerebral ganglia (Brown and MacLeod, 2001; D’Souza-Li et al., 2002; Hauache, 2001; Lienhardt et al., 2001; Pearce et al., 1996b; Watanabe et al., 1998; Yamamoto et al., 2000). Clinical presentation of ADH varies from asymptomatic hypocalcaemia to hypocalcaemic seizures, paraesthesias, sometimes with severe outcome manifesting with tetany or laryngospasm (D’Souza-Li et al., 2002; Tan et al., 2003). ADH has been previously demonstrated to be caused by activating mutations of CaR, which lead to suppression of PTH secretion by an increased sensitivity of CaR to extracellular calcium concentration. Genetic alterations of CaR were mapped to locus 3q13 on chromosome 3 (D’Souza-Li et al., 2002; Hauache, 2001; Hendy et al., 2000; Kifor et al., 2001; Lienhardt et al., 2001; Nagase et al., 2002; Okazaki et al., 1999; Watanabe et al., 1998).
N. Baran et al./Molecular and Cellular Endocrinology 407 (2015) 18–25
To date, more than 230 different disease-causing mutations of the CaSR have been reported (Hannan and Thakker, 2013). Furthermore about 95 different mutations have been identified in patients with ADH and sporadic hypoparathyroidism and are associated with the coding region for either the proximal extracellular domain (51%), for the transmembrane region (41%) or for the intracellular domain (8%) (Baron et al., 1996; D’Souza-Li et al., 2002; Hannan and Thakker, 2013; Hauache, 2001; Hendy et al., 2000; Lienhardt et al., 2001; Okazaki et al., 1999; Pearce, 2002; Pearce et al., 1996b; Pollak et al., 1994; Tan et al., 2003; Watanabe et al., 1998; Yamamoto et al., 2000). Depending on the potency of the activating mutation in CaR, patients can suffer not only from hypocalcaemia, hypomagnesemia and hypercalcuria, but also from renal loss of NaCl with polyuria, exhibiting symptoms similar to Bartter syndrome with secondary hyperaldosteronism and hypokalemia. To date, such severe courses of ADH were described for the following CaR mutations: E481K, A843E, C131W, L125P and K29E (Kinoshita et al., 2014; Lienhardt et al., 2000; Sato et al., 2002; Vargas-Poussou et al., 2002; Vezzoli et al., 2006; Watanabe et al., 2002). In the present study, a novel mutation of CaR (P136L) is reported in a family with ADH. Expression of P136L-CaR in HEK293 cells showed increased extracellular Ca2+-dependent activation of intracellular Ca2+ mobilisation compared to wt-CaR. Moreover P136L-CaR showed a left-shift in the Ca2+dependent concentration curve of intracellular calcium release. Furthermore, calcium dependent stimulation of MAP-kinases ERK1/2, p38 and JNK were increased in HEK293 cells by expression of P136LCaR compared to wt-CaR. 2. Materials and methods 2.1. Subjects The family came to clinical attention because of symptomatic hypocalcaemia in individual II-7 [index patient, Fig. 1]. The index patient was diagnosed to have “idiopathic hypoparathyroidism” at age 10 after complaining of muscle pain and muscle cramps. Physical examination of the index patient revealed no abnormalities. CaR sequencing of the index patient demonstrated a novel mutation (P136L). Further examination demonstrated hypocalcaemia in nine additional family members, affecting three generations [Fig. 1, Table 1]. Biochemical analysis was prepared either at the time of first manifestation (individuals II-7 and III-3 to III-8) or at the time of genetic consultation (I-1, II-3, II-4). The results of serum examination and reference ranges were included in Table 2. Twentyfour-collected urine samples were analysed for adults and summarised in Table 3. Fractional excretion of Ca2+ was calculated as (urine Ca2+*serum creatinine)/(serum Ca2+*urine creatinine). Spot
19
Table 1 Clinical findings in ten family members with ADH. Pedigree no.
Age by manifestation
Symptoms
Blood pressure
I-1 II-3 II-4 II-7 III-3 III-4 III-5 III-6 III-7 III-8 Mean ± SE
64 37 32 10 11 7 5 3 1 2 17 ± 20
BC, S S, M S S,NC,NL MP NO NO M, MP, S, NO NO
145/75 110/60 100/70 110/80 110/60 100/50 90/60 85/55 ND ND
BC, basal ganglia calcification; M, myoclonia; MP, muscle pain; NA, not available; NC, nephrocalcinosis; NL, nephrolithiasis; NO, no clinical symptoms; S, seizures; RC, renal calcification; T, tremulousness. Six of 10 family members were symptomatic, mostly the third generation did show no symptoms. Blood pressure was normal for resp. age group.
urine samples were collected from children and depicted in Table 3. Ca/Cr ratio was calculated as (urine Ca2+/urine creatinine). 2.2. Direct sequence analysis of CaR exons Genomic DNA was obtained from peripheral blood leukocytes and isolated using standard methods (Tan et al., 2003). Proteincoding exons 2-7 of the CaR were amplified by PCR, as described previously (D’Souza-Li et al., 2002; Hendy et al., 2003; Janicic et al., 1995; Lienhardt et al., 2000; Pearce et al., 1995; Pollak et al., 1993; Zajickova et al., 2007). Amplification products were purified and nucleotide sequences of both strands were determined by direct sequencing and compared to reference DNA sequence. 2.3. DNA amplification, site-directed mutagenesis and sequence analysis For studying protein structure–function relationships and gene expression, site-directed mutagenesis was used. We first cloned the wt-CaR in XL10-Gold® Ultracompetent Cells (STRATAGENE, La Jolla, CA). Plasmid pcDNA3.1, containing the wt-CaR (GenBank accession no.U20759), a the generous gift of Mei Bai and Ed Brown (Endocrine-Hypertension Division, Brigham and Women’s Hospital, Boston, MA). To create mutant receptor the Quick-change-XLII-site directed mutagenesis kit was used (STRATAGENE, La Jolla, CA). To yield the mutation in which the CCC (Proline) residue at position 136 was substituted to CTC (Leucine), in Exon 3 in CaR, the mutagenic oligonucleotides were used: forward primer, 5′CTGCTCAGAGCACATTCCCTCTACGATTGCTGTG 3′; and reverse primer, 5′CACAGCAATCGTAGAGGGAATGTGCTCTGAGCAG 3′ for P136L mutation (Eurofins MWG Operon, Ebersberg, Germany). The plasmids were isolated using S.N.A.P.™ MiniPrep Kit (Invitrogen) when the suspension culture reached up to OD600 > 1.0, measured using Spectrophotometer (Eppendorf). PCR products were verified by direct double stranded sequencing (QIAGEN, Hilden, Germany). The verification of the insert sequence confirmed the desired mutation in selected clones. The plasmid probes of concentration of about 30 μg/ml were used for further experiments. 2.4. Cell culture and transient transfection
Fig. 1. Pedigrees of the three generation family with ADH, presenting with hypocalcaemia and low serum concentration of PTH caused by an activating CaR mutation. Index patient II-7 is indicated by arrow; all affected hypocalcaemic members (solid symbols) were demonstrated to have heterozygous P136L CaR mutation. Unaffected family members are characterised by open symbols. Individuals who provided samples for DNA sequencing are indicated by (*).
It has been previously shown that HEK293 cells do not express endogenous CaR (Galitzer et al., 2009). For functional characterisation of P136L mutant receptor, CaR wild-type and P136L-CaR were transiently transfected into HEK 293 cells (Bai et al., 1996; Lienhardt et al., 2001; Okazaki et al., 1999). Cells were cultured in DMEM
20
N. Baran et al./Molecular and Cellular Endocrinology 407 (2015) 18–25
Table 2 Biochemical features of affected family members. All subjects showed normal renal function at the time of initial biochemical evaluation. The values of natrium and potassium were in normal range. All subjects showed hypocalcaemia. Five of 10 cases show hypomagnesemia and hyperphosphatemia. Seven of 10 cases did show inappropriately low serum intact PTH, while the 1,25-(OH)2D and 25-(OH)D vitamin levels in serum were normal. Pedigree no.
Ca (S) mmol/l
Na (S) mmol/l
Cl (S) mmol/l
K (S) mmol/l
P (S) mmol/l
Cr (S) mg/dl
Mg (S) mmol/l
PTH (S) pg/ml
1,25-(OH)2D
25-(OH)D
Reference range I-1 II-3 II-4 II-7 III-3 III-4 III-5 III-6 III-7 III-8 Mean ± SE
2.12–2.52 1.84 1.84 1.89 1.83 1.9 1.87 2.06 1.98 1.99 1.87 1.91 ± 0.07
136–145 140 136 142 139 143 143 141 139 138 NO 140 ± 2
97–107 107 103 100 104 108 104 106 104 105 NO 104 ± 2
3.5–5.1 4.27 4.36 4.03 3.87 4.3 4 4.3 4.4 4.06 NO 4.18 ± 0.18
0.8–1.45 1.41 1.03 2.17 1.1 1.88 1.99 1.99 2.03 2.5 2.5 1.86 ± 0.51
0.8–1.3 0.8 0.82 0.8 0.8 0.48 0.5 0.38 0.37 0.43 0.6 0.60 ± 0.18
0.74–0.99 0.68 0.69 0.67 0.63 0.7 NO 0.8 NO 0.79 NO 0.71 ± 0.06
Dec-72 26 18 18 6 9 11 4 10 9 9 12 ± 6
18–62 35.9 26.2 34.8 31.9 NO 41.4 NO 42.9 86 NO 42.7 ± 19.9
9.2–45.2 15.2 30.1 45.5 21.4 20.1 25.3 NO 28.5 21 NO 25.9 ± 9.26
supplemented with 10% fetal bovine serum, Glutamax, and 10 μg/ml penicillin/streptomycin (Invitrogen). After reaching 80% confluence, cells were transfected by wt-CaR or P136L mutant CaR for 24 h. Fugene HD (Roche, Mannheim, Germany) was employed as a DNA carrier for transfection. After 24 h, the medium was changed and substituted by serum starved DMEM containing 0.1% fetal bovine serum for 48 h. 2.5. Fluorescent immunostaining and confocal microscopy For fluorescent staining, transiently transfected HEK293 cells were placed on coverslips in 24-well plates and transiently transfected as previously described (Bai et al., 1996). After 48 hours, cells were washed in PBS, fixed, permeabilised, and blocked with PBS containing 4% BSA. Subsequently, cells were washed with PBS and incubated (1 h, room temperature) with the primary antibody antiCASR (6D4) (Santa Cruz Biotechnology, Heidelberg, Germany). Afterwards, cells were washed again and incubated with the secondary antibody labeled with Alexa Fluor 488, and then mixed with Hoechst 33258 to enable nuclear staining (Molecular Probes, Inc). Antibody labelled cells on coverslips were washed, slides were mounted with Fluoromount-G (Southern Biotech), dried, and visualised by inverted fluorescence microscope Olympus IX70 (Olympus Life Science Europe, Hamburg). The microscope was equipped with a Colorview III camera and the images were acquired under control of cell^P software from OSIS (Olympus Soft Imaging System, Münster, Germany). For the photographs, an objective with magnification of 20× was used, and the same contrast/ brightness settings were chosen for each photograph. Relative numbers of transfected cells were quantified for all constructs, by counting cells with surface staining in relation to whole amount of cell’ nuclei stained with Hoechst 33258 within a given field area. There was no staining of nontransfected HEK293 cells with the antiCASR antibody. 2.6. Measurement of [Ca2+] i by fluorometry of intracellular Ca2+ mobilisation in P136L mutant To functionally characterise the novel P136L-CaR, HEK-293 cells were transiently transfected by wild-type CaR or P136L-CaR, and intracellular calcium mobilisation was determined by FURA-2/AM (Molecular Probes, Darmstadt, Germany) as previously described (Bai et al., 1996; D’Souza-Li et al., 2002). HEK293 cells were plated in 75 cm2 flasks and transfected with wt-CaR or mutant CaR. After 72 hours, HEK293 cells were resuspended in HEPES 20 mM, pH 7.4, and loaded with FURA-2/AM (Invitrogen), washed again, pelleted, and suspended in HEPES. Measurement of the intracellular calcium
concentration [Ca2+]i was performed in a Hitachi F2000 spectrofluorometer using cells in suspension. Aliquots of cell suspension were placed in a quartz cuvette and used for fluorescence measurements, according to the modified technique employed previously (Fajtova et al., 1991; Hofer et al., 2000). CaR was activated by multiple additions of Ca2+ solution in incremental doses to reach the desired concentrations (0–100 mM). Excitation monochronometres were centered at 340 nm and 380 nm, with emission light collected at 510 ± 40 nm through a wide-band emission filter. The magnitude of response at each concentration of Ca2+ was measured as the maximal increment from baseline. In most experiments, the peak responses were observed about 60–80 s after stimulation. The 340/380 excitation ratio of emitted light was used to calculate the [Ca2+]i. For measuring EC50, the [Ca2+]i in response to 0.5–7.0 mM [Ca2+]0, was recorded. The EC50 value was calculated by plotting the intracellular calcium concentration [Ca2+]i response against the extracellular calcium addition [Ca2+]0 and normalised to value achieved at 0.5 mM respectively for wild type and P136L mutant CaR. The mean EC50 (median effective concentration) values, determined from 6 independent experiments between wild-type and P136L mutant CaR, were compared by ANOVA test. A p-value
Contents lists available at ScienceDirect
Molecular and Cellular Endocrinology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / m c e
Novel activating mutation of human calcium-sensing receptor in a family with autosomal dominant hypocalcaemia Natalia Baran a,b,*, Michael ter Braak c, Rainer Saffrich b, Joachim Woelfle d, Udo Schmitz a a
Department of Endocrinology and Diabetology, University of Bonn, Sigmund-Freud-Str. 25, 53127 Bonn, Germany Department of Medicine V, University of Heidelberg, INF 410, 69120 Heidelberg, Germany Institut of Pharmacology, University of Essen, Hufelandstr. 55, 45122 Essen, Germany d Pediatric Endocrinology Division, University of Bonn, Adenauerallee 119, 53113 Bonn, Germany b c
A R T I C L E
I N F O
Article history: Received 7 November 2013 Received in revised form 13 January 2015 Accepted 19 February 2015 Available online 9 March 2015 Keywords: ADH CaR MAPK Hypocalcaemia Activating mutation
A B S T R A C T
Introduction: Autosomal dominant hypocalcaemia (ADH) is caused by activating mutations in the calcium sensing receptor gene (CaR) and characterised by mostly asymptomatic mild to moderate hypocalcaemia with low, inappropriately serum concentration of PTH. Objective: The purpose of the present study was to biochemically and functionally characterise a novel mutation of CaR. Patients: A female proband presenting with hypocalcaemia was diagnosed to have “idiopathic hypoparathyroidism” at the age of 10 with a history of muscle pain and cramps. Further examinations demonstrated hypocalcaemia in nine additional family members, affecting three generations. Main outcome measure: P136L CaR mutation was predicted to cause gain of function of CaR. Results: Affected family members showed relevant hypocalcaemia (mean ± SD; 1.91 ± 0.1mmol/l). Patient history included mild seizures and recurrent nephrolithiasis. Genetic analysis confirmed that hypocalcaemia cosegregated with a heterozygous mutation at codon 136 (CCC → CTC/Pro → Leu) in exon 3 of CaR confirming the diagnosis of ADH. For in vitro studies P136L mutant CaR was generated by sitedirected mutagenesis and examined in transiently transfected HEK293 cells. Extracellular calcium stimulation of transiently transfected HEK293 cells showed significantly increased intracellular Ca2+ mobilisation and MAPK activity for mutant P136L CaR compared to wild type CaR. Conclusions: The present study gives insight about a novel activating mutation of CaR and confirms that the novel P136L-CaR mutation is responsible for ADH in this family. © 2015 Elsevier Ireland Ltd. All rights reserved.
1. Introduction CaR is a cell surface receptor for divalent cations. It is abundantly expressed in parathyroid glands, kidneys, and is also found in a wide variety of other tissues (Brown, 1997; Brown and MacLeod, 2001; Brown et al., 1998a, 1998b, 1999; Nemeth and Scarpa, 1987; Pearce et al., 1996a; Shoback et al., 1988). Stimulation of CaR plays a pivotal role in regulation of extracellular calcium homeostasis (Brown, 1997; Brown and MacLeod, 2001; Brown et al., 1998a, 1998b, 1999; Nemeth and Scarpa, 1987; Pearce et al., 1996a; Shoback et al., 1988). Furthermore, CaR regulation has been implicated in a variety of physiological and pathological processes in humans, such as hormone secretion, control of ion channels, or regulation of cell cycle events with proliferation, differentiation and apoptosis (Brown and MacLeod, 2001; Brown et al., 1994b; Kifor et al., 2001; Nagase et al.,
* Corresponding author. Department of Medicine V, University of Heidelberg, INF 410, 69120 Heidelberg, Germany. Tel.: +49 6221 56 38053; fax: +49 6221 56 5775. E-mail address: [email protected] (N. Baran). http://dx.doi.org/10.1016/j.mce.2015.02.021 0303-7207/© 2015 Elsevier Ireland Ltd. All rights reserved.
2002; Tfelt-Hansen et al., 2003b, 2004). Autosomal dominant hypocalcaemia (ADH) is a familial syndrome characterised by the presence of inappropriately low parathyroid hormone levels with varying degrees of hypocalcaemia, hyperphosphatemia, and relative hypercalciuria (D’Souza-Li et al., 2002; Hendy et al., 2000; Okazaki et al., 1999; Pearce and Brown, 1996; Pearce et al., 1996b). ADH might be complicated by nephrolithiasis, nephrocalcinosis, and calcification of cerebral ganglia (Brown and MacLeod, 2001; D’Souza-Li et al., 2002; Hauache, 2001; Lienhardt et al., 2001; Pearce et al., 1996b; Watanabe et al., 1998; Yamamoto et al., 2000). Clinical presentation of ADH varies from asymptomatic hypocalcaemia to hypocalcaemic seizures, paraesthesias, sometimes with severe outcome manifesting with tetany or laryngospasm (D’Souza-Li et al., 2002; Tan et al., 2003). ADH has been previously demonstrated to be caused by activating mutations of CaR, which lead to suppression of PTH secretion by an increased sensitivity of CaR to extracellular calcium concentration. Genetic alterations of CaR were mapped to locus 3q13 on chromosome 3 (D’Souza-Li et al., 2002; Hauache, 2001; Hendy et al., 2000; Kifor et al., 2001; Lienhardt et al., 2001; Nagase et al., 2002; Okazaki et al., 1999; Watanabe et al., 1998).
N. Baran et al./Molecular and Cellular Endocrinology 407 (2015) 18–25
To date, more than 230 different disease-causing mutations of the CaSR have been reported (Hannan and Thakker, 2013). Furthermore about 95 different mutations have been identified in patients with ADH and sporadic hypoparathyroidism and are associated with the coding region for either the proximal extracellular domain (51%), for the transmembrane region (41%) or for the intracellular domain (8%) (Baron et al., 1996; D’Souza-Li et al., 2002; Hannan and Thakker, 2013; Hauache, 2001; Hendy et al., 2000; Lienhardt et al., 2001; Okazaki et al., 1999; Pearce, 2002; Pearce et al., 1996b; Pollak et al., 1994; Tan et al., 2003; Watanabe et al., 1998; Yamamoto et al., 2000). Depending on the potency of the activating mutation in CaR, patients can suffer not only from hypocalcaemia, hypomagnesemia and hypercalcuria, but also from renal loss of NaCl with polyuria, exhibiting symptoms similar to Bartter syndrome with secondary hyperaldosteronism and hypokalemia. To date, such severe courses of ADH were described for the following CaR mutations: E481K, A843E, C131W, L125P and K29E (Kinoshita et al., 2014; Lienhardt et al., 2000; Sato et al., 2002; Vargas-Poussou et al., 2002; Vezzoli et al., 2006; Watanabe et al., 2002). In the present study, a novel mutation of CaR (P136L) is reported in a family with ADH. Expression of P136L-CaR in HEK293 cells showed increased extracellular Ca2+-dependent activation of intracellular Ca2+ mobilisation compared to wt-CaR. Moreover P136L-CaR showed a left-shift in the Ca2+dependent concentration curve of intracellular calcium release. Furthermore, calcium dependent stimulation of MAP-kinases ERK1/2, p38 and JNK were increased in HEK293 cells by expression of P136LCaR compared to wt-CaR. 2. Materials and methods 2.1. Subjects The family came to clinical attention because of symptomatic hypocalcaemia in individual II-7 [index patient, Fig. 1]. The index patient was diagnosed to have “idiopathic hypoparathyroidism” at age 10 after complaining of muscle pain and muscle cramps. Physical examination of the index patient revealed no abnormalities. CaR sequencing of the index patient demonstrated a novel mutation (P136L). Further examination demonstrated hypocalcaemia in nine additional family members, affecting three generations [Fig. 1, Table 1]. Biochemical analysis was prepared either at the time of first manifestation (individuals II-7 and III-3 to III-8) or at the time of genetic consultation (I-1, II-3, II-4). The results of serum examination and reference ranges were included in Table 2. Twentyfour-collected urine samples were analysed for adults and summarised in Table 3. Fractional excretion of Ca2+ was calculated as (urine Ca2+*serum creatinine)/(serum Ca2+*urine creatinine). Spot
19
Table 1 Clinical findings in ten family members with ADH. Pedigree no.
Age by manifestation
Symptoms
Blood pressure
I-1 II-3 II-4 II-7 III-3 III-4 III-5 III-6 III-7 III-8 Mean ± SE
64 37 32 10 11 7 5 3 1 2 17 ± 20
BC, S S, M S S,NC,NL MP NO NO M, MP, S, NO NO
145/75 110/60 100/70 110/80 110/60 100/50 90/60 85/55 ND ND
BC, basal ganglia calcification; M, myoclonia; MP, muscle pain; NA, not available; NC, nephrocalcinosis; NL, nephrolithiasis; NO, no clinical symptoms; S, seizures; RC, renal calcification; T, tremulousness. Six of 10 family members were symptomatic, mostly the third generation did show no symptoms. Blood pressure was normal for resp. age group.
urine samples were collected from children and depicted in Table 3. Ca/Cr ratio was calculated as (urine Ca2+/urine creatinine). 2.2. Direct sequence analysis of CaR exons Genomic DNA was obtained from peripheral blood leukocytes and isolated using standard methods (Tan et al., 2003). Proteincoding exons 2-7 of the CaR were amplified by PCR, as described previously (D’Souza-Li et al., 2002; Hendy et al., 2003; Janicic et al., 1995; Lienhardt et al., 2000; Pearce et al., 1995; Pollak et al., 1993; Zajickova et al., 2007). Amplification products were purified and nucleotide sequences of both strands were determined by direct sequencing and compared to reference DNA sequence. 2.3. DNA amplification, site-directed mutagenesis and sequence analysis For studying protein structure–function relationships and gene expression, site-directed mutagenesis was used. We first cloned the wt-CaR in XL10-Gold® Ultracompetent Cells (STRATAGENE, La Jolla, CA). Plasmid pcDNA3.1, containing the wt-CaR (GenBank accession no.U20759), a the generous gift of Mei Bai and Ed Brown (Endocrine-Hypertension Division, Brigham and Women’s Hospital, Boston, MA). To create mutant receptor the Quick-change-XLII-site directed mutagenesis kit was used (STRATAGENE, La Jolla, CA). To yield the mutation in which the CCC (Proline) residue at position 136 was substituted to CTC (Leucine), in Exon 3 in CaR, the mutagenic oligonucleotides were used: forward primer, 5′CTGCTCAGAGCACATTCCCTCTACGATTGCTGTG 3′; and reverse primer, 5′CACAGCAATCGTAGAGGGAATGTGCTCTGAGCAG 3′ for P136L mutation (Eurofins MWG Operon, Ebersberg, Germany). The plasmids were isolated using S.N.A.P.™ MiniPrep Kit (Invitrogen) when the suspension culture reached up to OD600 > 1.0, measured using Spectrophotometer (Eppendorf). PCR products were verified by direct double stranded sequencing (QIAGEN, Hilden, Germany). The verification of the insert sequence confirmed the desired mutation in selected clones. The plasmid probes of concentration of about 30 μg/ml were used for further experiments. 2.4. Cell culture and transient transfection
Fig. 1. Pedigrees of the three generation family with ADH, presenting with hypocalcaemia and low serum concentration of PTH caused by an activating CaR mutation. Index patient II-7 is indicated by arrow; all affected hypocalcaemic members (solid symbols) were demonstrated to have heterozygous P136L CaR mutation. Unaffected family members are characterised by open symbols. Individuals who provided samples for DNA sequencing are indicated by (*).
It has been previously shown that HEK293 cells do not express endogenous CaR (Galitzer et al., 2009). For functional characterisation of P136L mutant receptor, CaR wild-type and P136L-CaR were transiently transfected into HEK 293 cells (Bai et al., 1996; Lienhardt et al., 2001; Okazaki et al., 1999). Cells were cultured in DMEM
20
N. Baran et al./Molecular and Cellular Endocrinology 407 (2015) 18–25
Table 2 Biochemical features of affected family members. All subjects showed normal renal function at the time of initial biochemical evaluation. The values of natrium and potassium were in normal range. All subjects showed hypocalcaemia. Five of 10 cases show hypomagnesemia and hyperphosphatemia. Seven of 10 cases did show inappropriately low serum intact PTH, while the 1,25-(OH)2D and 25-(OH)D vitamin levels in serum were normal. Pedigree no.
Ca (S) mmol/l
Na (S) mmol/l
Cl (S) mmol/l
K (S) mmol/l
P (S) mmol/l
Cr (S) mg/dl
Mg (S) mmol/l
PTH (S) pg/ml
1,25-(OH)2D
25-(OH)D
Reference range I-1 II-3 II-4 II-7 III-3 III-4 III-5 III-6 III-7 III-8 Mean ± SE
2.12–2.52 1.84 1.84 1.89 1.83 1.9 1.87 2.06 1.98 1.99 1.87 1.91 ± 0.07
136–145 140 136 142 139 143 143 141 139 138 NO 140 ± 2
97–107 107 103 100 104 108 104 106 104 105 NO 104 ± 2
3.5–5.1 4.27 4.36 4.03 3.87 4.3 4 4.3 4.4 4.06 NO 4.18 ± 0.18
0.8–1.45 1.41 1.03 2.17 1.1 1.88 1.99 1.99 2.03 2.5 2.5 1.86 ± 0.51
0.8–1.3 0.8 0.82 0.8 0.8 0.48 0.5 0.38 0.37 0.43 0.6 0.60 ± 0.18
0.74–0.99 0.68 0.69 0.67 0.63 0.7 NO 0.8 NO 0.79 NO 0.71 ± 0.06
Dec-72 26 18 18 6 9 11 4 10 9 9 12 ± 6
18–62 35.9 26.2 34.8 31.9 NO 41.4 NO 42.9 86 NO 42.7 ± 19.9
9.2–45.2 15.2 30.1 45.5 21.4 20.1 25.3 NO 28.5 21 NO 25.9 ± 9.26
supplemented with 10% fetal bovine serum, Glutamax, and 10 μg/ml penicillin/streptomycin (Invitrogen). After reaching 80% confluence, cells were transfected by wt-CaR or P136L mutant CaR for 24 h. Fugene HD (Roche, Mannheim, Germany) was employed as a DNA carrier for transfection. After 24 h, the medium was changed and substituted by serum starved DMEM containing 0.1% fetal bovine serum for 48 h. 2.5. Fluorescent immunostaining and confocal microscopy For fluorescent staining, transiently transfected HEK293 cells were placed on coverslips in 24-well plates and transiently transfected as previously described (Bai et al., 1996). After 48 hours, cells were washed in PBS, fixed, permeabilised, and blocked with PBS containing 4% BSA. Subsequently, cells were washed with PBS and incubated (1 h, room temperature) with the primary antibody antiCASR (6D4) (Santa Cruz Biotechnology, Heidelberg, Germany). Afterwards, cells were washed again and incubated with the secondary antibody labeled with Alexa Fluor 488, and then mixed with Hoechst 33258 to enable nuclear staining (Molecular Probes, Inc). Antibody labelled cells on coverslips were washed, slides were mounted with Fluoromount-G (Southern Biotech), dried, and visualised by inverted fluorescence microscope Olympus IX70 (Olympus Life Science Europe, Hamburg). The microscope was equipped with a Colorview III camera and the images were acquired under control of cell^P software from OSIS (Olympus Soft Imaging System, Münster, Germany). For the photographs, an objective with magnification of 20× was used, and the same contrast/ brightness settings were chosen for each photograph. Relative numbers of transfected cells were quantified for all constructs, by counting cells with surface staining in relation to whole amount of cell’ nuclei stained with Hoechst 33258 within a given field area. There was no staining of nontransfected HEK293 cells with the antiCASR antibody. 2.6. Measurement of [Ca2+] i by fluorometry of intracellular Ca2+ mobilisation in P136L mutant To functionally characterise the novel P136L-CaR, HEK-293 cells were transiently transfected by wild-type CaR or P136L-CaR, and intracellular calcium mobilisation was determined by FURA-2/AM (Molecular Probes, Darmstadt, Germany) as previously described (Bai et al., 1996; D’Souza-Li et al., 2002). HEK293 cells were plated in 75 cm2 flasks and transfected with wt-CaR or mutant CaR. After 72 hours, HEK293 cells were resuspended in HEPES 20 mM, pH 7.4, and loaded with FURA-2/AM (Invitrogen), washed again, pelleted, and suspended in HEPES. Measurement of the intracellular calcium
concentration [Ca2+]i was performed in a Hitachi F2000 spectrofluorometer using cells in suspension. Aliquots of cell suspension were placed in a quartz cuvette and used for fluorescence measurements, according to the modified technique employed previously (Fajtova et al., 1991; Hofer et al., 2000). CaR was activated by multiple additions of Ca2+ solution in incremental doses to reach the desired concentrations (0–100 mM). Excitation monochronometres were centered at 340 nm and 380 nm, with emission light collected at 510 ± 40 nm through a wide-band emission filter. The magnitude of response at each concentration of Ca2+ was measured as the maximal increment from baseline. In most experiments, the peak responses were observed about 60–80 s after stimulation. The 340/380 excitation ratio of emitted light was used to calculate the [Ca2+]i. For measuring EC50, the [Ca2+]i in response to 0.5–7.0 mM [Ca2+]0, was recorded. The EC50 value was calculated by plotting the intracellular calcium concentration [Ca2+]i response against the extracellular calcium addition [Ca2+]0 and normalised to value achieved at 0.5 mM respectively for wild type and P136L mutant CaR. The mean EC50 (median effective concentration) values, determined from 6 independent experiments between wild-type and P136L mutant CaR, were compared by ANOVA test. A p-value
