Free Radical Research

ISSN: (Print) (Online) Journal homepage: https://www.tandfonline.com/loi/ifra20

Up-regulation of LncRNA NEAT1 induces apoptosis of human placental trophoblasts Fan Xufei , Zheng Xiujuan , Lou Jianyi , Ye Liyan , Yan Ting & Hu Min To cite this article: Fan Xufei , Zheng Xiujuan , Lou Jianyi , Ye Liyan , Yan Ting & Hu Min (2020): Up-regulation of LncRNA NEAT1 induces apoptosis of human placental trophoblasts, Free Radical Research, DOI: 10.1080/10715762.2020.1826468 To link to this article: https://doi.org/10.1080/10715762.2020.1826468

Published online: 01 Oct 2020.

Submit your article to this journal

View related articles

View Crossmark data

Full Terms & Conditions of access and use can be found at https://www.tandfonline.com/action/journalInformation?journalCode=ifra20

FREE RADICAL RESEARCH https://doi.org/10.1080/10715762.2020.1826468

ORIGINAL ARTICLE

Up-regulation of LncRNA NEAT1 induces apoptosis of human placental trophoblasts Fan Xufei, Zheng Xiujuan, Lou Jianyi, Ye Liyan, Yan Ting and Hu Min Department of Obstetrics and Gynecology, Affiliated Jinhua Hospital, Zhejiang University School of Medicine, Jinhua, China ABSTRACT

ARTICLE HISTORY

The trophoblast apoptosis induced by placental oxidative stress is a contributor to the pathological development of preeclampsia (PE), whereas the molecular mechanism remains unclear. In this study, we explored the role and mechanism of Long non-coding RNA (LncRNA) NEAT1 in trophoblasts apoptosis. In the placenta tissues of PE patients and H2O2-treated human trophoblast cell line HTR-8/SVneo, the expressions of LncRNA NEAT1, p53, and estrogen receptor a (ESRa) were increased whereas miR-18a-5p expression was decreased. ESRa expression was up-regulated by LncRNA NEAT1 overexpression and down-regulated by miR-18a-5p overexpression in HTR-8/SVneo cells. LncRNA NEAT1 could release ESRa expression through sponging miR-18a-5p and the transcription of LncRNA NEAT1 was promoted by p53. miR-18a-5p overexpression suppressed H2O2-induced cell apoptosis in HTR-8/SVneo cells, while the inhibitory effect of miR-18a-5p overexpression on cell apoptosis was abrogated by LncRNA NEAT1 overexpression. In summary, LncRNA NEAT1 transcription was induced by p53 under oxidative stress condition, the high expression of LncRNA NEAT1 subsequently increased ESRa expression by sponging miR-18a-5p, thus inducing trophoblasts apoptosis.

Received 15 July 2020 Revised 8 September 2020 Accepted 16 September 2020

Introduction Preeclampsia (PE) is one of the most common and serious pregnancy complications, which affects approximately 7% of nulliparous women [1,2]. Placental oxidative stress has been considered to be a key intermediary step in the pathogenesis of PE [3]. Increasing placental trophoblasts apoptosis, which is triggered by placental oxidative stress, contributing to the systemic vascular endothelial injury and eventually leads to maternal clinical symptoms [4,5]. Accordingly, clarifying the molecular mechanisms responsible for placental trophoblasts apoptosis would benefit us to have a more indepth understanding of the pathogenesis of PE. Oestrogen receptor a (ESRa) is a subtype of ESR, which is mainly expressed in ovaries, uterus, and placenta [6]. In pregnancies with PE, the expression level of ESRa was elevated than that in healthy pregnancies [7]. Meanwhile, ESRa mediated the proapoptotic and antiproliferative effects of oestradiol on human placental trophoblast cells [8]. Zhu et al. [9] identified that miR-18a-5p, a miRNA which was down-regulated in the placentas of severe PE [10], suppressed the translation of ESRa by binding to its mRNA, thus reducing the CONTACT Hu Min [email protected] 365# Renming Rd, Jinhua 321000, China

KEYWORDS

LncRNA NEAT1; oestrogen receptor a; miR-18a-5p; trophoblasts apoptosis; preeclampsia

apoptosis of human placental trophoblast cells. These previous studies suggest that miR-18a-5p/ESRa is a vital axis associated with the trophoblasts apoptosis during PE progression, whereas the upstream regulatory mechanism remains to be investigated. Long non-coding RNA nuclear-enriched abundant transcript 1 (LncRNA NEAT1) is a LncRNA that has been proposed to regulate stress response [11]. Mello et al. [12] reported that in pancreatic cancer cells, the transcription of LncRNA NEAT1 was induced by the transcriptional activator p53. Considering p53 is upregulated in the placental villous tissues of PE pregnancies and the up-regulation of p53 enhanced trophoblasts apoptosis [13,14], we speculated that LncRNA NEAT1 maybe also participated in the trophoblasts apoptosis during PE. As reported, LncRNAs could bind to miRNA and eliminate the inhibitory effect of them on target mRNA expression [15]. An et al. [16] found that LncRNA NEAT1 promoted paclitaxel resistance of ovarian cancer cells by releasing zinc-finger E-box binding protein 1 expression via adsorbing miR-194, proving that LncRNA NEAT1 was able to function as ceRNA. Thereby, we propose the following hypothesis: during PE, oxidative

Department of Obstetrics and Gynecology, Affiliated Jinhua Hospital, Zhejiang University School of Medicine,

ß 2020 Informa UK Limited, trading as Taylor & Francis Group

2

F. XUFEI ET AL.

stress elevated LncRNA NEAT1 expression through p53, the up-regulation of LncRNA NEAT1 increased ESRa expression by sponging miR-18a-5p, thus inducing trophoblasts apoptosis.

Table 1. Primer sequences used in the qRT-PCR analysis. Genes

Primers

Sequences (50 -30 )

ESRa

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

TTCGTCCTGGGACTGCACTTG GAGCACAGCCCGAGGTTAGA AAGTCTAGAGCCACCGTCCA CAATCCAGGGAAGCGTGTCA CACAGGCAGGGGAAATGTCT TGCTGCGTATGCAAGTCTGA UGTTCTAAGGTGCATCTAGTG GCTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGTG GCTCGCTTCGGCAGCACA GATTCCTATGTGGGCGACGA TGTAGAAGGTGTGGTGCCAG

p53 LncRNA NEAT1_1

Materials and methods Sample collection The placenta tissues between 36 and 40 weeks were obtained from pregnancies with PE (n ¼ 20) in the Jinhua Hospital of Zhejiang University. The placenta tissues of healthy pregnancies (36 to 40 weeks, n ¼ 20, HC group) were used as normal control. Small pieces (0.5 cm3) were obtained from the central part of tissue below one-third of the placenta (near the maternal side). All placental tissues were collected immediately after placental delivery, followed by washing with phosphate buffer saline (PBS). Then, all placental tissues were preserved at 80  C for the following experiments. Our study was approved by the Ethics Committee of the Jinhua Hospital of Zhejiang University. All pregnancies enrolled in this study signed informed consent forms.

Cell culture and transfection Institute of the Chinese Academy of Sciences provided us the human trophoblast cell line HTR-8/SVneo used in this study. HTR-8/SVneo cells were cultured in RPMI1640 medium containing 5% foetal calf serum. To induce oxidative stress, HTR-8/SVneo cells were incubated with 175 mM hydrogen peroxide (H2O2) for 24 h [17]. Sh-NEAT1, miR-18a-5p mimic, miR-18a-5p inhibitor, pCMV-p53, and their corresponding negative controls [shNC, mimic (mi)-NC, inhibitor (in)-NC, and pCMV-control (CTL)] were provided by RiboBio (CHN). Lentivirus-overexpress-NEAT1 (oe-NEAT1) and its negative control oe-NC were purchased from Genechem (CHN). Cell transfection was conducted using Lipofectamine 3000 (Thermo Fisher, USA). Forty-eight hours after transfection, cells were harvested or treated with H2O2 for another 24 h.

qRT-PCR qRT-PCR was conducted using SYBR-Green PCR Master Mix purchased from Applied Biosystems (CA). The relative expression levels of LncRNA NEAT1_1, miR-18a-5p, p53, and ESRa were calculated using the 2DDCT method, with U6 or b-actin served as an endogenous control. The primers sequences used in this study are shown in Table 1.

miR-18a-5p U6 b-actin

Dual-luciferase reporter gene assay To evaluate the effect of p53 on the activity of the promoter of LncRNA NEAT1, the sequence of LncRNA NEAT1 promoter was amplified and inserted into a pGL3-basic plasmid. HTR-8/SVneo cells were cotransfected with a plasmid containing LncRNA NEAT1 promoter þ pCMV-p53/pCMV-CTL. Forty-eight hours later, relative luciferase activities were measured. To measure the interaction between LncRNA NEAT1 and miR-18a-5p, the sequence of NEAT1 wild type (WT, containing the binding sites with miR-18a-5p) and NEAT1 mutant type (Mut, containing the mutant binding sites with miR-18a-5p) were amplified and inserted into the pmirGLO plasmids. HTR-8/SVneo cells were cotransfected with pmirGLO- NEAT1-WT/Mut þ miR18a-5p mimic/mimic-NC. Forty-eight hours later, relative luciferase activities were measured. The interaction between miR-18a-5p and ESRa mRNA was measured in the same way.

Chromatin immunoprecipitation (CHIP) A CHIP Assay Kit (Active Motif, USA) was purchased to detect the combination of p53 and LncRNA NEAT1 promoter. HTR-8/SVneo cells (1  107) were cross-linked using 1% formaldehyde solution. DNA samples were split into fragments using ultrasonication. The lysate was immunoprecipitated with an anti-p53 antibody (Abcam, UK) or anti-human IgG antibody (Abcam) or anti-H3 antibody (Abcam). Then, the LncRNA NEAT1 levels in the complex pulled down by anti-p53 antibody, anti-human IgG antibody, and anti-H3 antibody were assessed by PCR.

RNA pull-down assay miR-18a-5p-WT and miR-18a-5p-Mut were combined with biotin. Bio-NC was used as a blank control. The lysate of HTR-8/SVneo cells was incubated with Bio- miR18a-5p-WT or Bio-miR-18a-5p-Mut or Bio-NC and

FREE RADICAL RESEARCH

streptavidin-coupled magnetic beads. LncRNA NEAT1 level in the complex pulled down by Bio- miR-18a-5pWT or Bio-miR-18a-5p-Mut or Bio-NC was measured using qRT-PCR.

RNA immunoprecipitation (RIP) The lysate of HTR-8/SVneo cells was obtained using the RiP buffer (Millipore, USA), followed by centrifugation. The supernatant was reacted with anti-AGO2 antibody in the presence of protein A/G beads. Anti-IgG antibody was used as a control. qRT-PCR was used to determine the relative expression levels of LncRNA NEAT1 and miR-18a-5p in the immunoprecipitate.

Western blot The protein levels of ESRa, p53, cleaved-caspase 3, caspase 3 were determined by Western blot as previously described [18]. The primary antibodies used in this study were: anti-ESRa antibody (1:1000; Abcam), antip53 antibody (2 mg/mL; Abcam), anti-cleaved-caspase 3 antibody (1:500; Abcam), and anti-pro caspase 3 antibody (1:10000; Abcam). Anti-b-actin antibody (1 mg/ml; Abcam) was used as an internal control.

TUNEL assay A One-Step TUNEL Apoptosis Assay Kit (Beyotime, CHN) was utilised to detect the apoptosis of HTR-8/SVneo cells. Forty-eight hours after transfection, paraformaldehyde (4%) was used to fix HTR-8/SVneo cells and Triton X-100 (0.3%) was used to permeabilize HTR-8/SVneo cells. Then, HTR-8/SVneo cells were incubated with TUNEL reagent for 1 h, and then TUNEL-positive cells were observed utilising fluorescence microscopy.

Statistical analysis Data were expressed as mean ± SD. Statistical analysis was conducted using GraphPad Prism 6.0. Comparisons between two experimental groups were performed using the student’s t-test. The correlation between LncRNA NEAT1 expression level and miR-18a-5p/ESRa expression level was performed using Pearson correlation analysis. When p < 0.05, the results were deemed statistically significant.

3

Results Expression levels of LncRNA NEAT1, miR-18a-5p, p53, and ESRa in placenta tissues of PE patients The expression levels of LncRNA NEAT1, miR-18a-5p, p53, and ESRa were detected in the placenta tissues of PE patients (n ¼ 20) and HC (n ¼ 20). The results of qRTPCR showed that compared with the placentas of HC, LncRNA NEAT1 and p53 expressions were elevated (Figure 1(A)) whereas miR-18a-5p expression was reduced in the placentas of PE (Figure 1(B)). The correlation analysis revealed there was a negative correlation between LncRNA NEAT1 expression level and miR-18a5p expression level in the placentas of PE (Figure 1(C)). The mRNA and protein levels of ESRa, measured by qRT-PCR and Western blot, depicted that ESRa expression was increased in the placentas of PE compared with that in the placentas of HC (Figure 1(D,E)). The correlation analysis revealed that LncRNA NEAT1 expression was positively related to the ESRa mRNA level in the placentas of PE (Figure 1(F)).

LncRNA NEAT1 was up-regulated in H2O2-treated HTR-8/SVneo cells and positively regulated ESRa expression Since oxidative stress plays an essential role in trophoblasts apoptosis during PE [3], to mimic the oxidative stress condition in vitro, human trophoblast cell line HTR-8/SVneo was treated with 175 mM H2O2. In response to H2O2 induction, the LncRNA NEAT1 level (measured by qRT-PCR), mRNA and protein levels of ESRa (measured by qRT-PCR and Western blot, respectively), and protein level of p53 (measured by Western blot) were increased whereas miR-18a-5p level (measured by qRT-PCR) was decreased in HTR-8/SVneo cells (Figure 2(A,B)). Subsequently, LncRNA NEAT1 was overexpressed or knockdown in HTR-8/SVneo cells utilising transfections of oe-NEAT1 or sh-NEAT1, respectively. As shown in Figure 2(C,D), the mRNA and protein levels of ESRa (measured by qRT-PCR and Western blot, respectively) were up-regulated by oe-NEAT1 and down-regulated by sh-NEAT1, indicating that LncRNA NEAT1 positively regulated ESRa expression. Then, miR-18a-5p was overexpressed or knockdown in HTR-8/SVneo cells utilising transfections of miR-18a-5p mimic or miR-18a5p inhibitor. As depicted in Figure 2(E), the results of qRT-PCR showed that miR-18a-5p negatively regulated the mRNA level of ESRa while having no effect on LncRNA NEAT1 expression.

4

F. XUFEI ET AL.

Figure 1. Expression levels of LncRNA NEAT1, p53, miR-18a-5p, and oestrogen receptor a in placenta tissues of preeclampsia patients. The placenta tissues of preeclampsia (PE) patients (n ¼ 20) were collected. The placenta tissues of healthy pregnancies were used as healthy controls (HC, n ¼ 20). The expression levels of (A) LncRNA NEAT1, p53, and (B) miR-18a-5p were measured using qRT-PCR. (C) The correlation plot of LncRNA NEAT1 level and miR-18a-5p level in the placenta tissues of PE patients (n ¼ 20). (D) The mRNA level of oestrogen receptor a (ESRa) was measured using qRT-PCR. (E) The protein level of ESRa was measured using Western blot. b-actin was used as an internal control. (F) The correlation plot of LncRNA NEAT1 level and ESRa mRNA level in the placenta tissues of PE patients (n ¼ 20). p < 0.001 vs HC.

p53 is a transcriptional promoter of LncRNA NEAT1 As reported, p53 induced the transcription of LncRNA NEAT1 in pancreatic cancer cells [12]. To explore whether p53 also functions as a modulator of LncRNA NEAT1 transcription in HTR-8/SVneo cells, a Dual-luciferase reporter gene assay was conducted. As shown in Figure 3(A), the overexpression of p53 significantly elevated the activity of LncRNA NEAT1 promoter. The results of the CHIP-qPCR assay depicted that compared with IgG, abundant DNA fragment containing the LncRNA NEAT1 promoter region was detected in the DNA immunoprecipitate pulled down by anti-p53-antibody in HTR-8/SVneo cells (Figure 3(B)). These data confirmed that p53 is a transcriptional promoter of LncRNA NEAT1.

LncRNA NEAT1 released ESRa expression through sponging miR-18a-5p Subsequently, we investigated the modulatory effect of LncRNA NEAT1 on miR-18a-5p and ESRa. The results of

the Dual-luciferase reporter gene assay showed that miR18a-5p overexpression prominently reduced the relative luciferase activity of NEAT1-WT while not affecting the relative luciferase activity of NEAT1-Mut (Figure 3(C)). Compared with miR-18a-5p-Mut, miR-18a-5p-WT was able to pull down more LncRNA NEAT1 in HTR-8/SVneo cells (Figure 3(D)). Similarly, abundant LncRNA NEAT1 and miR-18a-5p were detected by qRT-PCR in the complex pulled down by anti-AGO2 antibody (Figure 3(E)). The above data indicated that there was an interaction between LncRNA NEAT1 and miR-18a-5p. As shown in Figure 3(F), the relative luciferase activity of ESRa-WT30 UTR was decreased by miR-18a-5p overexpression. However, in the HTR-8/SVneo cells co-transfected with miR-18a-5p mimic and oe-NEAT1, LncRNA NEAT1 overexpression partly reversed the inhibitory effect of miR-18a5p overexpression on the relative luciferase activity of ESRa-WT-30 UTR (Figure 3(G)). The mRNA level of ESRa measured by qRT-PCR showed that the overexpression of LncRNA NEAT1 elevated ESRa mRNA level, whereas the promotion effect of LncRNA NEAT1 on ESRa expression was abrogated by miR-18a-5p mimic (Figure 3(H)).

FREE RADICAL RESEARCH

5

Figure 2. LncRNA NEAT1 was up-regulated in H2O2-treated HTR-8/SVneo cells and positively regulated ESRa expression. HTR-8/ SVneo cells were cultured with or without 175 mM H2O2 for 24h, (A) the expression levels of LncRNA NEAT1, ESRa, and miR-18a5p were measured by qRT-PCR; (B) the protein levels of p53 and ESRa were measured by Western blot. p < 0.05, p < 0.01, p < 0.001 vs HTR-8/SVneo cells cultured without H2O2 (Blank). HTR-8/SVneo cells were transfected with lentivirus-overexpress-NEAT1 (oe- NEAT1), sh-NEAT1, or the corresponding negative controls (oe-NC and sh-NC), (C) the LncRNA NEAT1 level, ESRa mRNA level, and (D) ESRa protein level were measured. p < 0.001 vs oe-NC; ###p < 0.001 vs sh-NC. (E) HTR-8/SVneo cells were transfected with miR-18a-5p mimic (mimic), miR-18a-5p inhibitor (inhibitor), or the corresponding negative controls [mimic (mi)-NC and inhibitor (in)-NC]. The expression levels of miR-18a-5p, LncRNA NEAT1, and ESRa were measured by qRT-PCR. p < 0.01 vs mi-NC; ##p < 0.01, ###p < 0.001 vs in-NC.

miR-18a-5p expression mediated the effect of LncRNA NEAT1 on H2O2-induced cell apoptosis As shown in Figure 4(A), H2O2 treatment prominently elevated the protein level of cleaved-caspase 3 (measured by Western blot) in HTR-8/SVneo cells. Meanwhile, the number of TUNEL-positive cells was boosted in H2O2-treated HTR-8/SVneo cells (Figure 4(B)). These data indicated that H2O2 treatment induced cell apoptosis. Then, miR-18a-5p mimic or miR-18a-5p mimic þ oe-NEAT1 was transfected into HTR-8/SVneo cells to overexpressed miR-18a-5p or co-overexpressed LncRNA NEAT1þ miR-18a-5p. The overexpression of miR-18a-5p reduced H2O2-induced cell apoptosis, manifesting as reduced cleaved-caspase 3 protein level, and

decreased TUNNEL-positive cell numbers (Figure 4(A,B)). However, the inhibitory effect of miR-18a-5p on cell apoptosis was reversed by LncRNA NEAT1 overexpression (Figure 4(A,B)), indicating that LncRNA NEAT1 exerted its promotion effect on H2O2-induced cell apoptosis through suppressing miR-18a-5p expression.

Discussion The trophoblast apoptosis caused by placental oxidative stress is a vital event during the PE progression [5], whereas the molecular mechanism remains unclear. In this study, we found that p53 expression was boosted by oxidative stress, the high expression of p53

6

F. XUFEI ET AL.

Figure 3. The upstream and downstream regulatory mechanism of LncRNA NEAT1. (A) The relative luciferase activity of pGL3NEAT1 promoter was measured in HTR-8/SVneo cells transfected with pCMV-p53 or its negative control [pCMV-control (CTL)]. p < 0.001 vs pCMV-CTL. (B) Chromatin immunoprecipitation assay followed by PCR amplification. IgG was used as a negative control and H3 was used as a positive control. p < 0.001 vs IgG. (C) The relative luciferase activities of pmirGLO-NEAT1-wild type (WT) and pmirGLO-NEAT1-mutant type (Mut) were measured in HTR-8/SVneo cells transfected with mi-NC or miR-18a-5p mimic. p < 0.05. (D) Detection of LncRNA NEAT1 expression level using qRT-PCR in the samples pulled down by miR-18a-5p-WT or miR-18a-5p-Mut. The blank vector was served as a negative control (NC). p < 0.01 vs NC; ##p < 0.01 vs miR-18a-5p-WT. (E) RNA-binding protein immunoprecipitation (RIP) was performed on HTR-8/SVneo cells using anti-AGO2 or anti-IgG (negative control) antibody, followed by qRT-PCR analysis to detect the expression levels of miR-18a-5p and LncRNA NEAT1. p < 0.05. (F) The relative luciferase activities of pmirGLO-ESRa-WT-30 UTR and pmirGLO-ESRa-Mut-30 UTR were measured in HTR-8/SVneo cells transfected with mi-NC or miR-18a-5p mimic. p < 0.05. (G) The relative luciferase activity of pmirGLO-ESRa-WT-30 UTR was measured in HTR-8/SVneo cells transfected with mi-NC, miR-18a-5p mimic, miR-18a-5p mimic þ oe-NEAT1, or miR-18a-5p mimic þ the oeNC. p < 0.05. (H) ESRa mRNA level was measured by qRT-PCR in HTR-8/SVneo cells transfected with oe-NC or oe-NEAT1 or oeNEAT1þ mi-NC or oe-NEAT1þ miR-18a-5p mimic. p < 0.01 vs oe-NC; ###p < 0.001 vs oe-NEAT1þ mi-NC.

FREE RADICAL RESEARCH

7

Figure 4. miR-18a-5p expression mediated the effect of LncRNA NEAT1 on H2O2-induced cell apoptosis. HTR-8/SVneo cells were divided into six groups: Blank, H2O2, H2O2þmi-NC, H2O2þ miR-18a-5p mimic, H2O2þ miR-18a-5p mimic þ oe-NEAT1, H2O2þ miR18a-5p mimic þ oe-NC. (A) The protein levels of cleaved-caspase 3 and caspase 3 were measured by Western blot. b-actin was used as a negative control. (B) The representative images of the TUNEL assay performed on each group. The nuclei were stained with DAPI (right).

subsequently induced the transcription of LncRNA NEAT1, which released ESRa through sponging miR18a-5p, thus promoting the apoptosis of trophoblasts. The results of our study supported the research of Zhu et al. [9], which found that miR-18a-5p knockdown elevated trophoblasts apoptosis via boosting ESRa

expression. What’s more, we also demonstrated the upstream regulatory mechanism of the miR-18a-5p/ ESRa axis during trophoblasts apoptosis. The expression level of LncRNA NEAT1 in the placenta tissues of PE patients and HC was confirmed. The elevated LncRNA NEAT1 expression in the placenta

8

F. XUFEI ET AL.

tissues of PE patients suggested the potential pathogenic feature of LncRNA NEAT1 during the development of PE. In line with our study, Gremlich et al. [19] also found that LncRNA NEAT1 was up-regulated in the placentas of patients with intrauterine growth restriction, indicating that LncRNA NEAT1 was closely related to the placental dysfunction. Therefore, we then explored the role and regulatory mechanism of LncRNA NEAT1 in trophoblasts apoptosis in vitro. HTR-8/SVneo cell line is an immortalised trophoblast cell line, which has been widely used in studies investigating PE [20,21]. Through using H2O2 to stimulate HTR-8/SVneo cells, we mimic a placental oxidative stress ambiance in vitro. Under oxidative stress, the expression levels of LncRNA NEAT1 and p53 were significantly elevated. A previous study showed that the p53 expression was up-regulated by oxidative stress and associated with the high expression of LncRNA NEAT1 in H2O2-treated human umbilical cord endothelial cells [22]. Consistent with this, the Dual-luciferase reporter gene assay and CHIP-qPCR assay proved that the transcription of LncRNA NEAT1 was facilitated by p53 in HTR-8/SVneo cells. Subsequently, the Dual-luciferase reporter gene assay, RNA pull-down assay, and RIP confirmed that LncRNA NEAT1 could up-regulate the ESRa expression by adsorbing miR-18a-5p. This mechanism is well explained why the LncRNA NEAT1 expression level was positively correlated with ESRa expression level in H2O2-treated HTR-8/SVneo cells. The dysregulation of miR-18a-5p has been proven to be closely related to the development of pregnancy diseases. For instance, during foetal growth restriction, the miR-18a-5p expression was upregulated and reduced trophoblast invasion by targeting interferon regulatory factor 2 [23]. In addition, in the placenta and plasma from severe PE patients, the miR-18a-5p expression was down-regulated [10], and the overexpression of miR-18a-5p decreased the apoptosis of the human trophoblast cells through reducing ESRa expression [9]. In our study, we also found that ESRa is the target gene of miR-18a-5p in human trophoblast cells and miR-18a-5p overexpression reduced the apoptosis of human trophoblast cells. Besides, our data also found that through releasing ESRa, a transcription factor contributed to the apoptosis of trophoblasts [9], LncRNA NEAT1 abrogated the inhibitory effect of miR-18a-5p on H2O2-induced apoptosis of HTR-8/SVneo cells. Previous research on LncRNA NEAT1 has focussed on its role in cancers. Zhang et al. [24] reported that LncRNA NEAT1 promoted the metastasis of colorectal cancer. Li et al. [25] found that LncRNA NEAT1

facilitated the invasion of hepatocellular carcinoma cells. Herein in this study, we provided evidence for the involvement of LncRNA NEAT1 in the pathogenic development of PE for the first time and clarified a new regulatory pathway for trophoblasts apoptosis during PE.

Ethics approval and consent to participate Our study was approved by the Ethics Committee of the Jinhua Hospital of Zhejiang University. All pregnancies enrolled in this study signed informed consent forms.

Disclosure statement No potential the author(s).

conflict

of

interest

was

reported

by

Funding This work was supported by Zhejiang Provincial Natural Science Foundation of China (NO. LQ19H040002) and Jinhua municipal science and technology bureau project (20203-042).

References [1]

[2]

[3]

[4]

[5]

[6]

[7]

[8]

Levine RJ, Hauth JC, Curet LB, et al. Trial of calcium to prevent preeclampsia. N Engl J Med. 1997;337(2): 69–76. Pettit F, Mangos G, Davis G, et al. Pre-eclampsia causes adverse maternal outcomes across the gestational spectrum. Pregnancy Hypertens. 2015;5(2): 198–204. Jauniaux E, Poston L, Burton GJ. Placental-related diseases of pregnancy: involvement of oxidative stress and implications in human evolution. Hum Reprod Update. 2006;12(6):747–755. DiFederico E, Genbacev O, Fisher SJ. Preeclampsia is associated with widespread apoptosis of placental cytotrophoblasts within the uterine wall. Am J Pathol. 1999;155(1):293–301. Longtine MS, Chen B, Odibo AO, et al. Villous trophoblast apoptosis is elevated and restricted to cytotrophoblasts in pregnancies complicated by preeclampsia, IUGR, or preeclampsia with IUGR. Placenta. 2012;33(5):352–359. Kuiper GG, Carlsson B, Grandien K, et al. Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors alpha and beta. Endocrinology. 1997;138(3):863–870. Yin G, Zhu X, Guo CHUN, et al. Differential expression of estradiol and estrogen receptor a in severe preeclamptic pregnancies compared with normal pregnancies. Mol Med Rep. 2013;7(3):981–985. Patel S, Kilburn B, Imudia A, et al. Estradiol elicits proapoptotic and antiproliferative effects in human trophoblast cells. Biol Reprod. 2015;93(3):74.

FREE RADICAL RESEARCH

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

Zhu X, Yang Y, Han T, et al. Suppression of microRNA18a expression inhibits invasion and promotes apoptosis of human trophoblast cells by targeting the estrogen receptor a gene. Mol Med Rep. 2015;12(2): 2701–2706. Xu P, Zhao Y, Liu M, et al. Variations of microRNAs in human placentas and plasma from preeclamptic pregnancy. Hypertension. 2014;63(6):1276–1284. Nakagawa S, Hirose T. Paraspeckle nuclear bodies-useful uselessness? Cell Mol Life Sci. 2012;69(18): 3027–3036. Mello SS, Sinow C, Raj N, et al. Neat1 is a p53-inducible lincRNA essential for transformation suppression. Genes Dev. 2017;31(11):1095–1108. Muralimanoharan S, Maloyan A, Myatt L. Evidence of sexual dimorphism in the placental function with severe preeclampsia. Placenta. 2013;34(12):1183–1189. Levy R, Smith SD, Yusuf K, et al. Trophoblast apoptosis from pregnancies complicated by fetal growth restriction is associated with enhanced p53 expression. Am J Obstet Gynecol. 2002;186(5):1056–1061. Cesana M, Cacchiarelli D, Legnini I, et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 2011; 147(2):358–369. An J, Lv W, Zhang Y. LncRNA NEAT1 contributes to paclitaxel resistance of ovarian cancer cells by regulating ZEB1 expression via miR-194. Onco Targets Ther. 2017;10:5377–5390. Zhou X, Zhang G-y, Wang J, et al. A novel bridge between oxidative stress and immunity: the interaction between hydrogen peroxide and human leukocyte antigen G in placental trophoblasts during

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

9

preeclampsia. Am J Obstet Gynecol. 2012;206(5): 447.e7. Li P, Pan X, Zheng Z, et al. LINC00271 inhibits epithelial-mesenchymal transition of papillary thyroid cancer cells by downregulating trefoil factor 3 expression. Aging Pathobiol Therap. 2020;2(2):78–85. Gremlich S, Damnon F, Reymondin D, et al. The long non-coding RNA NEAT1 is increased in IUGR placentas, leading to potential new hypotheses of IUGR origin/development. Placenta. 2014;35(1):44–49. Lu J, Zhang Q, Tan D, et al. GABA A receptor p subunit promotes apoptosis of HTR-8/SVneo trophoblastic cells: implications in preeclampsia. Int J Mol Med. 2016;38(1):105–112. Lang X, Zhao W, Huang D, et al. The role of NUDT21 in microRNA-binging sites of EZH2 gene increases the of risk preeclampsia. J Cell Mol Med. 2019;23(5): 3202–3213. Fuschi P, Carrara M, Voellenkle C, et al. Central role of the p53 pathway in the noncoding-RNA response to oxidative stress. Aging. 2017;9(12):2559–2586. Zhang L, Deng X, Shi X, et al. Silencing H19 regulated proliferation, invasion, and autophagy in the placenta by targeting miR-18a-5p. J Cell Biochem. 2019;120(6): 9006–9015. Zhang M, Weng W, Zhang Q, et al. The lncRNA NEAT1 activates Wnt/b-catenin signaling and promotes colorectal cancer progression via interacting with DDX5. J Hematol Oncol. 2018;11(1):113. Li Y, Ding X, Xiu S, et al. LncRNA NEAT1 promotes proliferation, migration and invasion via regulating miR-296-5p/CNN2 Axis in hepatocellular carcinoma cells. Onco Targets Ther. 2019;12:9887–9897.