Biochimica et Biophysica Acta, 1130(1992) 197-202 © 1992 Elsevier Science Publishers BA,. All rights reserved 0167-4781/92/$05.00

197

BBAEXP 92356

Differential tissue expression of multiple genes for chicken smooth muscle/nonmuscle myosin regulatory light chains A k i h i r o I n o u e !, M a s a s h i Y a n a g i s a w a 2 a n d T o m o h Masaki 2 Institute of Basic Medical Sciences, Unicersity of Tsukuba, Tsukuba, Ibaraki (Japan)

(Received I l November 1991)

Key words: Myosin light chain; Smooth muscle; Nonmuscle myosin The eDNA clones for two distinct mRNAs encoding one of the two known isoforms of chicken smooth muscle/nonmusclc myosin regulatory light chain were isolated. The nucleotide sequences of these cDNAs were very similar to each other (99q~ nucleotide identities) in the 516 bp translated regions and in the first 33 bp of the 3' noncoding regions, whereas the rest of the 3' noncoding regions and the 5' noncoding regions had no significant similarity. Genomic Southern blot analysis showed that these two mRNAs were encoded in two individual genes. Whereas these two genes encoded almost identical polypeptides with only one conservative substitution of amino acid residues, expression of the mRNAs was differentially regulated both at the transcriptional and translational levels in various tissues of the chicken.

Introduction Myosin is a major contractile protein widely distributed in eukaryotic muscle and nonmuscle cells. It is a hexamer molecule comprising a pair of heavy chains, a pair of essential light chains and a pair of regulatory (phosphorylatable, 20 kDa) light chains. Myosin regulatory light chain (MRLC) from vertebrate smooth muscle/nonmuscle cells plays a key role in the regulation of smooth muscle contraction and nonmuscle cell motility via the Ca2+-calmodulin dependent phosphorylation catalyzed by myosin light chain kinase [1,2]. Multiple isoforms have been found in all of these subunits of myosin, and the expression of the isoforms is differentially regulated in a tissue-specific and developmental stage-related manner [3]. The existence of two subtypes of smooth muscle MRLC isoforms was also reported in the pig [4,5] and the rat [6] at the protein level. We previously demonstrated at the mRNA level that, in addition to the known smooth muscle MRLC isoform [7-10], there was another

Present address: i The Graduate University for Advanced Studies, and Laboratory of Neurochemistry, National Institute for Physiological Sciences, Okazaki 444, Japan and 2 Department of Pharmacology, Kyoto University Faculty of Medicine, Kyoto 606, Japan. Abbreviation: MRLC, myosin regulatory light chain. Correspondence: M. Yanagisawa, Department of Pharmacology, Kyoto University Faculty of Medicine, Sakyo-ku, Kyoto 606, Japan.

MRLC isoform in chicken gizzard [11]. We designate the former as L20-A and the latter as L20-B, respectively [11]. We also reported that one of these isoforms, L20-B, appeared to be encoded by two distinct mRNAs. Northern blot analysis showed that, while the translated regions of the two mRNAs were cross-hybridizable to each other under high stringency, the 3' noncoding regions were quite divergent [11]. in the present study, to examine the mechanism of the generation of the two L20-B related mRNAs, we cloned and sequenced the cDNAs for both of these mRNAs. Genomic Southern and Northern blot analysis showed that two L20-B mRNAs are encoded by two separate genes, which are differentially expressed in various chicken tissues. Materials and Methods

cDNA cloning and sequencing Approx. 3 - l 0 s clones from an embryonic chicken gizzard eDNA library constructed in Agtll [1I] was screened by plaque hybridization with the 375 bp EcoRI fragment from the translated region of GMRLB1 [11] (7EE; Fig. 1). One of the 17 hybridizationpositive clones, GMBRB2, did not hybridize with the 322 bp PstI.EcoRI fragment from the 3' noncoding region of GMRLBI (7PE; Fig. 1). The EcoRI inserts of GMRLB2 were subcloned into pUCllS/I19 plasraids in both directions, and sequenced by the dideoxy chain termination method [12].

198 Results and Discussion

Southern and Northern blot analysis For genomic Southern blot analysis, DNA (6 /~g/lane) prepared from 8-day-old whole chicken embryo was digested with restriction endonucleases, fractionated in a 0.8% agarose gel, and alkaline-transferred to a GeneScreen Plus membrane (DuPont). For No,hem blot analysis, total (8 /~g/lane) prepared adult and embryonic chicken tissues by the LiCl/urea method [13] was separated in a formaldehyde/1.2% agarose gel and transferred to a GeneScreen Plus membrane. Hybridization was done at 42°C in the presence of 50% (v/v) formamide; the membranes were washed at 65°C in 0,3 M NaCl/30 mM sodium citrate/1% SDS.

Cloning of two mRNAs encoding L2o-B isoform of chicken non-sarcomeric MRLC We have previously isolated a cDNA clone, GMRLB1, corresponding to one of the two mRNAs for the L20-B isoform of chicken gizzard MRLC [11]. The same eDNA library was rescreened with a coding-region probe derived from GMRLB1 (7EE; Fig. 1). We identified and sequenced one cDNA clone, GMRLB2, which hybridized with the coding-region probe but not with a 3' noncoding-region probe (7PE; Fig. 1). Fig. 2 shows the 1436 bp nucleotide sequence of GMRLB2 aligned with GMRLB1. The polypeptide coding sequences (nucleotide 1-516) were almost perfectly conserved with the exception of six sporadic nucleotide substitutions. Accordingly, the encoded amino acid sequences for GMRLBI and GMRLB2 (the encoded polypeptides are denoted hereafter as L20-B1 and L20B2, respectively) were identical with only one exception: Arg-4 of L20-BI was substituted with a chemically similar amino acid residue Lys-4 in L2o-B2. Furthermore, the first 36 nucleotide residues of the 3' noncoding regions (including the stop codon) were also identical. In contrast, GMRLB1 and GMRLB2 abruptly lost their sequence similarity at nucleotide 553 in the 3' noncoding regions (the borders are shown by vertical arrows in Figs. 1 and 2). No significant similarity was detected in the remainder of the 3' noncoding regions or in the 5' noncoding regions.

S I nuclease protection assay SI nuclease protection assay was performed essentially as described [14]. The 236 bp SacI-Accl fragment of GMRLB2 (3JSA in Fig. 1) was 3' end-labeled with terminal deoxynucleotidyl transferase in the presence of [¢-'~2P]-2',3'-dideoxyATP (Amersham) as recommended by the manufacturer. The probe DNA (4.104 cpm) was hybridized with 50/~g of total RNA from chicken tissues at 45.5°C for 16 h in 20/tl of a buffer containing 80% (v/v) fonnamide/0.4 M NaCl/40 mM Pipes (pH 6.4)/1 mM EDTA/0.1% SDS. The DNARNA hybrid was then incubated with 560 units of S1 nuclease (Boehringer-Manheim) at 37°C for 40 rain in a buffer (360/zl) containing 1 M NaCl/60 mM sodium acetate/20 mM ZnSO4/10 ~tg/mi sonicated salmon testis DNA. Nucleic acids were precipitated in ethanol and separated in a 6% polyacrylamide/urea sequencing gel, followed by autoradiography.

~

~

~

~/.

Multiple genes for chicken non-sarcomeric MRLC We previously reported that 1.4 kb and 1.1 kb mRNAs from both adult and embryonic chicken gizzard

~

AATAAA

tO0 t)lJ

GMIIIMIll sP-I

~

TEE

I

I

7PE

AATAAA~ ~"

AATAAA I

GMIILII~

'aJp

;

I

I

I

3JSA

'~

~

I

I

Fig. 1. Restriction maps of chicken smooth muscle/nonmuscle MRLC cDNAs cloned in GMRLBI and GMRLB2. Open boxes indicate the pobjpeptide coding regions of the mRNAs. Bars (SP, 7EE, 7PE, 3JP and 3JSA) represent the probe sequences used in this study. Arrowheads indicate the coding-region nucleotide substitutions in GMRLB2 as compared with GMRLBI. Vertical arrows indicate the borders of the highly conserved stretches of sequence between GMRLBI and GMRLB2.

19q hybridized with the GMRLB1 coding-region probe, whereas the 3' noncoding region probe hybridized only with the 1.1 kb mRNA [11]. In contrast, the GMRLB2-specific 3JP probe (Fig. 1) detected the 1.4 kb mRNA but not 1.1 kb mRNA (Fig. 3). To verify ttmt GMRLB1 and GMRLB2 cDNAs are authentic copies of these mRNAs, we performed S1 nuclease protection assay for mRNAs from chicken tissues with the Sac lAccl fragment of GMRLB2 (probe 3JSA in Fig. 1). This probe contained 126 bp of the coding-region sequence common to GMRLB1 and GMRLB2, plus B2

B1 B2

110 bp of the 3' noncoding sequence specific for GMRLB2. A fully protected 236-base signal corresponding to the 1.4 kb LE0-B2 mRNA, in addition to a partially protected 126-base band corresponding to the 1.1 kb L20-B1 mRNA, was detected in different tissues (Fig. 4). Furthermore, the relative intensities of these signals were consistent with the results from Northern blot analysis (see Fig. 6); e.g., LE0-B2 mRNA was abundant in the brain but not in the pectoralis muscle. We conclude from these findings that GMRLB1 and GMRLB2 cDNAs are not derived from artifactual prod-

CCGTCACACCGAGGCGCCGCGCAGCCGCTGGGGGCTTCAGACCGGAGTTCCATTCTT CCGGTCCTGCTGCTGCCGCCAG-AGCCAACAGC GTAGACAGATCTATTAAGAAGGGAACCCAt;ACAAAAG.T.C .... T..CAGAGT.AA..T.T .... A.AT

B1 " ~ C A A C ~ T C T A G C A A A A G G G C A A A G A C G A A G A C C ~ C C A A G A A G C G C C C T C A G C G C G C C A C G T C C A A T G B2 .............. AA .................................................

-75 -5 -5 64 64

BI B2

TATTTGCCATGTTTGATCAGTCCCAGATCCAGGAATTCAAGGAGGCCTTCAACATGATTGATCAGAACAG o,,.,,.,,,o,,.,,,,e,o,,,,,..,,.,.,,'',''''''''''''''''''''''''''''''''

134 134

B1 B2

GGATGGCTTCATTGACAAGGAGGACTTGCACGACATGCTTGCCTCCCTCGGGAAGAACCCAACGGATGAA .....................-.......---.-...-.'"-'--'"'''"'"'"'''"'"'"

204 204

B1 B2

TACCTGGATGCCATGATGAACGAGGCTCCAGGGCCCATCAACTTCACAATGTTCCTCACAATGTTTGGTG ................................ C .....................................

274 274

BI B2

AGAAACTCAATGGCACTGATCCGGAAGATGTCATCAGGAATGCTTTTGCTTGCTTTGACGAAGAAGCAAC .... G ..................................................... T ...........

344 344

B1

AGGGTTTATTCAAGAAGACTACCTGCGGGAGCTGCTGACCACGATGGGAGACAGGTTCACAGATGAAGAG

414 414

B1 B2

GTAGATGAGCTCTACAGAGAGGCACCAATCGACAAAAAGGGCAATTTCAACTACATTGAATTCACGCGCA 484

B1 B2

TCCTTAAACATGGAGCGAAAGACAAGGCTGAC~ GCAAATCCCTGGACACCTACCTGCAGATTTTCT~552 ................ A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 552

BI B2

--CTACTTTACACTCATGT-TTATTTTTGAGGGGGTTTTCCTGGTAGAACTTGTTGCATGCATT---TAG TTT.G .... TTTT.TT.T.CCCCCCCC.C...ACC.G..TT.TT-TTTTT-CT''T'TCT .... GGGACC

616 622

B1 B2

CTTTACA-ACTTTTGCCTTTCTTAATGTATT ..... TATCTATTC-CGGACCATTTAGGCACAACTGCAC .... G..T..A...CTGGCA...C.GC.T..GCCTC.G.AG.C..TG.-G.TGC'C ....... C ..... G

679 692

B1 B2

CTGTGTAATCAGACTGGAAGT-TGGGAAAATACTGTAAGGAGAAG-GAGATAG-GGACAAAGATAAGTGA T.T..C.T.A ......... A.G..CAGGG.G.GA.G.T,.CTT..A.TT .... A..TTT.G..AC.AA..

746 762

BI B2

ACTTTGAAGTCCAAGAAAAT---AATCTCAGTGTTTCTGGTT-TGGCTGGATTTTTACATTTTTTGTAAT TT.GG.GT.GGG.G.C.C..ACAG..G.TGA .... A..CC..C.A...A .... C..G..AC..A..GT.A

812 832

BI B2

AAATGGCATTTTGAAATAAAG-ATTGCTATATAGATAAAAAAAAAA~ CTT.T...--A.A ..... Ct~.CT..AT..A...C..CGTTAAGCAGTTTCATGCTAGAGGTGGGCTGTTT

863 900

B2 B2 B2 B2 B2 B2

ATCTAATCATTTCTGTAAA~ATTCCTGCAGCTGTATACAGTCTTGGCATGATCTACTTTTGCCTTAATGA AGCATAAGTCACTTACACATACTGAATTTGTACGTCAGTGACTGAACTCTTCCCAGTGACTGAGTACTTC ATTTCCTACTGTGAGCATACAAAATGAAGCAATTCACACCCCTCACGTGTTACTACACTGTAAATTAATG AGTTTTGTCCTAGACTTGCACGTTAAGATTTTAAAATCCTATGGGTGTAATGGAGGTGGTATTTCACTGT TTATCTTAACTGCTTCATTTCTGGACAGTGAGTACAGCATTAATACTGCTTTTTTAAACTCACGTGGTAA ATCCTGTGCTTTCTGTAAAATAAAAAAGTCTGTGTATGAAAAAAAA~AAAAAAAA

1040 IIi0 1180 1250 1305

,.,,..,.,,.,...,..,,,,,...,--..,.,,."""'''"'""'"''""'"''"'"

484

970

Fig. 2. Nucleotide sequences of GMRLB1 (BI) and GMRLB2 (B2). In the GMRLB2 sequence, nucleotide residues identical to those in GMRLBI are designated by dots. Dashes designate the gaps introduced to attain an optimal sequence alignment. Underlines indicate putative polyadenylation signals. Arrows indicate the border of the highly conserved regions.

o.

uJ

B

-3 O3

(kb)

LI.I I£1 I:1. tD

23.1 28S ,.(kb)

9.4 6.6

18S ,,-

23.1

4.4

9.4 ~" 6.6

2.3 2.0

4.4

Gizzard Fig, 3, Northern blot analysis of mRNAs for chicken gizzard L:o-BI and L,o-B2 MRLC, Total RNA (8/zg) from adult chicken gizzard was hybridized with labeled 7EE (translated region), 7PE (GMRLBl-specific) or 3JP (GMRLB2-specific) probes (see Fig, !). The !,i kb and 1.4 kb signals represent L.,o-BI and L2o-B2 mRNAs, respectively,

2.3 ="

2.0 =" 0.56

0 . 6 ="

ucts of the cloning procedure. In addition to the 236 and 126 base signals, we detected an approx. 165 base product in the S! nuclease analysis (Fig. 4). This signal nt

|

2

3

4

S

6

7

299-

Bgl II

Xbal

Eco RI

Fig. 5. Genomic Southern bot analysis with chicken smooth muscle MRLC cDNAs as probes. (A) Chicken genomic DNA was diges,'ed with Bglll or Xbal and hybridized with labeled 7EE (translated region), 7PE (GMRLBI-specific) or 3JP (GMRLB2-specific) probes (see Fig. I). (B) DNA was digested with EcoRl, and hybridized with the TEE and SP probes.

268258-

175-

m Q

•

103-

~

8t-

O

•

Fig. 4. SI Nuclease mapping of RNA from chicken tissues with L~-B2 eDNA probe. 50 p.g of total RNA prepared from adult chicken brain (lane 3), gizzard (lane 4), pectoralis muscle (lane 5) ventricle (lane 6), and 15/~g of yeast tRNA as negative control (lane 7) were hybridized with 3' end-labeled 3JSA probe (see Fig. 1), and subjected to S! nuclease mapping. Lane 2, intact probe.-Lane i, 3' end-labeled Haelll fragments of pUCI9 plasmid as size markers.

may represent yet another variant of L2o-B related transcript, although further study is required to identify the nature of the signal. To examine whether the two L2o-B related mRNAs are each encoded in separate genes or derived from a single gene by alternative mRNA processing, we carried out genomic Southern blot analysis with these eDNA probes. The coding-region probe (7EE) hybridized with two Bglll fragments and two Xbal fragments (Fig. 5A). Irrespective of the restriction enzyme used, one of the two positive fragments also hybridized to the GMRLBl-specific probe (7PE), whereas the other fragment to the GMRLB2-specific sequence (3JP). The 7EE probe also hybridized to two EcoRl fragments (approx. 1.9 kb and 5.0 kb long; Fig. 5B). These results are consistent with the notion that the two mRNAs corresponding to GMRLB1 and GMRLB2 are each encoded by separate genes. The weaker hybridization to one of the two positive fragments in the 7EE lanes of Fig. 5A and B might be due to the three scattered base substitution within the 7EE region between GMRLB1 and GMRLB2 sequences (see arrowheads in Fig. 1), considering the high hybridization stringency used in this study. In contrast, the synthetic 'guess-mer' oligonucleotide probe (SP; Fig. 1) that encodes for amino acid residues 24-43 [11] and is universal for all non-sarcomeric MRLC isoforms including

201 °~

28S

(,,)

,"-

1 8 S ,,-

Fig. 6. Tissue distribution of Lzo-BI and Lao-B2 mRNAs in adult chicken. Total RNA prepared from the designated tissues was hybridized with labeled 7EE (translated region) probe. The positions of chicken 18S and 28S ribosomal RNAs are indicated.

L20-A [6], hybridized with yet another EcoRI fragment (9.0 kb). We conclude from these results, in conjunction with the sequence data from the cloned cDNAs (Fig. 2, Ref. 11), that there exist at least three separate genes for smooth muscle/non-muscle MRLC isoforms in the chicken genome. The negative hybridization of the SP probe to the L2o-B1 or L2o-B2 genes is most likely due to the existence of an EcoRI site in the middle of the probe regions in these genes (Fig. I); L2o-A gene contained no EcoRI site at this position [9,10]. These results also indicate that GMRLB1/ GMRLB2-derived probes were not hybridizable to L2,A gene at all under the. stringency we used.

Differential tissue expression of mRNAs for L2o-B isoform of chicken non-sarcomeric MRLC We further examined the distribution of the two L20-B mRNAs in various muscle and nonmuscle tissues from adult chicken by Northern blot analysis with the coding-region probe. Both L20-B1 mRNA and L2o-B2 mRNA were present in all muscle and nonmuscle tissues we examined (Fig. 6), including the skeletal and cardiac muscles in which no smooth muscle/nonmuscle MRLC has been detected at the protein level [15]. Furthermore, the relative amounts of L2o-B1 mRNA and L 20-B2 mRNA varied significantly between tissues. For example, the pectoralis muscle contained much larger amounts of L~0-B1 mRNA (88% by densitometry of the autoradiograms) as compared with L20-B2 mRNA (12%), whereas L2o-B2 mRNA was much more abundant (72%) than L20-B1 mRNA (28%) in the kidney. These observations suggest the possibility that the expression of L2o-B1 gene and L20-B2 gene is regulated differentially at both the transcriptional and

translational levels in a tissue-specific manner. Toubman et al. [15] also reported similar translational regulation of the expression of rat smooth muscle MRLC gene. A previous report of two-dimensional gel electrophoretic analysis of porcine MRLC [16] showed that 'satellite' MRLC species running near the major MRLC spot, which most likely corresponds to L20-B in the chicken [11], represents a nonmuscle MRLC isoform. Co-existence of multiple smooth muscle/nonmuscle MRLC isoforms was demonstrated also in human platelet [17]. A preliminary two-dimensional gel electrophoresis study showed that LEo-B is the predominant isoform of smooth muscle/nonmusele MRLC in chicken brain (H. Takano-Ohmuro, unpublished data), whereas L20-A is predominant in the smooth muscle tissue [11]. Recently, these results at the protein level has been supported by eDNA cloning of both L2o-A (smooth muscle type) and L20-B (nonmuscle 'cellular' type) MRLC isoforms in the chickens [18] and humans [19], which are encoded by separate genes. 'Fhe present study further supports these findings, and establish that there exist in the chicken genome at lease three distinct genes encoding for non-sarcomeric isoforms of MRLC. We previously reported significant enzymological differences between L20-A and L20-B as substrates for myosin light chain kinase [11]. Thus, myosin-bound L20-B was more rapidly phosphorylated by the kinase as compared with L20-A, and this biochemical difference was ascribed to the difference in their primary structures. However, since the encoded amino acid sequences of L20-BI and L20-B2 presented in this study are almost identical, it is unlikely that the biological properties of these two L20-B variants are appreciably different from each other. What is physiological significance of the apparently 'redundant' existence of these two LE0-B genes then? One attractive possibility is that the expression of these two genes is regulated in a different way from each other in response to various homeostatic signals, adding further cellular adaptability. Acknowledgements This study was supported in part by research grants from the Ministry of Education, Science and Culture of Japan, the Uehara Memorial Foundation, and the Daiko Foundation. References 1 Adelstein, R.S. and Einsenberg, E. (1980) Annu. Rev. Biochem. 49, 921-956. 2 Kamm, K.E. and Stull, J.T. (1985) Annu. Rev. Pharmcol. Toxicol. 25, 593-62.

202 3 Pearson, M.L. and Epstein, H.F. (1982) Molecular and cellular control of muscle development, Cold Spring Harbor Laboratory, New York. 4 D~ska, S.P., Aksoy, M.O. and Murphy, R.A. (1981) Am. J. Physiol. C222-C233. 5 Erd6di, F., B:~rfiny, M. and B~rfiny, K. (1987) Circ. Res. 61,

89s~9os. 6 ~ b i n a , S, Mougios, V., B~rfiny, M. and B~r~ny, K. (1986) Biochim, Biophys. Acta 871, 311-315. 7 Maita~ T,, Chen, J,I. and Matsuda, G. (1981) Eur. J. Biochem. 117, 417-424. 8 Pearson, R,B., Jakes, R., John, M., Kendrick-Jones, J. and Kemp, B, E. (1984) FEBS Lett. 168, 108-112. 9 Zavodny, P.J., Petro, M.E., Kumar, C.C,, Dailey, S.H., Lonial, H,K,, Narula, S,K, and Leibowilz, PJ. (1988) Nucleic Acids Res, 16, 1214-1214. 10 Messer, N.G. and Kendrick-Jones, J. (1988) FEBS Lett. 234, 49--52,

I I Inoue, A., Yanagisawa, M., Takano-Ohmuro, H. and Masaki, T. (1989) Eur. J. Biochem. 183, 645-651. 12 Sanger, F., Nicklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. 13 Inouie, A., Yanagisawa, M., Takuwa, Y., Mitsui, Y., Kobayashi, M. and Masaki, T. (1989) J. Biol. Chem. 264, 14954-14959. 14 Berk, A J. and Sharp, P.A. (1977) Cell 12, 721-732. 15 Toubman, M.B., Grant, J.W. and Nadal-Ginard, B. (1987) J. Cell Biol. 104, 1505-1513. 16 Eddinger, TJ., Gaylinn, B.D., Monical, P.L. and Murphy, R.A. 0988) Biophys. J. 53, 579. 17 Kawamoto, S, Bengur, A,R., Sellers, J.R. and Adelstein, R.S. (1989) J. Biol. Chem. 264, 2258-2265. 18 Zavodny, PJ., Petro, M.E., Lonial, H.K., Dailey, S.H., Narula, S.K,, Leibowitz, PJ. and Kumar, C.C. (1990) Circ. Res. 67, 933-940. 19 Kumar, C.C., Mohan, S.R., Zavodny, P.J., Narula, S.K. and Leibowitz, P.J. (1989) Biochemistry 28, 4027-4035.