No title

Human Gene Therapy

Page 1 of 42

© Mary Ann Liebert, Inc. DOI: 10.1089/hum.2020.113

1

Gene transfer in AAV seropositive rhesus macaques following Human Gene Therapy Gene transfer in AAV seropositive rhesus macaques following rapamycin treatment and subcutaneous delivery of AAV6 but not retargeted AAV6 vectors (DOI: 10.1089/hum.2020.113) This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.

Downloaded by AUT UNIVERSITY (Auckland University of Tech) from www.liebertpub.com at 10/05/20. For personal use only.

rapamycin treatment and subcutaneous delivery of AAV6 but not retargeted AAV6 vectors Daniel Stone1*, Elizabeth J. Kenkel3*, Michelle A. Loprieno1, Motoko Tanaka1, Harshana S. De Silva Feelixge1, Arjun J. Kumar1, Laurence Stensland3, Willimark M. Obenza2, Solomon Wangari6, Chul Y. Ahrens6, Robert D. Murnane6, Christopher W. Peterson2,5, Hans-Peter Kiem1,2,5, Meei-Li Huang3, Martine Aubert1, Shiu-Lok Hu4,6, Keith R. Jerome1,3, # 1

Vaccine and Infectious Disease Division, 2Clinical Research Division, Fred Hutchinson

Cancer Research Center, Seattle, WA; 3Department of Laboratory Medicine, 4Department of Pharmaceutics, 5Department of Medicine, University of Washington, Seattle, WA; 6

Washington National Primate Research Center, University of Washington, Seattle, WA

* Contributed equally #

Corresponding author

Emails: [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected], [email protected] Short title: Rapamycin enables AAV gene transfer in pre-immune macaques Keywords: Immunosupression, rapamycin, AAV, non-human primate, DARPin

Human Gene Therapy Gene transfer in AAV seropositive rhesus macaques following rapamycin treatment and subcutaneous delivery of AAV6 but not retargeted AAV6 vectors (DOI: 10.1089/hum.2020.113) This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.


Page 2 of 42

2

Corresponding author:

Keith R. Jerome, MD, PhD

Vaccine and Infectious Disease Division

Fred Hutchinson Cancer Research Center

1100 Fairview Ave N

Seattle

WA 98109

Email: [email protected]

Tel: 206-667-6793

Fax: 206-667-6179

Page 3 of 42

3



Abstract Adeno-associated virus (AAV) vectors such as AAV6, which shows tropism for primary human CD4+ T cells in vitro, are being explored for delivery of anti-HIV therapeutic modalities in vivo. However, pre-existing immunity and sequestration in non-target organs can significantly hinder their performance. To overcome these challenges, we investigated whether immunosuppression would allow gene delivery by AAV6 or targeted AAV6 derivatives in seropositive rhesus macaques. Animals were immune suppressed with rapamycin prior to intravenous (IV) or subcutaneous (SC) delivery of AAV, and we monitored vector biodistribution, gene transfer and safety. Macaques received either PBS, AAV6 alone, or an equal dose of AAV6 and an AAV6-55.2 vector retargeted to CD4 via a direct ankyrin repeat protein (DARPin). AAV6 and AAV6-55.2 vector genomes were found in PBMCs and most organs up to 28 days post administration, with the highest levels seen in liver, spleen, lymph nodes, and muscle, suggesting that retargeting did not prevent vector sequestration. Despite vector genome detection, gene expression from AAV6-55.2 was not detected in any tissues. SC injection of AAV6 facilitated efficient gene expression in muscle adjacent to the injection site, plus low-level gene expression in spleen, lymph nodes, and liver, whereas gene expression following IV injection of AAV6 was predominantly seen in the spleen. AAV vectors were well tolerated, although elevated liver enzymes were detected in 3 of 4 AAV treated animals 14 days after rapamycin withdrawal. One SC injected animal had muscle inflammation proximal to the injection site, plus detectable T cell responses against transgene and AAV6 capsid at study finish. Overall, our data suggests that rapamycin treatment may offer a possible strategy to express anti-HIV therapeutics such as broadly neutralizing antibodies from muscle. This study provides important safety and efficacy data that will aid study design for future anti-HIV gene therapies.

Page 4 of 42

4



Introduction Recombinant adeno-associated virus (AAV) vectors have been widely used as in vivo gene transfer vectors, and extensively tested in many gene therapy applications. AAV has a favorable safety record, efficiently transduces various tissue types, can be produced at high titer, and has low immunogenicity, making it a vector of choice for many

1-3

. AAV vectors

are being explored as gene delivery platforms for anti-HIV therapeutics. For example, local administration of AAV to muscle has been used to systemically deliver broadly neutralizing antibodies or the soluble CD4-mimetic eCD4-Ig to block HIV infection 4-6. Additionally, AAV6 has the potential to transduce CD4+ T cells based on its in vitro tropism

7-11

, which gives

AAV6 or variants engineered to bind CD4 the potential to deliver targeted anti-HIV therapeutics. These therapeutics could include HIV restriction factors or gene editing enzymes that target the HIV provirus such as CRISPR/Cas9. Unfortunately, many of the natural evolved properties of AAV hinder its potential as an HIV gene therapy vehicle, with perhaps the two largest hurdles being pre-existing immunity and sequestration in nontarget tissues. As natural hosts of AAV, humans and NHPs have a high incidence of antibodies to many of the vectorized AAV serotypes 12, 13, and studies have shown that up to 60% of humans possess anti-AAV antibodies 14-16. A subset of these are neutralizing antibodies (NAbs), which block viral infection by binding epitopes critical for cellular entry 17, 18. Broadly cross-reactive antibody responses to multiple AAV serotypes can be induced after a single natural infection with AAV 19. Antibodies can have a profound effect on the efficiency of AAV tissue transduction, with even low antibody titers limiting gene transfer 20, 21

. Notably, intravenous delivery of vector is most susceptible to antibody inhibition 21,

22

. Anti-AAV cellular immune responses can also limit gene transfer, and while such

responses are often weak, they are still capable of eliminating transduced cells 23. Immunosuppression has the potential to mitigate AAV- and transgene-specific humoral and cellular immune responses and improve vector transduction 24-29, although studies of immune responses in macaques or human liver and kidney transplant recipients have shown that pre-existing AAV-specific immune responses as well as the impact of immunosuppression on AAV-specific responses can be variable 30, 31.

Page 5 of 42

5



Many natural AAV serotypes have been isolated from humans and nonhuman primates (NHPs) 32, 33, and although each has a comparatively unique tropism, in general they all show tropism for multiple tissue types 34. A high AAV vector dose can be used to overcome vector sequestration in off-target tissue and cell types, but high level exposure of off-target tissues to vector has the potential to induce vector- or transgene-specific immune responses that can limit efficacy 35-37. Additionally, very high vector doses may lead to increased toxicity, and in some pre-clinical studies this has proved lethal 38. Therefore, attempts to retarget AAV and concurrently reduce the effective dose have been ongoing. Modification and retargeting of AAV has enabled successful transduction of many different cell types 39, but in vivo retargeted vectors can still be taken up by irrelevant cell types and tissues. To minimize non-specific tissue sequestration of AAV vectors, modification of natural receptor binding motifs within the capsid are required to substantially influence AAV vector biodistribution 40. Additionally, retargeting capsid modifications may also minimize immune responses to AAV 41-43. To realize the full potential of AAV vectors for HIV therapy, evasion of the host immune response and targeted cell transduction are key. Here, we demonstrate that immunosuppressive treatment with rapamycin before and after AAV delivery can prevent onset of AAV capsid- and transgene-specific cellular immunity, and importantly allows for AAV6-mediated gene transfer following subcutaneous administration in AAV6 seropositive rhesus macaques. Immunosuppression enabled efficient transfer of vector genomes and subsequent transgene expression in muscle, liver, spleen, and lymph nodes. We also showed that despite being ablated for native heparin sulfate proteoglycan (HSPG) and sialic acid binding, a CD4 retargeted AAV6 vector (AAV6-55.2) had a similar biodistribution to unmodified AAV6 in vivo. Our results suggest that immunosuppressive rapamycin therapy was well tolerated and could be used to suppress anti-AAV immunity, and facilitate efficient localized gene delivery of AAV6-based anti-HIV therapeutics to muscle.

Page 6 of 42

6



Materials and Methods AAV vectors To enable production of AAV6 vectors that are de-targeted and incorporate a modified VP2 with an N-terminal surface displayed DARPin targeting ligand, mutations were introduced by Quikchange mutagenesis into the AAV6 cap gene of the plasmid and pRepCap6 44. A synonymous ACG to ACC mutation that deletes the T138 VP2 start codon were introduced to prevent expression of native VP2 protein. Previously identified V473D (GTT to GAT) and K531E (AAA to GAA) mutations that ablate sialic acid and heparin binding respectively 45, 46 were introduced, creating the plasmid pAAV6-detarget. To generate the plasmid pDGM6-detarget which contains the modified AAV6 cap gene plus the adenovirus genes needed for generating AAV vectors, the modified AAV6 cap gene was amplified by PCR from pAAV6-detarget using primers AAV6cap-SwaI-F 5’CTTTGAACAATAAATGATTTAAATCAGGTATGGCTGCCGATGGTT3’ and AAV6cap-ClaI-R 5’CCGGACCCAAGGACATGCATCGATTGCTATGGTGACCAGATAAGATAAT3’, and then introduced into the plasmid pDGM6 47 by Gibson assembly following excisions of the wild type AAV6 cap gene by SwaI/ClaI digestion. To produce AAV6 vectors that display DARPins on the surface of their capsids, pcDNA3.1 derived plasmids were generated for expression in trans of VP2 with a CD4 targeted or control DARPin fused to its N-terminus. Plasmids incorporating DARPins specific for CD4 (55.2 and 57.2; Genbank accession numbers JC982162 and JC982163), Her2/neu (G3; Genbank accession JC982169) or a Lactococcus lactis ABC transporter (LmrCD; Genbank accession JQ425607), were generated (Supplemental Fig. 1A) 48-50. DARPins G3 and 55.2 contain two internal ankyrin repeat modules, and DARPins LmrCD and 57.2 contain three internal ankyrin repeat modules. VP2-DARPin constructs contained the following: an Nterminal 6-His tag, an IEGR factor Xa cleavage signal to remove the 6-His tag, each respective DARPin, a LYKYSDP linker and the AAV6 VP2 sequence (starting at cap amino acid P140) from pAAV6-detarget (Supplemental Fig. 1B). To enable production of control de-targeted sialic acid and HSPG binding ablated (AAV6) vectors that contain VP2 without

Page 7 of 42

7



an N-terminal DARPin, the V473D/K531E mutations were introduced into pRepCap6 by Quikchange mutagenesis to generate the plasmid pRepCap6-V473D-K531E. AAV production and purification Self-complementary AAV (scAAV) vectors expressing GFP or mCherry were generated using the AAV vector plasmids pscAAV-MND-GFP 51 or pscAAV-MND-mCherry. pscAAVMND-mCherry was generated by removing the GFP gene from pscAAV-MND-GFP by HindII/NotI digestion and inserting an mCherry PCR product via Gibson assembly. The MND promoter is a modified Moloney murine leukemia virus (MoMuLV) LTR-derived promoter with myeloproliferative sarcoma virus enhancer and deleted negative control region 52. AAV vectors were produced by transient transfection of HEK293 cells with plasmids containing vector, helper and packaging sequences as previously described 53, 54. The pDGM6 plasmid was used to package control AAV6 vectors with native tropism. The pRepCap6-V473D-K531E plasmid was used to generate control de-targeted AAV6 vectors. To generate de-targeted and DARPin re-targeted AAV6 vectors, cells were co-transfected with AAV vector plasmid, pDGM6-detarget, and a pcDNA-DARPin-AAV6-VP2 plasmid. For in vitro studies, AAV vectors were purified by iodixanol gradient separation (Supplemental Fig. 2), then concentrated into PBS using Amicon Ultra-15 100K MW columns as previously described 53. For in vivo studies, AAV6 vectors were purified by HPLC affinity chromatography (Supplemental Fig. 2) using a HiTrap heparin column (GE Healthcare), followed by dialysis against HBSS as described 54. The de-targeted AAV6-55.2 vector used for in vivo studies that displays a CD4-specific DARPin on the capsid was concentrated by precipitating combined clarified cell lysate and culture supernatant from virus cultures by adding 40% PEG 8000 to a final concentration of 8% and then incubating on ice for 2 hours. Virus was then pelleted by centrifugation and re-suspended, digested with Factor Xa for 16 hours at 37oC to remove the N-terminal His tag, purified using first a step cesium chloride gradient and then an isopycnic cesium chloride gradient (Supplemental Fig. 2), before dialysis against HBSS as described previously 54. All AAV vectors were quantified by qPCR according to the method of Aurnhammer et al 55 or Southern blot as described previously 47

.

Page 8 of 42

8



Cell lines HEK293 and HEK293T cells have been described previously 56, 57. Stable cell lines 293ThCD4 and 293T-RhCD4 that express human CCR5 plus human or rhesus CD4 were generously provided by Dr. Julie Overbaugh 58. All cells were grown in DMEM + 10% FBS. Primary CD4+ T cells and in vitro AAV transduction Primary CD4+ T cells were extracted from human PBMCs using the EasySep human CD4 T cell isolation kit (Stemcell) and from rhesus macaque peripheral blood using a custom rhesus CD4 T cell isolation kit (Stemcell). Cells were cultured in IMDM plus 10% FBS containing 30 U/ml of rhIL-2 (human and rhesus cells). Prior to AAV transductions cells were plated at 2.5x106 cells/well in 24 well plates and activated for 72 hours with CD3/CD28 Dynabeads for human CD4+ T cells (Thermo Fisher) and according to the protocol of Munoz et al. for rhesus CD4+ T cells 59, using paramagnetic beads (Dynabeads M-450 Tosylactivated, Thermo Fisher) coated with mouse monoclonal antibodies antihuman CD3 (clone SP34-2 BD Biosciences, San Jose CA) and anti-human CD28 (CD28.2 obtained from Dr. Daniel Olive, INSERM, France, through the NIH Nonhuman Primate Reagent Resource). Activated primary CD4+ T cells were incubated with iodixanol purified AAV vectors at the indicated MOI for 2.5 hours before media was changed, and levels of gene transfer were measured at 48 hours post transduction. Anti-AAV ELISA Nunc MaxiSorp Immunoplates were coated with AAV6 particles overnight at 4oC in a volume of 50l using 1x109 vector genomes/well diluted in carbonate-bicarbonate coating buffer (Sigma-Aldrich # c3041-50CAP). Wells were then washed 3 times with PBS-T (0.05% Tween 20 in PBS), incubated with blocking/binding buffer (PBS-T + 6% BSA) for 2 hours at room temperature, and then washed 3 more times with PBS-T. Macaque serum was heatinactivated at 56oC for 30 minutes, serially diluted in blocking/binding buffer, and added to wells for 1 hour at 37oC in a volume of 50l. Intravenous immunoglobulin (Gammagard; cat#1500190, Baxter) was used as a positive control, and guinea pig serum (Gene Tex; cat# GTX27482) was used as a negative control. Wells were then washed 3 times with PBS-T

Page 9 of 42

9



before incubation with 50l of a 1:500 dilution in blocking/binding buffer of mouse antihuman IgG Fc HRP conjugated antibody (clone JDC-10, SouthernBiotech; cat# 555788) for 1 hr at 37oC. Wells were washed 3 more times with PBS-T, then 100l of TMB substrate solution (Thermo Fisher; cat# N301) was added for 15-30 minutes at room temperature before stopping the reaction by adding 100l of TMB stop solution (Thermo Fisher; cat# N600) and reading the plate absorbance at 450nm. Animal welfare statement The protocol was approved by the Institutional Animal Care and Use Committee of the University of Washington, (Protocol # 2370-30), and was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the NIH (“The Guide”). All animals were housed at the Washington National Primate Research Center (WaNPRC) and were housed using standard WaNPRC recommendations and monitoring procedures. Study details Studies were performed in male and female rhesus macaques of 3-11 years of age, and 4-8 Kg in size. Rapamycin (Selleck Chemicals) was administered orally from 7 or 15 days preAAV administration with an initial single dose of 2mg/Kg, followed by daily doses of 1mg/Kg up to 14 days post AAV administration. Drug was administered daily as powder in an applesauce treat, or via oral gavage under sedation. Animals were administered AAV via intravenous injection in the saphenous vein or via interscapular subcutaneous injection in the back in a volume of 10ml diluted in 1X UPS grade PBS (Quality Biological Inc). Animals were administered a total dose of 1x1013 vector genomes per animal of either scAAV6MND-GFP, or a 50:50 mixed dose preparation of scAAV6-MND-GFP and scAAV6-55.2MND-mCherry vectors. Blood draws were performed at days 0, 1, 3, 7, 14, 21 and 28 post AAV administration. At day 7 post AAV administration a single inguinal lymph node was removed and punch biopsies were taken from the colon. Animals were humanely euthanized at day 28 post AAV administration.

Page 10 of 42

10



Blood, lymph node, colon and spleen processing CBC and T-cell subset analysis was performed by the WaNPRC virology core. Blood chemistry analysis was performed at the University of Washington Medical Center clinical laboratory. PBMC were isolated from whole blood by Ficoll density gradient separation and cryopreserved in freezing medium (90% FBS, 10% DMSO). All tissues for lymphocyte extraction were collected into R10 media (RPMI 1640, 10% FBS) and stored on ice until processing. For lymphoid cell extraction, colonic tissue was digested in R10 media containing 0.1U/ml liberase (Roche) and 20g/ml Dnase I (Sigma Aldrich) at 37oC for 1 hour with agitation. Digested tissue was then filtered through a 70M cell strainer, pelleted, and then washed with fresh R10 media before cell counting and cryopreservation in freezing medium. For lymph nodes and spleen, fat was trimmed before tissue was cut into small pieces and ground through a 70M cell strainer. Cells were pelleted, and then washed with fresh R10 media before cell counting and cryopreservation in freezing medium. For spleen, a 5 minute incubation in ACK lysing solution (Thermo Fisher) was performed immediately after the wash step to remove contaminating erythrocytes. Flow cytometry and cell sorting Flow cytometry was performed using cryopreserved PBMC or tissue derived mononuclear cells. Cells were stained with the following antibodies: BV570 mouse anti-human CD20 (Biolegend - #302332, 1:20 dilution), BV605 mouse anti-human CD4 (Biolegend - #317438, 1:20 dilution), BV785 mouse anti-human CD14 (Biolegend - #301840, 1:20 dilution), BV650 mouse anti-human CD3 (BD Biosciences - #563916, 1:20 dilution), ApcCy7 mouse antihuman CD8 (BD Biosciences - #557760, 1:20 dilution), BV421 mouse anti-human CD95 (BD Biosciences - #562616, 1:10 dilution), PE mouse anti-human CD28 (BD Biosciences #556622, 1:10 dilution), PE-Cy7 mouse anti-rhesus macaque CD45 (BD Biosciences #561294, 1:20 dilution), and PerCP-eFluor710 rat anti-human CCR7 (ThermoFisher - #461979-42, 1:10 dilution). Stained cells were acquired on an FACSARIA III (BD Biosciences) and analyzed using FlowJo software v10.5.3 (FlowJo, LLC).

Page 11 of 42

11



Quantitative PCR Prior to DNA extraction, tissue was snap frozen, PBMCs were cryopreserved in freezing media, and tissue-derived mononuclear cells were snap frozen. Prior to RNA extraction, tissue samples or lymphocyte populations were placed in RNA Later and PBMCs were cryopreserved in freezing media. DNA was extracted using the Roche MagNA Pure 96 system. AAV vector genomes were detected using primer probe sets specific for GFP and mCherry, and copies per cell were calculated using a primer/probe set designed for the rhesus RPP30 (Supplemental Table 1). Levels of GFP or mCherry mRNA were also detected by qRT-PCR using the same primer/probe sets. Histology and Immunohistochemistry Tissues were formalin fixed then paraffin embedded after necropsy before sectioning at 5m. For basic histology sections were stained with hematoxylin and eosin. To detect expression of GFP or mCherry in different tissues immunohistochemistry was performed on the Leica Bond RX automated stainer (Leica biosystems). GFP was detected using rabbit polyclonal anti-GFP (ThermoFisher # A11122; 1:1000 dilution) primary antibody, TCT blocking buffer (Leica biosystems), H2 antigen retrieval buffer (Leica biosystems), and H2O2 peroxidase block (Leica biosystems). mCherry was detected using mouse monoclonal anti-mCherry (Fred Hutch Experimental Histopathology - Clone G6; 1:2000 dilution) primary antibody, TCT blocking buffer (Leica biosystems), H1 antigen retrieval buffer (Leica biosystems), and H2O2 peroxidase block (Leica biosystems). Primary antibodies were detected with PowerVision Poly-HRP anti-rabbit (Leica biosystems), or PowerVision Poly-HRP anti-mouse (Leica biosystems) respectively, and DAB chromagen substrate (Leica biosystems). Sections were counterstained with hematoxylin. For fluorescent labeling of GFP positive cells in combination with CD8 or CD20 cells in trapezius muscle, antigen retrieval was performed on deparaffinized sections using Sodium citrate buffer (10 mM Sodium citrate, 0.05% Tween 20, pH 6.0). Sections were then blocked with 10% donkey serum + 1% BSA in TBS before incubation with goat antiGFP (Novus #NB100-1770; 1:200) in combination with rabbit anti-CD8 (Abcam #ab4055; 1:200) or rabbit polyclonal anti-CD20 (Abcam #ab9475; 1:1000) antibodies in TBS + 1%

Page 12 of 42



12 BSA. Donkey anti-goat Alexa Fluor 488 (Abcam #ab150129; 1:200) and donkey anti-rabbit Alexa Fluor 594 (ThermoFisher #A-21207; 1:200) secondary antibodies were diluted in TBS + 1% BSA. ELISpot assay IFN-specific ELISpot assays were performed in triplicate using the human IFN single-color 384-well enzymatic ELISPOT assay (ImmunoSpot) according to the manufacturer’s recommendations. Briefly, 105 PBMCs were stimulated with the indicated mitogens/antigens for 24 hours prior to incubation with IFN-capture antibody and subsequent detection of IFN-specific responses. PBMCs were stimulated with DMSO, 5g/ml Concanavalin A re-suspended in sterile water, recombinant mCherry (Origene, #TP790040) and recombinant eGFP (Origene, #TP790050) readjusted to 1g/ml in DMSO, or 1g/ml of pooled 15mer peptides with 11 amino acid overlap spanning the entire length of eGFP (JPT Peptide Technologies GmbH, #PM-EGFP) or AAV6 VP1 (JPT Peptide Technologies GmbH, #PM-AAV6-VP1) re-suspended in DMSO. Results Detection of anti-AAV6 antibodies in rhesus macaques Pre-existing capsid-specific antibodies pose a hurdle to AAV-mediated gene delivery as they can prevent transduction via direct neutralization and may play a role in other cellmediated AAV vector clearance mechanisms 60, 61. In the healthy human population preexisting anti-AAV6 antibodies have been reported at levels of up to 46% 62, and in a study of 50 rhesus macaques the prevalence of anti-AAV6 NAbs was also high (68%) 13. We therefore developed an ELISA to quantify capsid-specific antibodies against AAV6 and used this ELISA to screen a panel of 11 rhesus macaques that were available for our study for pre-existing antibodies that could potentially impede gene transfer by AAV6 derived vectors. We screened sera from several different species including sheep, mouse and guinea pig to identify one that did not bind to AAV6 virions and found that guinea pig sera was the best internal negative control serum (data not shown). Unexpectedly, moderate to high levels of anti-AAV6 capsid-specific binding antibodies were detected in all animals,

Page 13 of 42

13



with half maximal binding (OD 450nm = 1.5) seen between a 1:90 and 1:2430 dilution of serum (Supplemental Fig. 3). The five animals with the lowest levels of AAV6-specific antibodies (half maximal binding over an approximately 3-fold dilution range, 1:90-1:810) were selected for use in our study (A1730950 SFU/106 cells) after AAV administration in a single animal (SC1), and only at day 28 post AAV administration once rapamycin had been withdrawn for 14 days. In day 28 PBMCs from animal SC1, moderate IFN T cell responses of similar magnitudes (270-570 SFU/106 cells) were detected following stimulation with recombinant mCherry and eGFP protein, and with eGFP or AAV6 peptide pools. Notably, animal SC1 received one week less rapamycin pre-treatment prior to AAV vector delivery, and also had the highest levels of pre-existing AAV6-specific humoral immunity in serum collected prior to study initiation (Supplemental Fig. 3). Discussion Two of the main barriers to AAV use for system wide in vivo gene delivery are pre-existing humoral and cellular immunity due to previous exposures to naturally occurring AAV serotypes, and the sequestration of AAV vector in non-target tissues and cell types following systemic or localized delivery. In this study we tested whether approaches to avoid these hurdles would enable either widespread or target cell-specific gene transfer in rhesus macaques. We also performed one of the first studies to assess the gene transfer efficiency of an engineered AAV vector in a non-human primate. Pre-existing AAV capsid-specific neutralizing antibodies and cytotoxic T cells (CTLs) pose a significant barrier to AAV vector-mediated gene transfer. Pre-existing AAV6-specific

Page 21 of 42

21



antibodies were detected in serum from all 11 macaques screened for this study. We selected the five animals with the lowest levels of AAV-6 specific antibodies for our study, and none of these animals had AAV6-specific T cells at the onset of the study. We administered the immunosuppressive drug rapamycin before and after AAV administration, as several studies have shown that rapamycin or other immunosuppressive therapies can increase the efficiency of AAV gene transfer via modulation of humoral and cellular immune responses, which may lead to tolerance to AAV capsid and transgene products 24, 25, 27-29. Our study used a rapamycin dosing regimen that was previously able to suppress levels of anti-AAV antibodies efficiently 27, but longitudinal serum samples were not collected, precluding analysis of the degree to which rapamycin treatment affected the levels of anti-AAV6 antibodies over time. On the other hand, we measured transgene and capsid-specific T cell responses in PBMCs for all animals before, during and after rapamycin treatment. In 3 of the 4 animals that received AAV, no AAV6 or transgene-specific T were detected at either 14 or 28 days post AAV administration despite delivery of the moderately high dose of 1013 AAV vector genomes per animal. This suggests that rapamycin may have suppressed cellular immune responses against the capsid and transgenes in these 3 animals during therapy. In animal SC1, robust T cell responses against both capsid and transgene) were detected in macaque PBMCs (270-570 SFU/million cells, but only at day 28 post AAV administration, when high levels of CD8 and CD20 positive cells were also seen in trapezius muscle proximal to the injection site. Notably, animal SC1 received the shortest rapamycin pretreatment period, had the highest levels of AAV6-specific antibodies prior to study onset, and only developed CTLs 14 days after the cessation of rapamycin treatment. Despite these encouraging effects of rapamycin on cellular immunity, the lack of available serum samples prevents comparison of the relative effects on cellular vs. humoral immunity. Efficient suppression of anti-AAV antibody levels by rapamycin would be expected to improve initial AAV biodistribution and gene transfer, and rapamycin could also blunt the boosting of circulating anti-AAV6 antibodies after AAV6 or AAV6-55.2 administration. Future studies should address the degree to which both cellular and humoral responses are impacted by similar immune suppressive regimens, particularly in a setting where subjects are effectively being ‘readministered’ an AAV vector to which they already show seropositivity.

Page 22 of 42

22



In an attempt to prevent non-specific AAV sequestration and facilitate gene transfer into CD4+ cells throughout the body, we generated de-targeted and CD4 retargeted vectors based on the AAV6 serotype, which is able to efficiently transduce primary human CD4+ T cells in vitro7-11. Like AAV6, CD4 retargeted AAV6 vectors, were able to transduce human CD4+ T cells, but unexpectedly neither vector performed as well in primary rhesus macaque CD4+ T cells isolated from two independent donors. This species difference could be due to lower activity from the MND promoter in rhesus CD4+ T cells than in human CD4+ T cells, although the MND promoter has shown activity in other rhesus hematopoietic cell populations previously 78. CD4 retargeted AAV6-55.2 and AAV657.2 vectors were able to transduce HEK293 cells via human and rhesus CD4 in vitro (Supplemental Fig. 5), so it is unlikely that receptor binding is the reason for this observation. It is possible that species-specific differences in vector uptake, trafficking, and uncoating occur between rhesus and human cells CD4+ T cells, and might account for the observed differences. Alternatively, the species disparity may due to differences in primary CD4+ T cell activation status following stimulation by human vs rhesus CD3/CD28 beads in culture. Further studies will be required to determine which factors influence these differences. Despite our attempt to prevent non-specific sequestration, our AAV6-55.2 vector was found in almost all organs after subcutaneous delivery, a delivery route that was chosen to facilitate more rapid drainage of vector into lymph nodes that are rich in tissueresident CD4+ T cells based on previous studies using nanoparticles of a similar size to AAV 79, 80

. While subcutaneous delivery of AAV between the shoulder blades did lead to

efficient local delivery of both AAV6 and AAV-55.2 to skin and trapezius muscle, overall the biodistribution of AAV6-55.2 following SC delivery was similar to that seen for unmodified AAV6, albeit at lower levels. This implies that much of the in vivo biodistribution of AAV6 could be independent of its ability to utilize either HSPGs or sialic acid for cell entry, as known receptor usage for AAV6 and AAV6-55.2 does not overlap (HSPG/Sialic acid vs CD4). Since our study was small, all animals were sacrificed at day 28 post AAV administration, and no tissue biodistribution data is available from earlier time points, it is not possible to determine whether the higher levels of AAV6 observed were a result of AAV6-55.2

Page 23 of 42

23



detargeting, or whether cross competition between AAV6 and AAV6-55.2 vectors via an unknown mechanism may have contributed to the observed differences. The biodistribution of AAV6 and AAV6-55.2 may be less distinct early after AAV administration, and it is possible that AAV6-55.2 was cleared from organs more rapidly than AAV6 by day 28 post AAV delivery. Furthermore, even though AAV6-55.2 was able to transduce activated human and rhesus macaque CD4+ T cells in vitro, and vector genomes were detected in macaque PBMCs and lymphoid organs, no gene transfer from was detected from this vector in lymphoid cells from any animal. Additional studies are needed to determine which mechanisms influence the observed differences in biodistribution in vivo. Previously, Munch et al. showed that enrichment for DARPin containing virions via iMac His purification increases the specificity of AAV2-55.2 vectors for human CD4+ T cells both in vitro and in vivo 73. Our AAV6-55.2 vector was not iMac purified so a fraction of the vector likely did not display DARPin 55.2 on the capsid surface. As much as 68% of virions within an AAV-DARPin vector prep are thought to display DARPins on their surface 73, but for our AAV6-55.2 vector preparation it is unknown what percentage of virions displayed DARPin 55.2. This may explain why the biodistribution of AAV6-55.2 was not more restricted to tissues containing CD4+ lymphocytes, and was similar to AAV6 vector biodistribution. Previous targeting studies showing that iMac purified AAV2-55.2 vectors can selectively transduce CD4+ T cells in vivo were performed in humanized NSG mice that contain CD4+ T cells. Unlike humanized NSG mice, macaques contain a full complement of immune cells, and other cell types that express CD4, such as monocytes, macrophages and microglia, which may have acted as a sink for AAV6-55.2. A recent study in rhesus macaques and pigs found that a very high AAV dose of 2 x 1014 genomes/Kg caused severe toxicity, transaminitis, and in extreme cases liver failure, or proprioceptive deficits and ataxia that impaired movement, all of which necessitated euthanasia 38. Our animals received a significantly lower but still moderately high AAV dose, but were nevertheless monitored for hallmarks of AAV-mediated toxicity such as transaminitis, or fluctuations in blood cell counts. Previous studies in humans and macaques have seen transaminitis following delivery of AAV2, AAV8 or variant AAV9 vectors at doses ranging from 2x1012 -2x1014 vg/Kg 20, 21, 26, 38, 81, which is thought to be

Page 24 of 42

24



caused by CTL-mediated lysis of AAV transduced hepatocytes after systemic AAV administration 23. The commonly accepted explanation is that CTLs involved in this process are predominantly directed against vector transgenes and not the AAV capsid, although the main target for CTL responses following AAV gene therapy can vary between transgene and capsid across different species including macaques 82-86. In macaques, transgenespecific T cells have been detected at high frequency in PBMCs and livers of some animals, and at higher levels than capsid-specific T cells 86, 87. On the other hand, capsid-specific CD4+ and CD8+ T cells are detected at high frequency in both rhesus macaques and humans exposed to natural AAV infections, although their ability to differentiate and function differs from those found in humans 30. In our study, no clinically significant toxicity was observed, although ALT and AST levels above normal were seen in multiple animals, but only after rapamycin had been withdrawn for 14 days, and histologic evidence of biliary stasis was seen in all animals that received AAV. The highest elevations of hepatic enzymes were seen in the animal that received AAV intravenously, received a shorter duration of rapamycin pre-treatment, had the highest baseline T lymphocyte levels, and had elevated CD8+CD4- T cell counts, concurrently with transaminitis. Interestingly, no correlation was seen between liver toxicity and treatment-related T cell responses in any animal. Moreover, transaminitis was not observed in the only animal (SC1) with detectable capsid or transgene-specific T cells at day 28 post AAV administration. Beyond the transaminitis observed in 3 of 4 animals receiving AAV, no other major hallmarks of toxicity were detected aside from inflammation adjacent to the delivery site within the trapezius muscle of all animals receiving subcutaneous AAV, and the aforementioned biliary stasis in all animals receiving AAV. A number of in vivo studies suggest that AAV6 has a broad tissue tropism in vivo, but the widespread transduction of muscle and other organs previously seen in mice 47, 65, 67, 69

was not observed in NHPs beyond the trapezius muscle proximal to the AAV injection

site. AAV6 can transduce hepatocytes in mice 67, sheep 88, and dogs 66, but in our study hepatocyte transduction was only detected at low levels in the 2 animals receiving AAV subcutaneously after the longest rapamycin pretreatment (SC2 and SC3). These animals had no AAV or transgene-specific CTLs at day 28 post AAV administration. Animal SC1,

Page 25 of 42



25 which also received AAV subcutaneously but had shorter rapamycin pretreatment, had the lowest vector genome levels in liver, the highest anti-transgene and anti-AAV T cell responses at day 28 post AAV administration, and no detectable gene transfer in liver. Here we present a pre-clinical evaluation of an AAV6 vector and an engineered CD4-retargeted AAV6 vector in immune-suppressed rhesus macaques that had pre-existing antibodies against AAV6 at the onset of the study. This setting is conceivable in humans, where anti-AAV antibodies are prevalent. Despite the evidence of pre-existing anti-AAV6 immunity, both vectors were well tolerated, with only minor evidence of clinically insignificant toxicity. Immunosuppressive rapamycin treatment enabled high-level localized gene expression from AAV6 in trapezius muscle, and other organs following subcutaneous delivery, whereas no gene transfer was detected from the CD4-retargeted AAV6 vector in any organs. Overall, our study demonstrates that immunosuppressive therapy can enable efficient gene transfer in rhesus macaques despite the presence of preexisting immunity to AAV, and offers hope for future AAV-mediated gene therapies that target diseases such as HIV in patients that previously may not have been considered for treatment. Acknowledgements We thank Jeff Chamberlain, James Allen and Christine Halbert of the Senator Paul D. Wellstone Muscular Dystrophy Cooperative Research Center vector core at the University of Washington for production of in vivo grade AAV vectors. We thank Sandra Dross and Deb Fuller for advice developing multi-color rhesus macaque flow cytometry panels. We thank David Russell for generously providing the plasmids pRepCap6 and pDGM6. We thank Julie Overbaugh for generously providing cell lines 293T-hCD4 and 293T-RhCD4. Funding This work was funded by grants from amfAR (ARCHE-GT grant # 109575-62-RGRL), the National Institute of Allergy and Infectious Diseases (UM1 AI126623), and in part by a developmental grant from the University of Washington Center for AIDS Research (CFAR), an NIH funded program under award number P30 AI 027757 which is supported by the



Page 26 of 42

26 following NIH Institutes and Centers (NIAID, NCI, NIMH, NIDA, NICHD, NHLBI, NIA, NIGMS,

NIDDK), and in part by NIH/NCI Cancer Center Support Grant P30 CA015704.

Author disclosure statement

The authors declare no competing financial interests

Page 27 of 42

27



References 1.

Mingozzi F, High KA. Therapeutic in vivo gene transfer for genetic disease using AAV:

progress and challenges. Nature reviews Genetics 2011;12:341-355. 2.

Kotterman MA, Schaffer DV. Engineering adeno-associated viruses for clinical gene

therapy. Nature reviews Genetics 2014;15:445-451. 3.

Buning H, Perabo L, Coutelle O et al. Recent developments in adeno-associated

virus vector technology. The journal of gene medicine 2008;10:717-733. 4.

Gardner MR, Fetzer I, Kattenhorn LM et al. Anti-drug Antibody Responses Impair

Prophylaxis Mediated by AAV-Delivered HIV-1 Broadly Neutralizing Antibodies. Mol Ther 2019;27:650-660. 5.

Johnson PR, Schnepp BC, Zhang J et al. Vector-mediated gene transfer engenders

long-lived neutralizing activity and protection against SIV infection in monkeys. Nat Med 2009;15:901-906. 6.

Martinez-Navio JM, Fuchs SP, Pantry SN et al. Adeno-Associated Virus Delivery of

Anti-HIV Monoclonal Antibodies Can Drive Long-Term Virologic Suppression. Immunity 2019;50:567-575 e565. 7.

Sather BD, Romano Ibarra GS, Sommer K et al. Efficient modification of CCR5 in

primary human hematopoietic cells using a megaTAL nuclease and AAV donor template. Sci Transl Med 2015;7:307ra156. 8.

Wang J, DeClercq JJ, Hayward SB et al. Highly efficient homology-driven genome

editing in human T cells by combining zinc-finger nuclease mRNA and AAV6 donor delivery. Nucleic Acids Res 2016;44:e30. 9.

Bak RO, Porteus MH. CRISPR-Mediated Integration of Large Gene Cassettes Using

AAV Donor Vectors. Cell Rep 2017;20:750-756.

Page 28 of 42



10.

28 Hale M, Lee B, Honaker Y et al. Homology-Directed Recombination for Enhanced

Engineering of Chimeric Antigen Receptor T Cells. Mol Ther Methods Clin Dev 2017;4:192203. 11.

MacLeod DT, Antony J, Martin AJ et al. Integration of a CD19 CAR into the TCR Alpha

Chain Locus Streamlines Production of Allogeneic Gene-Edited CAR T Cells. Mol Ther 2017;25:949-961. 12.

Calcedo R, Morizono H, Wang L et al. Adeno-associated virus antibody profiles in

newborns, children, and adolescents. Clinical and vaccine immunology : CVI 2011;18:15861588. 13.

Wang D, Zhong L, Li M et al. Adeno-Associated Virus Neutralizing Antibodies in

Large Animals and Their Impact on Brain Intraparenchymal Gene Transfer. Mol Ther Methods Clin Dev 2018;11:65-72. 14.

Li C, Narkbunnam N, Samulski RJ et al. Neutralizing antibodies against adeno-

associated virus examined prospectively in pediatric patients with hemophilia. Gene Ther 2012;19:288-294. 15.

Erles K, Sebokova P, Schlehofer JR. Update on the prevalence of serum antibodies

(IgG and IgM) to adeno-associated virus (AAV). Journal of medical virology 1999;59:406411. 16.

Fitzpatrick Z, Leborgne C, Barbon E et al. Influence of Pre-existing Anti-capsid

Neutralizing and Binding Antibodies on AAV Vector Transduction. Mol Ther Methods Clin Dev 2018;9:119-129. 17.

Gurda BL, DiMattia MA, Miller EB et al. Capsid antibodies to different adeno-

associated virus serotypes bind common regions. J Virol 2013;87:9111-9124. 18.

Gurda BL, Raupp C, Popa-Wagner R et al. Mapping a neutralizing epitope onto the

capsid of adeno-associated virus serotype 8. J Virol 2012;86:7739-7751.

Page 29 of 42



19.

29 Calcedo R, Wilson JM. AAV Natural Infection Induces Broad Cross-Neutralizing

Antibody Responses to Multiple AAV Serotypes in Chimpanzees. Hum Gene Ther Clin Dev 2016;27:79-82. 20.

Manno CS, Pierce GF, Arruda VR et al. Successful transduction of liver in hemophilia

by AAV-Factor IX and limitations imposed by the host immune response. Nat Med 2006;12:342-347. 21.

Jiang H, Couto LB, Patarroyo-White S et al. Effects of transient immunosuppression

on adenoassociated, virus-mediated, liver-directed gene transfer in rhesus macaques and implications for human gene therapy. Blood 2006;108:3321-3328. 22.

Scallan CD, Jiang H, Liu T et al. Human immunoglobulin inhibits liver transduction by

AAV vectors at low AAV2 neutralizing titers in SCID mice. Blood 2006;107:1810-1817. 23.

Pien GC, Basner-Tschakarjan E, Hui DJ et al. Capsid antigen presentation flags

human hepatocytes for destruction after transduction by adeno-associated viral vectors. J Clin Invest 2009;119:1688-1695. 24.

Meliani A, Boisgerault F, Hardet R et al. Antigen-selective modulation of AAV

immunogenicity with tolerogenic rapamycin nanoparticles enables successful vector readministration. Nat Commun 2018;9:4098. 25.

Corti M, Elder M, Falk D et al. B-Cell Depletion is Protective Against Anti-AAV Capsid

Immune Response: A Human Subject Case Study. Mol Ther Methods Clin Dev 2014;1. 26.

Nathwani AC, Tuddenham EG, Rangarajan S et al. Adenovirus-associated virus

vector-mediated gene transfer in hemophilia B. N Engl J Med 2011;365:2357-2365. 27.

Ramsingh AI, Gray SJ, Reilly A et al. Sustained AAV9-mediated expression of a non-

self protein in the CNS of non-human primates after immunomodulation. PLoS One 2018;13:e0198154. 28.

Velazquez VM, Meadows AS, Pineda RJ et al. Effective Depletion of Pre-existing

Anti-AAV Antibodies Requires Broad Immune Targeting. Mol Ther Methods Clin Dev 2017;4:159-168.

Page 30 of 42



29.

30 Mingozzi F, Hasbrouck NC, Basner-Tschakarjan E et al. Modulation of tolerance to

the transgene product in a nonhuman primate model of AAV-mediated gene transfer to liver. Blood 2007;110:2334-2341. 30.

Li H, Lasaro MO, Jia B et al. Capsid-specific T-cell responses to natural infections

with adeno-associated viruses in humans differ from those of nonhuman primates. Mol Ther 2011;19:2021-2030. 31.

Parzych EM, Li H, Yin X et al. Effects of immunosuppression on circulating adeno-

associated virus capsid-specific T cells in humans. Hum Gene Ther 2013;24:431-442. 32.

Gao G, Alvira MR, Somanathan S et al. Adeno-associated viruses undergo

substantial evolution in primates during natural infections. Proc Natl Acad Sci U S A 2003;100:6081-6086. 33.

Gao G, Vandenberghe LH, Alvira MR et al. Clades of Adeno-associated viruses are

widely disseminated in human tissues. J Virol 2004;78:6381-6388. 34.

Kaufmann KB, Buning H, Galy A et al. Gene therapy on the move. EMBO molecular

medicine 2013;5:1642-1661. 35.

Buning H, Srivastava A. Capsid Modifications for Targeting and Improving the

Efficacy of AAV Vectors. Mol Ther Methods Clin Dev 2019;12:248-265. 36.

Vandamme C, Adjali O, Mingozzi F. Unraveling the Complex Story of Immune

Responses to AAV Vectors Trial After Trial. Hum Gene Ther 2017;28:1061-1074. 37.

Herzog RW. Complexity of immune responses to AAV transgene products - Example

of factor IX. Cell Immunol 2017. 38.

Hinderer C, Katz N, Buza EL et al. Severe Toxicity in Nonhuman Primates and Piglets

Following High-Dose Intravenous Administration of an Adeno-Associated Virus Vector Expressing Human SMN. Hum Gene Ther 2018;29:285-298. 39.

Hacker U, Buning H. Optimizing the adeno-associated viral vector system: a brief

summary. Therapeutic delivery 2011;2:967-970.

Page 31 of 42



40.

31 Reul J, Muik A, Buchholz CJ. Ligand Coupling to the AAV Capsid for Cell-Specific

Gene Transfer. Methods Mol Biol 2019;1950:35-50. 41.

van Lieshout LP, Domm JM, Rindler TN et al. A Novel Triple-Mutant AAV6 Capsid

Induces Rapid and Potent Transgene Expression in the Muscle and Respiratory Tract of Mice. Mol Ther Methods Clin Dev 2018;9:323-329. 42.

Martino AT, Basner-Tschakarjan E, Markusic DM et al. Engineered AAV vector

minimizes in vivo targeting of transduced hepatocytes by capsid-specific CD8+ T cells. Blood 2013;121:2224-2233. 43.

Huttner NA, Girod A, Perabo L et al. Genetic modifications of the adeno-associated

virus type 2 capsid reduce the affinity and the neutralizing effects of human serum antibodies. Gene Ther 2003;10:2139-2147. 44.

Rutledge EA, Halbert CL, Russell DW. Infectious clones and vectors derived from

adeno-associated virus (AAV) serotypes other than AAV type 2. J Virol 1998;72:309-319. 45.

Huang LY, Patel A, Ng R et al. Characterization of the Adeno-Associated Virus 1 and

6 Sialic Acid Binding Site. J Virol 2016;90:5219-5230. 46.

Wu Z, Asokan A, Grieger JC et al. Single amino acid changes can influence titer,

heparin binding, and tissue tropism in different adeno-associated virus serotypes. J Virol 2006;80:11393-11397. 47.

Gregorevic P, Blankinship MJ, Allen JM et al. Systemic delivery of genes to striated

muscles using adeno-associated viral vectors. Nat Med 2004;10:828-834. 48.

Schweizer A, Rusert P, Berlinger L et al. CD4-specific designed ankyrin repeat

proteins are novel potent HIV entry inhibitors with unique characteristics. PLoS Pathog 2008;4:e1000109. 49.

Seeger MA, Mittal A, Velamakanni S et al. Tuning the drug efflux activity of an ABC

transporter in vivo by in vitro selected DARPin binders. PLoS One 2012;7:e37845.

Page 32 of 42



50.

32 Zahnd C, Wyler E, Schwenk JM et al. A designed ankyrin repeat protein evolved to

picomolar affinity to Her2. J Mol Biol 2007;369:1015-1028. 51.

De Silva Feelixge HS, Stone D, Pietz HL et al. Detection of treatment-resistant

infectious HIV after genome-directed antiviral endonuclease therapy. Antiviral Res 2016;126:90-98. 52.

Challita PM, Skelton D, el-Khoueiry A et al. Multiple modifications in cis elements of

the long terminal repeat of retroviral vectors lead to increased expression and decreased DNA methylation in embryonic carcinoma cells. J Virol 1995;69:748-755. 53.

Choi VW, Asokan A, Haberman RA et al. Production of recombinant adeno-

associated viral vectors for in vitro and in vivo use. Curr Protoc Mol Biol 2007;Chapter 16:Unit 16 25. 54.

Halbert CL, Allen JM, Chamberlain JS. AAV6 Vector Production and Purification for

Muscle Gene Therapy. Methods Mol Biol 2018;1687:257-266. 55.

Aurnhammer C, Haase M, Muether N et al. Universal real-time PCR for the

detection and quantification of adeno-associated virus serotype 2-derived inverted terminal repeat sequences. Hum Gene Ther Methods 2012;23:18-28. 56.

DuBridge RB, Tang P, Hsia HC et al. Analysis of mutation in human cells by using an

Epstein-Barr virus shuttle system. Mol Cell Biol 1987;7:379-387. 57.

Graham FL, Smiley J, Russell WC et al. Characteristics of a human cell line

transformed by DNA from human adenovirus type 5. J Gen Virol 1977;36:59-74. 58.

Nahabedian J, Sharma A, Kaczmarek ME et al. Owl monkey CCR5 reveals synergism

between CD4 and CCR5 in HIV-1 entry. Virology 2017;512:180-186. 59.

Munoz NM, Trobridge GD, Kiem HP. Ex vivo expansion and lentiviral transduction of

Macaca nemestrina CD4+ T cells. J Med Primatol 2009;38:438-443. 60.

Parren PW, Burton DR. The antiviral activity of antibodies in vitro and in vivo. Adv

Immunol 2001;77:195-262.

Page 33 of 42



61.

33 Mingozzi F, High KA. Overcoming the Host Immune Response to Adeno-Associated

Virus Gene Delivery Vectors: The Race Between Clearance, Tolerance, Neutralization, and Escape. Annu Rev Virol 2017;4:511-534. 62.

Boutin S, Monteilhet V, Veron P et al. Prevalence of serum IgG and neutralizing

factors against adeno-associated virus (AAV) types 1, 2, 5, 6, 8, and 9 in the healthy population: implications for gene therapy using AAV vectors. Hum Gene Ther 2010;21:704712. 63.

Sipo I, Fechner H, Pinkert S et al. Differential internalization and nuclear uncoating

of self-complementary adeno-associated virus pseudotype vectors as determinants of cardiac cell transduction. Gene Ther 2007;14:1319-1329. 64.

Thomas CE, Storm TA, Huang Z et al. Rapid uncoating of vector genomes is the key

to efficient liver transduction with pseudotyped adeno-associated virus vectors. J Virol 2004;78:3110-3122. 65.

Blankinship MJ, Gregorevic P, Allen JM et al. Efficient transduction of skeletal

muscle using vectors based on adeno-associated virus serotype 6. Mol Ther 2004;10:671678. 66.

Jiang H, Lillicrap D, Patarroyo-White S et al. Multiyear therapeutic benefit of AAV

serotypes 2, 6, and 8 delivering factor VIII to hemophilia A mice and dogs. Blood 2006;108:107-115. 67.

Zincarelli C, Soltys S, Rengo G et al. Analysis of AAV serotypes 1-9 mediated gene

expression and tropism in mice after systemic injection. Mol Ther 2008;16:1073-1080. 68.

Towne C, Raoul C, Schneider BL et al. Systemic AAV6 delivery mediating RNA

interference against SOD1: neuromuscular transduction does not alter disease progression in fALS mice. Mol Ther 2008;16:1018-1025. 69.

Zincarelli C, Soltys S, Rengo G et al. Comparative cardiac gene delivery of adeno-

associated virus serotypes 1-9 reveals that AAV6 mediates the most efficient transduction in mouse heart. Clin Transl Sci 2010;3:81-89.

Page 34 of 42



70.

34 Gao G, Bish LT, Sleeper MM et al. Transendocardial delivery of AAV6 results in highly

efficient and global cardiac gene transfer in rhesus macaques. Hum Gene Ther 2011;22:979-984. 71.

Munch RC, Janicki H, Volker I et al. Displaying high-affinity ligands on adeno-

associated viral vectors enables tumor cell-specific and safe gene transfer. Mol Ther 2013;21:109-118. 72.

Hartmann J, Munch RC, Freiling RT et al. A Library-Based Screening Strategy for the

Identification of DARPins as Ligands for Receptor-Targeted AAV and Lentiviral Vectors. Mol Ther Methods Clin Dev 2018;10:128-143. 73.

Munch RC, Muth A, Muik A et al. Off-target-free gene delivery by affinity-purified

receptor-targeted viral vectors. Nat Commun 2015;6:6246. 74.

Nayak S, Sarkar D, Perrin GQ et al. Prevention and Reversal of Antibody Responses

Against Factor IX in Gene Therapy for Hemophilia B. Front Microbiol 2011;2:244. 75.

Chen Y, Qin S, Ding Y et al. Reference values of clinical chemistry and hematology

parameters in rhesus monkeys (Macaca mulatta). Xenotransplantation 2009;16:496-501. 76.

Caldwell RG, Marshall P, Fishel J. Method validation and reference range values for a

peripheral blood immunophenotyping assay in non-human primates. J Immunotoxicol 2016;13:64-76. 77.

Lee JI, Shin JS, Lee JE et al. Reference values of hematology, chemistry, electrolytes,

blood gas, coagulation time, and urinalysis in the Chinese rhesus macaques (Macaca mulatta). Xenotransplantation 2012;19:244-248. 78.

Singh S, Khan I, Khim S et al. Safe and Effective Gene Therapy for Murine Wiskott-

Aldrich Syndrome Using an Insulated Lentiviral Vector. Mol Ther Methods Clin Dev 2017;4:1-16. 79.

Freeling JP, Koehn J, Shu C et al. Long-acting three-drug combination anti-HIV

nanoparticles enhance drug exposure in primate plasma and cells within lymph nodes and blood. AIDS 2014;28:2625-2627.

Page 35 of 42



80.

35 Freeling JP, Koehn J, Shu C et al. Anti-HIV drug-combination nanoparticles enhance

plasma drug exposure duration as well as triple-drug combination levels in cells within lymph nodes and blood in primates. AIDS Res Hum Retroviruses 2015;31:107-114. 81.

Greig JA, Limberis MP, Bell P et al. Non-Clinical Study Examining AAV8.TBG.hLDLR

Vector-Associated Toxicity in Chow-Fed Wild-Type and LDLR(+/-) Rhesus Macaques. Hum Gene Ther Clin Dev 2017;28:39-50. 82.

Mays LE, Wilson JM. The complex and evolving story of T cell activation to AAV

vector-encoded transgene products. Mol Ther 2011;19:16-27. 83.

Herzog RW. Complexity of immune responses to AAV transgene products - Example

of factor IX. Cell Immunol 2019;342:103658. 84.

Basner-Tschakarjan E, Mingozzi F. Cell-Mediated Immunity to AAV Vectors, Evolving

Concepts and Potential Solutions. Front Immunol 2014;5:350. 85.

Verdera HC, Kuranda K, Mingozzi F. AAV Vector Immunogenicity in Humans: A Long

Journey to Successful Gene Transfer. Mol Ther 2020;28:723-746. 86.

Wang L, Calcedo R, Wang H et al. The pleiotropic effects of natural AAV infections

on liver-directed gene transfer in macaques. Mol Ther 2010;18:126-134. 87.

Gao G, Wang Q, Calcedo R et al. Adeno-associated virus-mediated gene transfer to

nonhuman primate liver can elicit destructive transgene-specific T cell responses. Hum Gene Ther 2009;20:930-942. 88.

Davey MG, Riley JS, Andrews A et al. Induction of Immune Tolerance to Foreign

Protein via Adeno-Associated Viral Vector Gene Transfer in Mid-Gestation Fetal Sheep. PLoS One 2017;12:e0171132. 89.

Opie SR, Warrington KH, Jr., Agbandje-McKenna M et al. Identification of amino acid

residues in the capsid proteins of adeno-associated virus type 2 that contribute to heparan sulfate proteoglycan binding. J Virol 2003;77:6995-7006.



Page 36 of 42

90. 36 Zhong L, Li B, Mah CS et al. Next generation of adeno-associated virus 2 vectors:

point mutations in tyrosines lead to high-efficiency transduction at lower doses. Proc Natl

Acad Sci U S A 2008;105:7827-7832.

Page 37 of 42

37



Figure legends

Figure 1. Experimental details. A, timeline for individual animal treatments. Rapamycin was given daily via oral administration to all animals, and blood and tissue sampling was performed as indicated. B, Animal sex, age, weight, injection details, and levels of preexisting anti-AAV6 antibodies at study initiation. Animals IDs from Figure S6 were changed for clarity to reflect the control PBS injected (C1), intravenously injected (IV1) and subcutaneously injected (SC1-SC3) animals. NA – not applicable; Kg – kilogram; vg – vector genomes; IV – intravenous; SC – subcutaneous.

Page 38 of 42



38

Figure 2. AAV vector biodistribution. Quantification of AAV6-GFP and AAV6-55.2-mCherry vector genomes in PBMCs at days 0-28 (A), mononuclear cells from day 7 colon and inguinal lymph node biopsies (B), day 28 lymphoid necropsy tissues (C), and day 28 nonlymphoid necropsy tissues (D/E). All tissue DNA samples were treated with Chelex to remove PCR inhibitors. eGFP and mCherry copies are shown per two copies of the rhesus RPP30 housekeeping gene. LN – lymph node. Asterisk – PCR reaction inhibited despite Chelex treatment.



Page 39 of 42

39

Figure 3. AAV6 gene transfer. Spleen, trapezius muscle, axillary lymph node and liver were

analyzed for GFP expression at day 28 post AAV administration. Paraffin sections were

stained by immunohistochemistry with anti-GFP antibody. Scale bar = 500m (upper

panels); 50m (lower inset panels). Individual animal IDs are indicated in the upper left

corner.



Page 40 of 42

40

Figure 4. Longitudinal liver enzyme levels in blood. Time points are relative to

administration of PBS control or AAV vectors. Reference ranges for Macaca mulatta (mean

+/- SD) are indicated using data from Lee et al. (Yellow, 77).

Page 41 of 42



41

Figure 5. Inflammation proximal to the injection site. A, Trapezius muscle from each animal was stained with H&E to visualize inflammation proximal to the subcutaneous injection site. B, Immunohistochemistry of trapezius muscle sections from animals C1 (control, B1/B3) or SC1 (AAV + short dose rapamycin, B2/B4) was performed to detect GFP transgene expression in combination with infiltrating CD8+ T cells (B1/B2) or CD20+ B cells (B3/B4). Inset images (B1’, B2’, B3’, B4’) show infiltrating CD8+ or CD20+ immune cells.

Page 42 of 42



42

Figure 6. Capsid and transgene-specific cytotoxic T cell responses. AAV6, eGFP and mCherry specific T cell responses were measured for each animal by IFN ELISpot using PBMCs isolated before rapamycin treatment, at the termination of rapamycin treatment, and 14 days post cessation of rapamycin treatment. Rhesus macaque PBMCs from days -7 (animals C1, IV1 and SC1), day -15 (animals SC2 and SC3), day 14 (all animals) and day 28 (all animals) were incubated with the indicated mitogen or antigen for 24 hours at 37oC. In each well 100,000 PBMCs were then added to the IFN capture antibody coated plate in triplicate to detect antigen-specific effector cells. Asterisks represent samples where at least one replicate had too many spots to count, and these samples were set at the highest detected spot count within the experiment (205 counts per well). All values were converted to SFU per million cells. DMSO – Dimethyl sulfoxide; ConA – concanavalin A; Rec – recombinant; Pepmix – tiled 15mer peptides with 11 amino acid overlap.

[No title available]

[No title available]

[No title available]

[No title available]

[No title available]

[No title available]

Title index.

Misleading title.

Incorrect table title.

Title X: a critical difference.

CT scanners vie for title.

What makes a good title?

What's in a title--Mr or Dr?

Writing style: what's in a title?

[Funktionsoberarzt. Pseudo-title or meaningful position?].

Futurist Art: Motion and Aesthetics As a Function of Title.

The anatomy of an article: title, abstract, and introduction.

"The chronic patient": in search of a title.

Citations-be sure to have a good title.

World title boxing: from early beginnings to the first bell.

Peer bids for protection of title 'veterinary nurse'.

Barriers to effective outreach in Title VII nutrition programs.

Article title misstates the role of pavement sealers.

Title and Abstract Screening and Evaluation in Systematic Reviews (TASER): a pilot randomised controlled trial of title and abstract screening by medical students.

No title

Follow Us

Suggest Documents

[No title available]

[No title available]

[No title available]

[No title available]

[No title available]

[No title available]

Title index.

Misleading title.

Incorrect table title.

Title X: a critical difference.

CT scanners vie for title.

What makes a good title?

What's in a title--Mr or Dr?

Writing style: what's in a title?

[Funktionsoberarzt. Pseudo-title or meaningful position?].

Futurist Art: Motion and Aesthetics As a Function of Title.

The anatomy of an article: title, abstract, and introduction.

"The chronic patient": in search of a title.

Citations-be sure to have a good title.

World title boxing: from early beginnings to the first bell.

Peer bids for protection of title 'veterinary nurse'.

Barriers to effective outreach in Title VII nutrition programs.

Article title misstates the role of pavement sealers.

Title and Abstract Screening and Evaluation in Systematic Reviews (TASER): a pilot randomised controlled trial of title and abstract screening by medical students.

No title

Recommend Documents

Follow Us