Journal of Environmental Science and Health, Part A Toxic/Hazardous Substances and Environmental Engineering
ISSN: (Print) (Online) Journal homepage: https://www.tandfonline.com/loi/lesa20
Phthalate esters and dexamethasone synergistically activate glucocorticoid receptor Yue Leng , Yonghai Sun , Wei Huang , Chengyu Lv , Jingyan Cui , Tiezhu Li & Yongjun Wang To cite this article: Yue Leng , Yonghai Sun , Wei Huang , Chengyu Lv , Jingyan Cui , Tiezhu Li & Yongjun Wang (2020): Phthalate esters and dexamethasone synergistically activate glucocorticoid receptor, Journal of Environmental Science and Health, Part A, DOI: 10.1080/10934529.2020.1826775 To link to this article: https://doi.org/10.1080/10934529.2020.1826775
Published online: 01 Oct 2020.
Submit your article to this journal
Article views: 2
View related articles
View Crossmark data
Full Terms & Conditions of access and use can be found at https://www.tandfonline.com/action/journalInformation?journalCode=lesa20
JOURNAL OF ENVIRONMENTAL SCIENCE AND HEALTH, PART A https://doi.org/10.1080/10934529.2020.1826775
Phthalate esters and dexamethasone synergistically activate glucocorticoid receptor Yue Lenga, Yonghai Suna, Wei Huangb, Chengyu Lvb, Jingyan Cuib, Tiezhu Lia,b, and Yongjun Wangb a
College of Food Science and Engineering, Jilin University, People’s Republic of China; bInstitute of Agro-Food Technology, Jilin Academy of Agricultural Sciences, Jilin, People’s Republic of China ABSTRACT
ARTICLE HISTORY
This study was conducted to determine the endocrine-disrupting effects of phthalate esters (PAEs) on the glucocorticoid receptor (GR) signaling. Potential (anti)glucocorticoid activities of six typical PAEs including di (2-ethylhexyl) phthalate (DEHP), diisononyl phthalate (DINP), dibutyl phthalate (DBP), diisobutyl phthalate (DIBP), diethyl phthalate (DEP) and dimethyl phthalate (DMP) were evaluated on human GR using cell viability assessment, reporter gene expression analysis, mRNA analysis, and molecular docking and simulation. For all tested chemicals, co-treatment of DEHP and DINP with dexamethasone (DEX) exhibited a synergistic effect on GR transactivity in the reporter assays. Such co-treatment also synergistically enhanced DEX-induced upregulation of GR mediated gene (PEPCK, FAS and MKP-1) mRNA expression in HepG2 cells and A549 cells. Molecular docking and dynamics simulations showed that hydrophobic interactions may stabilize the binding between molecules and GR. In summary, DEHP and DINP may be involved in synergistic effects via human GR, which highlight the potential endocrine-disrupting activities of PAEs as contaminants.
Received 5 July 2020 Accepted 16 September 2020
Introduction Phthalate esters (PAEs) are a group of plasticizers used to soften polyvinylchloride plastic materials. They are ramified to different industrial and consumer applications, including food processing, medical applications and building materials.[1–4] The applications of PAEs in plastic products have kept increasing since 1920s.[5] Phthalates bound physically, but not covalently, to the polymeric matrix, and are susceptible to migrating from the matrix into the environment during manufacture, storage and transportation.[6,7] Phthalates can therefore be detected in various media, including food, water, air and soil, leading to human exposure through contamination. Furthermore, di(2-ethylhexyl) phthalate (DEHP), diisononyl phthalate (DINP), dibutyl phthalate (DBP), diisobutyl phthalate (DIBP), diethyl phthalate (DEP) and dimethyl phthalate (DMP) are primarily used as PAEs.[8] Thus, it is important to consider the toxic effects of these PAEs. Exposure to phthalates raises scientific and public concern for fetal development. Furthermore, reproductive and cardiovascular systems are proven to be susceptible to some PAEs and their metabolites.[9] For example, exposure to certain phthalates is associated with testicular dysgenesis syndrome and with an apparent decline in male reproductive health.[10] Many studies also indicate that some PAEs and their metabolites can act as ligands to interact with the
KEYWORDS
Phthalate exposure; environmental contamination; glucocorticoid receptor; endocrine disruption
endocrine molecular signaling system. Those phthalates disrupt hormonal balance as endocrine disrupting compounds (EDCs). For example, DEHP reportedly affects the activities of the progesterone receptor.[11] However, much less attention has been paid to the exposure to the glucocorticoid receptor (GR) and its action modulations in target tissues. Glucocorticoids (GCs), owing to their immunomodulatory and anti-inflammatory activities, are steroid hormones successfully used in therapeutic administration.[12,13] GCs regulated by the hypothalamic-pituitary-adrenal axis play key roles in the regulation of homeostasis, central nervous system function, glucose and lipid metabolism and immune response.[14–16] For this reason, GCs become the mainstay in the treatment of various typical disorders, such as rheumatoid arthritis, asthma, systemic lupus erythematosus and other inflammatory diseases.[17,18] In target cells, GCs exert their major actions via activating GR. On binding glucocorticoid, the receptor undergoes several conformational changes, which result in nuclear translocation.[19] The GR complex (GRC) interacts with specific target DNA sequences as a homodimer and regulates transcriptional activation or repression.[20,21] Recently, a few studies suggest that several of the PAEs have the potential to disturb GR and regulate downstream genes. DEHP reportedly possesses glucocorticoid-like activity.[22] In addition, dicyclohexyl phthalate and mono-cyclohexyl phthalate can also stimulate GR
CONTACT Tiezhu Li [email protected] College of Food Science and Engineering, Jilin University, Changchun 130062, China; Institute of Agro-Food [email protected] Technology, Jilin Academy of Agricultural Sciences, Changchun 130033, Jilin, People’s Republic of China; Yongjun Wang Institute of Agro-Food Technology, Jilin Academy of Agricultural Sciences, Changchun 130033 Jilin, People’s Republic of China. ß 2020 Taylor & Francis Group, LLC
2
Y. LENG ET AL.
Figure 1. Structures of DEHP (A), DINP (B), DBP (C), DIBP (D), DEP (E), and DMP (F).
activity.[23,24] However, the detailed mechanisms how PAEs bind to GR have not been clarified. In this work, the glucocorticoid effects of six typical PAEs (Figure. 1) were evaluated by reporter gene assays and mRNA analysis. Furthermore, the binding poses of PAEs with GR were predicted by molecular docking. Then their binding stability was assessed by molecular dynamics (MD) simulations. The aim of this study was to explore the possible hormonal activity of PAEs via human GR.
Materials and methods Cell culture and materials The human cervical cancer (HeLa) cell line, human hepatoma (HepG2) cell line and non-small cell lung cancer (A549) cell line were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were routinely grown in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) with 5% CO2 at 37 C. The six typical PAEs (DEHP, DINP, DBP, DIBP, DEP and DMP) (>98% pure) were purchased from Aladdin Biotech Co., Ltd. (Shanghai, China). Dexamethasone (DEX) and dimethyl sulfoxide (DMSO) were obtained from SigmaAldrich (St. Louis, MO, USA). All compounds were dissolved in DMSO. Lipofectamine 2000 transfection reagent was purchased from Thermo Fisher Scientific (San Jose, CA, USA). Cells treated with the equivalent addition of DMSO served as the control.
Construction of the plasmids The human GR expression plasmid pcDNA3.1(þ)-hGR, as well as the reporter plasmid pGL6-TA-GRE-Luc were prepared as previously described.[25] Plasmid pRL-SV40 (Promega, WI, USA) was used as the internal control plasmid in reporter gene assays.
Table 1. Sequences of amplication primers. Gene MKP-1F MKP-1R FASF FASR PEPCKF PEPCKR GADPHF GADPHR HPRTF HPRTR
Primer CCACAAGGCAGACATCAGCTC TCTATGAAGTCAATGGCCTCGTT TATGCTTCTTCGTGCAGCAGTT GCTGCCACACGCTCCTCTAG CAAGACGGTTATCGTCAGCA GAACCTGGCATTGAACGCTT GAAGACGGGCGGAGAGAAAC GCCCAATACGACCAAATCCG GAAGAGCTATTGTAATGACC GCGACCTTGACCATCTTTG
Cell viability Cell viability was examined using the MTT array.[26] HeLa cells seeded in 96-well plates at 1 105 cells/mL (100 lL/ well) were cultured for 18 h in DMEM containing 10% FBS and treated with the six PAEs at different concentrations (10, 50, 100, 500 lM and 1 mM) at 37 C for 4 h. The 100 lL MTT solution diluted with medium was added to the cells for incubation of additional 4 h. The supernatant was removed, and then 150 lL of DMSO was added to dissolve formazan. The absorbance reading at 490 nm was recorded using a microplate reader. Luciferase reporter assay HeLa cells were seeded in 24-well plates at a density of 105 cells per well for 18 h prior to be transiently transfected with pcDNA3.1(þ)-hGR, pGL6-TA-GRE-Luc and pRL-SV40 using Lipofectamine 2000. For each tested chemical, three concentrations (1, 100 nM and 10 lM) were evaluated in HeLa cells. The luciferase activity was measured on a SpectraMax i3x microplate reader (Molecular Devices, Sunnyvale, CA, USA) using a Dual-Glo Luciferase Assay System (Promega, Madison, WI, USA).[27] Real-time quantitative PCR HepG2 cells and A549 cells were seeded in 6-well plates at a density of 2.5 105 cells per well, cultured for 16 h, and
JOURNAL OF ENVIRONMENTAL SCIENCE AND HEALTH, PART A
3
Figure 2. Cytotoxicity of DEHP (A), DINP (B), DBP (C), DIBP (D), DEP (E), and DMP (F) in HeLa cells. Results are given as means ± SD of three independent experiments and normalized to DMSO control group. , , , statistically significant differences (P < 0.05, P < 0.01 and P < 0.001).
treated with the test chemicals respectively for 24 h. Total RNA was extracted with the Trizol reagent (Transgen, Beijing, China), following the manufacturers’ protocol. Reverse transcription reactions were performed with total RNAs (500 ng per sample) using reverse transcriptional kit. Real-time quantitative PCR analysis was conducted using
quantitative PCR kit. The cycling parameters were 94 C for 10 min; 40 circles of 94 C for 5 s, 60 C for 30 s; 94 C for 10 s, 65 C for 60 s, 97 C for 10 s; cooling to 37 C for 30 s. Primers used in this study were shown in Table 1. HPRT and GADPH were served as the normalization genes and the relative expression was calculated by the DDCt method.
4
Y. LENG ET AL.
Molecular docking The three-dimensional structure of the GR ligand binding domain (GR-LBD) was downloaded from Protein Data Bank (ID 4UDC) firstly.[28] The receptor preparation was performed by removing the agonist DEX and then adding the hydrogen atoms. The structures of DEHP and DINP were generated using GaussView and then the energy minimization was performed using Gaussian 09W. Subsequently, both DEHP and DINP were docked into the ligand binding cavity of GR-LBD by AutoDockTools. Ten independent docking procedures for each PAE were performed in this work. The predicted poses of PAEs with lowest binding energies were selected for the sequential studies. Molecular dynamics simulations In addition, the binding stabilities of PAEs with GR-LBD was assessed by molecular dynamics simulations. The CHARMM36 all-atom force field was employed in GROMACS 2019.[29] The topologies of both DEHP and DINP were generated using the CGenFF server. The PAEGR-LBD complex was located in a cubic box with simple point charge water models. Then sodium ions were added to achieve electrostatic neutrality. After the energy minimization, the system was equilibrated at constant pressure and temperature with position restraints on both PAE and GR-LBD. The root mean squared deviation (RMSD) values of PAE and GR-LBD, compared with the docking structure and the crystal structure respectively, were calculated during 20 ns molecular dynamics simulation.
Results and discussion Viability and cytotoxicity
Figure 3. Effects of the tested PAEs on the activation of GR in HeLa cells. (A) DEHP and DINP, (B) DBP and DIBP, (C) DEP and DMP. The treated cells were incubated with the tested PAEs in the presence of 1.39 nM (EC50) DEX. The induction by 1.39 nM DEX was set at 100%. Results are given as means ± SD of three independent experiments and normalized to DEX control group. , , , statistically significant differences (P < 0.05, P < 0.01 and P < 0.001), compared with positive control (¼100%).
To assess the cytotoxicity of the selected PAEs, we used MTT assay to explore how PAEs at different concentrations (10, 50, 100, 500 lM and 1 mM) interacted with HeLa cells. No cytotoxic effects were observed in HeLa cells exposed to the selected PAEs (10–50 lM). However, the highest tested concentration (1 mM) of PAEs caused significant cytotoxic effects in the MTT assays of HeLa cells except for DEHP (P < 0.05) (Figure 2). The MTT results for high concentrations of DBP, DEP and DIBP showed dose-dependent effects to a greater content compared to DINP and DMP. Cell viability of HeLa cells was significantly reduced by DBP, DEP, DIBP, DINP and DMP at high concentration (1 mM) compared to the control. DBP, DEP and DIBP dose-dependently induced higher cytotoxic effects on HeLa cells compared with DINP and DMP. Preliminary results showed that 10 lM represented a non-toxic concentration for all six PAEs. GR transcriptional response induced by single PAEs The ability of single PAEs to activate GR was determined on the HeLa cell lines (Figure. 3). The treated cells were
JOURNAL OF ENVIRONMENTAL SCIENCE AND HEALTH, PART A
5
Figure 4. The synergistic effects of DEHP and DINP on DEX-induced expression of glucocorticoid-responsive genes. HepG2 (or A549) cells were incubated with 10, 100 nM and 1 lM DEHP (or DINP) in the presence of 1 lM DEX. (A) The relative mRNA levels of PEPCK, FAS and MKP-1 with the treatment of 10, 100 nM and 1 lM DEHP in the presence of 1 lM DEX. (B) The relative mRNA levels of PEPCK, FAS and MKP-1 with the treatment of 10, 100 nM and 1 lM DINP in the presence of 1 lM DEX. Results are given as means ± SD of three independent experiments and normalized to DEX control group. , , , statistically significant differences (P < 0.05, P < 0.01 and P < 0.001, respectively).
incubated with the tested PAEs in the presence of 1.39 nM (EC50) DEX. The induction by 1.39 nM DEX was set at 100%. None of the chemicals elicited GR agonistic response in this cell line. Effects of single PAEs on DEX-mediated GR transcriptional response The co-incubation of single PAEs with DEX failed to exhibit any antagonistic effect in the HeLa cell line. However, cotreatment of DEHP and DINP with DEX, exhibited a synergistic effect on GR transactivity. Co-exposure of DEX with DEHP and DINP significantly increased the DEX-mediated GR response to 131.06 ± 2.02% and 142.11 ± 6.72%, respectively (P < 0.01). A dose-dependent increase in GR activities was observed in both chemicals, but with different tendencies. After co-treatment with DEX, DEHP enhanced DEXmediated GR response at the highest concentration (10 lM) while DINP showed the synergistic effect at both 100 nM and 10 lM. HeLa cells contained sufficient endogenous GR. As expected, DEX effectively induced reporter gene transactivation compared to the control (P < 0.001). None of the six
PAEs exhibited an agonistic effect in the HeLa cell line. However, we observed, for the first time, that only DEHP and DINP (co-treated with DEX) can synergistically activate GR at high concentrations (DINP > DEHP). DEHP and DINP may act as novel ligands to induce GR conformation at the molecular level at high concentrations. Similar effects were also shown by other EDCs, such as pesticides. Single pesticides failed to be identified as GR agonists but 12 of the 34 candidate pesticides showed GR agonistic activity cotreated with DEX.[30] Modulation of glucocorticoid-responsive gene expression of DEHP and DINP To verify the transcriptional synergy potency of 2 candidate PAEs (DEHP and DINP) via GR, we performed the mRNA analysis of 3 endogenous GC-sensitive genes, including PEPCK, FAS and MKP-1, in HepG2 cells and A549 cells. Exposure to the GR agonist DEX (1 lM) for 24 h induced the upregulation of mRNA level of PEPCK, FAS and MKP-1 (Figure 4). In Figure 4A and 4B, consistent with the reporter assays, 100 nM DEHP and DINP co-treated with DEX enhanced DEX-induced increase of PEPCK mRNA by
6
Y. LENG ET AL.
48.54% and 19.39%, respectively. FAS mRNA levels were increased in a synergistic manner in the presence of DEX by all three doses of DEHP and DINP. Moreover, 10 nM DINP increased MKP-1 mRNA levels, indicating a synergistic effect (Figure 4B).
The expression of 3 GR-regulated genes, including PEPCK, FAS and MKP-1 was evaluated, some of which (PEPCK, FAS) were reportedly involved in glucose and fat metabolism.[31,32] MKP-1 was more likely to play a role in anti-inflammatory activities of GCs.[31] The genes mentioned above were greatly transactivated by DEX in both HepG2 cells and A549 cells.[33,34] The results implied that treatment of DEHP and DINP combined with DEX exhibited synergistic effects on DEX-induced GRE activity strongly at the transcriptional level. These results were in agreement with the reporter gene results and further confirmed the synergy potency of DEHP and DINP to enhance the DEX-induced transactivation. Binding poses of PAEs with GR The results of molecular docking showed that both DEHP (Figure 5A) and DINP (Figure 5B) can fit into the ligand binding cavity of GR-LBD. Clearly, these two PAEs bind to the active site of GR-LBD in a similar manner to the crystal pose of DEX. Regarding the synergistic agonist observed from combinations of PAE (DEHP or DINP) and DEX (Figure 3A), computational alignment of their respective binding conformations (Figure 5A and 5B) supports the possibility that both PAE (DEHP or DINP) and DEX can bind to GR-LBD simultaneously. Furthermore, the amino acid residues of GR-LBD that lie within 4 Å away from DEHP and DINP are shown in Figure 5C and 5D, respectively. Totally, 14 residues in the hydrophobic cavity are revealed to involve in formation of the hydrophobic interactions with DINP (Table 2). Interestingly, these 14 residues also hydrophobically interacted with DEHP. In addition to the aforementioned residues, Ile559 and Met639 also make hydrophobic interactions with DEHP. As illustrated in Figure 5C and Table 2, DEHP forms a hydrogen bond with Met560, which contributes to the stability of DEHP-GR-LBD binding. Met560 forms a hydrogen bond with DINP, while Asn564 forms two hydrogen bonds with DINP (Figure 5D; Table 2). In summary, both hydrophobic interactions and hydrogen bonding interactions are the dominant forces to stabilize PAE-GR-LBD binding.
Figure 5. The computational alignment of the predicted poses of PAEs and the crystal pose of DEX (A, B) as well as the structural details of GR-PAEs binding (C, D). (A) DEHP, cyan; DEX, yellow. (B) DINP, magenta; DEX, yellow. (C) DEHP, cyan. (D) DINP, magenta.
Binding stabilities of PAEs with GR The dynamic binding process of PAEs with GR was assessed by MD simulations and their RMSD values have been
Table 2. The results of molecular docking and molecular dynamics simulations between PAEs and GR. Compound DEHP
Hydrogen bonds Met560
DINP
Met560, Asn564
Hydrophobic contacts Ile559, Met560, Leu563, Leu566, Trp600, Met601, Met604, Ala605, Leu608, Phe623, Met639, Met646, Leu732, Ile747, Phe749, Leu753 Met560, Leu563, Leu566, Trp600, Met601, Met604, Ala605, Leu608, Phe623, Met646, Leu732, Ile747, Phe749, Leu753
RMSD (nm) for GR 0.11 ± 0.01
RMSD (nm) for PAE 0.38 ± 0.05
0.14 ± 0.01
0.37 ± 0.07
JOURNAL OF ENVIRONMENTAL SCIENCE AND HEALTH, PART A
7
Figure 6. The variations of RMSD values for DEHP (left) and DINP (right).
shown in Figure 6. As illustrated in Table 2, the average RMSD values of the backbone of protein for DEHP-GRLBD and DINP-GR-LBD were 0.11 and 0.14 nm, respectively, indicating that PAEs produce only a slight structural disturbance of GR-LBD. By contrast, PAEs undergo a significant structural disturbance compared with their initial docking structures during MD simulation. As shown in Figure 6, both DEHP and DINP basically achieve stability in the GR binding pocket after 10 ns. The average RMSD values of DEHP and DINP are 0.38 and 0.37 nm, respectively (Table 2).
[2]
[3]
[4]
[5]
Conclusions This study was conducted to evaluate whether the six tested PAEs presented biphasic effects to modulate the endocrine system on human GR. DEHP and DINP exhibited a synergistic effect on DEX-induced transactivation of GR and the expression of GR-mediated genes (PEPCK, FAS and MKP1), as determined in reporter gene and mRNA analysis. Moreover, the results of docking and molecular dynamics simulations confirm that hydrophobic interactions may stabilize the binding between molecules and GR molecular. In conclusion, DEHP and DINP may be synergic with DEX via GR signal transduction pathway in vitro. The possibility of PAEs to exert deleterious effects should be further evaluated.
[6]
[7]
[8]
Disclosure statement The authors declare that they have no actual or competing of interests. [9]
Funding This work was supported by the National Natural Science Foundation of China (U19A2035), the Science and Technology Development Project Foundation of Jilin Province (20180201062SF), and the Agricultural Science and Technology Innovation Program of Jilin Province (CXGC2017JQ006 and CXGC2017JQ010).
References [1]
Roslev, P.; Vorkamp, K.; Aarup, J.; Frederiksen, K.; Nielsen, P. H. Degradation of Phthalate Esters in an Activated Sludge Wastewater Treatment Plant. Water Res. 2007, 41, 969–976. DOI: 10.1016/j.watres.2006.11.049.
[10]
[11]
Martino-Andrade, A. J.; Chahoud, I. Reproductive Toxicity of Phthalate Esters. Mol. Nutr. Food Res. 2010, 54, 148–157. DOI: 10.1002/mnfr.200800312. Sibali, L. L.; Okonkwo, J. O.; Mccrindle, R. I. Determination of Selected Phthalate Esters Compounds in Water and Sediments by Capillary Gas Chromatography and Flame Ionization Detector. J. Environ. Sci. Health, Part A: Toxic/Hazard. Subst. Environ. Eng. 2013, 48, 1365–1377. DOI: 10.1080/10934529. 2013.781884. Zhang, J.; Li, T.; Zhang, T.; Xue, P.; Guan, T.; Yuan, Y.; Yu, H. Receptor-Based Fluorescence Polarization Assay to Detect Phthalate Esters in Chinese Spirits. Food Anal. Methods 2017, 10, 1293–1300. DOI: 10.1007/s12161-016-0682-4. Net, S.; Delmont, A.; Sempere, R.; Paluselli, A.; Ouddane, B. Reliable Quantification of Phthalates in Environmental Matrices (Air, Water, Sludge, Sediment and Soil): A Review. Sci. Total Environ. 2015, 515–516, 162–180. DOI: 10.1016/j.scitotenv.2015. 02.013. Mortensen, G. K.; Main, K. M.; Andersson, A. M.; Leffers, H.; Skakkebaek, N. E. J. A.; Chemistry, B. Determination of Phthalate Monoesters in Human Milk, Consumer Milk, and Infant Formula by Tandem Mass Spectrometry (LC–MS–MS). Anal. Bioanal. Chem. 2005, 382, 1084–1092. DOI: 10.1007/ s00216-005-3218-0. Gardner, S. T.; Wood, A. T.; Lester, R.; Onkst, P. E.; Burnham, N.; Perygin, D. H.; Rayburn, J. Assessing Differences in Toxicity and Teratogenicity of Three Phthalates, Diethyl Phthalate, Di-n-Propyl Phthalate, and Di-n-Butyl Phthalate, Using Xenopus laevis Embryos. J. Toxicol. Environ. Health Part A 2016, 79, 71–82. DOI: 10.1080/15287394.2015.1106994. Johansson, H. K. L.; Jacobsen, P. R.; Hass, U.; Svingen, T.; Vinggaard, A. M.; Isling, L. K.; Axelstad, M.; Christiansen, S.; Boberg, J. Perinatal Exposure to Mixtures of Endocrine Disrupting Chemicals Reduces Female Rat Follicle Reserves and Accelerates Reproductive Aging. Reprod. Toxicol. 2016, 61, 186–194. DOI: 10.1016/j.reprotox.2016.03.045. Le Moal, J.; Sharpe, R. M.; Jorgensen, N.; Levine, H.; Jurewicz, J.; Mendiola, J.; Swan, S. H.; Virtanen, H.; Christin-Maitre, S.; Cordier, S.; HURGENT Network. Toward a Multi-Country Monitoring System of Reproductive Health in the Context of Endocrine Disrupting Chemical Exposure. Eur J. Public Health 2016, 26, 76–83. DOI: 10.1093/eurpub/ckv153. Kay, V. R.; Bloom, M. S.; Foster, W. G. Reproductive and Developmental Effects of Phthalate Diesters in Males. Crit. Rev. Toxicol. 2014, 44, 467–498. DOI: 10.3109/10408444.2013. 875983. Sheikh, I. A. Stereoselectivity and the Potential Endocrine Disrupting Activity of Di-(2-Ethylhexyl)Phthalate (DEHP) Against Human Progesterone Receptor: A Computational Perspective. J. Appl. Toxicol. 2016, 36, 741–747. DOI: 10.1002/ jat.3302.
8
Y. LENG ET AL.
[12]
Barnes, P. J. Anti-Inflammatory Actions of Glucocorticoids: molecular Mechanisms. Clin. Sci. 1998, 94, 557–572. DOI: 10. 1042/cs0940557. Zhang, T.; Zhong, S.; Li, T.; Zhang, J. Saponins as Modulators of Nuclear Receptors. Crit. Rev. Food Sci. Nutr. 2020, 60, 94–107. DOI: 10.1080/10408398.2018.1514580. Charmandari, E.; Tsigos, C.; Chrousos, G. Endocrinology of the Stress Response. Annu. Rev. Physiol. 2005, 67, 259–284. Zhang, T.; Liang, Y.; Zhang, J. Natural and Synthetic Compounds as Dissociated Agonists of Glucocorticoid Receptor. Pharmacol. Res. 2020, 156, 104802DOI: 10.1016/j. phrs.2020.104802. Guan, T.; Sun, Y.; Yu, H.; Li, T.; Zhang, J.; Zhang, T. A Fluorescence Polarization Assay for Bisphenol Analogs in Soybean Oil Using Glucocorticoid Receptor. Eur. J. Lipid Sci. Technol. 2017, 119, 1700042. DOI: 10.1002/ejlt.201700042. Hench, P. S.; Kendall, E. C.; Slocumb, C. H.; Polley, H. F. Effects of Cortisone Acetate and Pituitary ACTH on Rheumatoid Arthritis, Rheumatic Fever and Certain Other Conditions. Arch. Intern. Med. (Chic) 1950, 85, 545–666. DOI: 10.1001/archinte.1950.00230100002001. Kirwan, J. R.; Balint, G.; Szebenyi, B. Anniversary: 50 Years of Glucocorticoid Treatment in Rheumatoid Arthritis. Rheumatology (Oxford) 1999, 38, 100–102. DOI: 10.1093/ rheumatology/38.2.100. Almawi, W. Y.; Melemedjian, O. K. Molecular Mechanisms of Glucocorticoid Antiproliferative Effects: Antagonism of Transcription Factor Activity by Glucocorticoid Receptor. J. Leukoc. Biol. 2002, 71, 9–15. Vandevyver, S.; Dejager, L.; Libert, C. On the Trail of the Glucocorticoid Receptor: Into the Nucleus and Back. Traffic 2012, 13, 364–374. DOI: 10.1111/j.1600-0854.2011.01288.x. Lefstin, J. A.; Yamamoto, K. R. Allosteric Effects of DNA on Transcriptional Regulators. Nature 1998, 392, 885–888. DOI: 10.1038/31860. Klopcic, I.; Kolsek, K.; Dolenc, M. S. Glucocorticoid-like Activity of Propylparaben, Butylparaben, Diethylhexyl Phthalate and Tetramethrin Mixtures Studied in the MDA-kb2 Cell Line. Toxicol. Lett. 2015, 232, 376–383. DOI: 10.1016/j.toxlet.2014.11. 019. Singh, N.; Dalal, V.; Kumar, P. Molecular Docking and Simulation Analysis for Elucidation of Toxic Effects of Dicyclohexyl Phthalate (DCHP) in Glucocorticoid ReceptorMediated Adipogenesis. Mol. Simul. 2020, 46, 9–21. DOI: 10. 1080/08927022.2019.1662002. Sargis, R. M.; Johnson, D. N.; Choudhury, R. A.; Brady, M. J. Environmental Endocrine Disruptors Promote Adipogenesis in the 3T3-L1 Cell Line through Glucocorticoid Receptor
[13]
[14] [15]
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33]
[34]
Activation. Obesity (Silver Spring) 2010, 18, 1283–1288. DOI: 10.1038/oby.2009.419. Zhang, T.; Liang, Y.; Zuo, P.; Yan, M.; Jing, S.; Li, T.; Wang, Y.; Zhang, J.; Wei, Z. Identification of 20(R, S)-Protopanaxadiol and 20(R, S)-Protopanaxatriol for Potential Selective Modulation of Glucocorticoid Receptor. Food Chem. Toxicol. 2019, 131, 110642. DOI: 10.1016/j.fct.2019.110642. Mosmann, T. Rapid Colorimetric Assay for Cellular Growth and Survival: Application to Proliferation and Cytotoxicity Assays. J. Immunol. Methods. 1983, 65, 55–63. DOI: 10.1016/ 0022-1759(83)90303-4. Zhang, T.; Zhong, S.; Wang, Y.; Dong, S.; Guan, T.; Hou, L.; Xing, X.; Zhang, J.; Li, T. In Vitro and In Silico Perspectives on Estrogenicity of Tanshinones from Salvia miltiorrhiza. Food Chem. 2019, 270, 281–286. DOI: 10.1016/j.foodchem.2018.07. 098. Edman, K.; Hosseini, A.; Bjursell, M. K.; Aagaard, A.; Wissler, L.; Gunnarsson, A.; Kaminski, T.; K€ ohler, C.; B€ackstr€om, S.; Jensen, T. J.; et al. Ligand Binding Mechanism in Steroid Receptors: From Conserved Plasticity to Differential Evolutionary Constraints. Structure 2015, 23, 2280–2290. DOI: 10.1016/j.str.2015.09.012. Zhang, J.; Zhang, T.; Guan, T.; Yu, H.; Li, T. In Vitro and In Silico Assessment of the Structure-Dependent Binding of Bisphenol Analogues to Glucocorticoid Receptor. Anal. Bioanal. Chem. 2017, 409, 2239–2246. DOI: 10.1007/s00216-016-0168-7. Zhang, J.; Zhang, J.; Liu, R.; Gan, J.; Liu, J.; Liu, W. EndocrineDisrupting Effects of Pesticides through Interference with Human Glucocorticoid Receptor. Environ. Sci. Technol. 2016, 50, 435–443. DOI: 10.1021/acs.est.5b03731. Sch€acke, H.; Rehwinkel, H.; Asadullah, K.; Cato, A. C. B. Insight into the Molecular Mechanisms of Glucocorticoid Receptor Action Promotes Identification of Novel Ligands with an Improved Therapeutic Index. Exp. Dermatol. 2006, 15, 565–573. DOI: 10.1111/j.1600-0625.2006.00453.x. Van Raalte, D. H.; Ouwens, D. M.; Diamant, M. Novel Insights into Glucocorticoid-Mediated Diabetogenic Effects: Towards Expansion of Therapeutic Options? Eur. J. Clin. Invest. 2009, 39, 81–93. DOI: 10.1111/j.1365-2362.2008.02067.x. Haridas, V.; Xu, Z.-X.; Kitchen, D.; Jiang, A.; Michels, P.; Gutterman, J. The Anticancer Plant Triterpenoid, Avicin D, Regulates Glucocorticoid Receptor Signaling: Implications for Cellular Metabolism. PloS One. 2011, 6, e28037. DOI: 10.1371/ journal.pone.0028037. Xiang, G.; Fan, M.; Ma, Y.; Wang, M.; Gao, J.; Chen, J.; Li, X.; Xue, W.; Wang, Y.; Gao, H.; Shen.; et al. Anti-inflammatory Actions of Caesalpinin M2 in Experimental Colitis as a Selective Glucocoricoid Receptor Modulator . Biochem. Pharmacol. 2018, 150, 150–159. DOI: 10.1016/j.bcp.2018.02.003.
ISSN: (Print) (Online) Journal homepage: https://www.tandfonline.com/loi/lesa20
Phthalate esters and dexamethasone synergistically activate glucocorticoid receptor Yue Leng , Yonghai Sun , Wei Huang , Chengyu Lv , Jingyan Cui , Tiezhu Li & Yongjun Wang To cite this article: Yue Leng , Yonghai Sun , Wei Huang , Chengyu Lv , Jingyan Cui , Tiezhu Li & Yongjun Wang (2020): Phthalate esters and dexamethasone synergistically activate glucocorticoid receptor, Journal of Environmental Science and Health, Part A, DOI: 10.1080/10934529.2020.1826775 To link to this article: https://doi.org/10.1080/10934529.2020.1826775
Published online: 01 Oct 2020.
Submit your article to this journal
Article views: 2
View related articles
View Crossmark data
Full Terms & Conditions of access and use can be found at https://www.tandfonline.com/action/journalInformation?journalCode=lesa20
JOURNAL OF ENVIRONMENTAL SCIENCE AND HEALTH, PART A https://doi.org/10.1080/10934529.2020.1826775
Phthalate esters and dexamethasone synergistically activate glucocorticoid receptor Yue Lenga, Yonghai Suna, Wei Huangb, Chengyu Lvb, Jingyan Cuib, Tiezhu Lia,b, and Yongjun Wangb a
College of Food Science and Engineering, Jilin University, People’s Republic of China; bInstitute of Agro-Food Technology, Jilin Academy of Agricultural Sciences, Jilin, People’s Republic of China ABSTRACT
ARTICLE HISTORY
This study was conducted to determine the endocrine-disrupting effects of phthalate esters (PAEs) on the glucocorticoid receptor (GR) signaling. Potential (anti)glucocorticoid activities of six typical PAEs including di (2-ethylhexyl) phthalate (DEHP), diisononyl phthalate (DINP), dibutyl phthalate (DBP), diisobutyl phthalate (DIBP), diethyl phthalate (DEP) and dimethyl phthalate (DMP) were evaluated on human GR using cell viability assessment, reporter gene expression analysis, mRNA analysis, and molecular docking and simulation. For all tested chemicals, co-treatment of DEHP and DINP with dexamethasone (DEX) exhibited a synergistic effect on GR transactivity in the reporter assays. Such co-treatment also synergistically enhanced DEX-induced upregulation of GR mediated gene (PEPCK, FAS and MKP-1) mRNA expression in HepG2 cells and A549 cells. Molecular docking and dynamics simulations showed that hydrophobic interactions may stabilize the binding between molecules and GR. In summary, DEHP and DINP may be involved in synergistic effects via human GR, which highlight the potential endocrine-disrupting activities of PAEs as contaminants.
Received 5 July 2020 Accepted 16 September 2020
Introduction Phthalate esters (PAEs) are a group of plasticizers used to soften polyvinylchloride plastic materials. They are ramified to different industrial and consumer applications, including food processing, medical applications and building materials.[1–4] The applications of PAEs in plastic products have kept increasing since 1920s.[5] Phthalates bound physically, but not covalently, to the polymeric matrix, and are susceptible to migrating from the matrix into the environment during manufacture, storage and transportation.[6,7] Phthalates can therefore be detected in various media, including food, water, air and soil, leading to human exposure through contamination. Furthermore, di(2-ethylhexyl) phthalate (DEHP), diisononyl phthalate (DINP), dibutyl phthalate (DBP), diisobutyl phthalate (DIBP), diethyl phthalate (DEP) and dimethyl phthalate (DMP) are primarily used as PAEs.[8] Thus, it is important to consider the toxic effects of these PAEs. Exposure to phthalates raises scientific and public concern for fetal development. Furthermore, reproductive and cardiovascular systems are proven to be susceptible to some PAEs and their metabolites.[9] For example, exposure to certain phthalates is associated with testicular dysgenesis syndrome and with an apparent decline in male reproductive health.[10] Many studies also indicate that some PAEs and their metabolites can act as ligands to interact with the
KEYWORDS
Phthalate exposure; environmental contamination; glucocorticoid receptor; endocrine disruption
endocrine molecular signaling system. Those phthalates disrupt hormonal balance as endocrine disrupting compounds (EDCs). For example, DEHP reportedly affects the activities of the progesterone receptor.[11] However, much less attention has been paid to the exposure to the glucocorticoid receptor (GR) and its action modulations in target tissues. Glucocorticoids (GCs), owing to their immunomodulatory and anti-inflammatory activities, are steroid hormones successfully used in therapeutic administration.[12,13] GCs regulated by the hypothalamic-pituitary-adrenal axis play key roles in the regulation of homeostasis, central nervous system function, glucose and lipid metabolism and immune response.[14–16] For this reason, GCs become the mainstay in the treatment of various typical disorders, such as rheumatoid arthritis, asthma, systemic lupus erythematosus and other inflammatory diseases.[17,18] In target cells, GCs exert their major actions via activating GR. On binding glucocorticoid, the receptor undergoes several conformational changes, which result in nuclear translocation.[19] The GR complex (GRC) interacts with specific target DNA sequences as a homodimer and regulates transcriptional activation or repression.[20,21] Recently, a few studies suggest that several of the PAEs have the potential to disturb GR and regulate downstream genes. DEHP reportedly possesses glucocorticoid-like activity.[22] In addition, dicyclohexyl phthalate and mono-cyclohexyl phthalate can also stimulate GR
CONTACT Tiezhu Li [email protected] College of Food Science and Engineering, Jilin University, Changchun 130062, China; Institute of Agro-Food [email protected] Technology, Jilin Academy of Agricultural Sciences, Changchun 130033, Jilin, People’s Republic of China; Yongjun Wang Institute of Agro-Food Technology, Jilin Academy of Agricultural Sciences, Changchun 130033 Jilin, People’s Republic of China. ß 2020 Taylor & Francis Group, LLC
2
Y. LENG ET AL.
Figure 1. Structures of DEHP (A), DINP (B), DBP (C), DIBP (D), DEP (E), and DMP (F).
activity.[23,24] However, the detailed mechanisms how PAEs bind to GR have not been clarified. In this work, the glucocorticoid effects of six typical PAEs (Figure. 1) were evaluated by reporter gene assays and mRNA analysis. Furthermore, the binding poses of PAEs with GR were predicted by molecular docking. Then their binding stability was assessed by molecular dynamics (MD) simulations. The aim of this study was to explore the possible hormonal activity of PAEs via human GR.
Materials and methods Cell culture and materials The human cervical cancer (HeLa) cell line, human hepatoma (HepG2) cell line and non-small cell lung cancer (A549) cell line were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were routinely grown in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) with 5% CO2 at 37 C. The six typical PAEs (DEHP, DINP, DBP, DIBP, DEP and DMP) (>98% pure) were purchased from Aladdin Biotech Co., Ltd. (Shanghai, China). Dexamethasone (DEX) and dimethyl sulfoxide (DMSO) were obtained from SigmaAldrich (St. Louis, MO, USA). All compounds were dissolved in DMSO. Lipofectamine 2000 transfection reagent was purchased from Thermo Fisher Scientific (San Jose, CA, USA). Cells treated with the equivalent addition of DMSO served as the control.
Construction of the plasmids The human GR expression plasmid pcDNA3.1(þ)-hGR, as well as the reporter plasmid pGL6-TA-GRE-Luc were prepared as previously described.[25] Plasmid pRL-SV40 (Promega, WI, USA) was used as the internal control plasmid in reporter gene assays.
Table 1. Sequences of amplication primers. Gene MKP-1F MKP-1R FASF FASR PEPCKF PEPCKR GADPHF GADPHR HPRTF HPRTR
Primer CCACAAGGCAGACATCAGCTC TCTATGAAGTCAATGGCCTCGTT TATGCTTCTTCGTGCAGCAGTT GCTGCCACACGCTCCTCTAG CAAGACGGTTATCGTCAGCA GAACCTGGCATTGAACGCTT GAAGACGGGCGGAGAGAAAC GCCCAATACGACCAAATCCG GAAGAGCTATTGTAATGACC GCGACCTTGACCATCTTTG
Cell viability Cell viability was examined using the MTT array.[26] HeLa cells seeded in 96-well plates at 1 105 cells/mL (100 lL/ well) were cultured for 18 h in DMEM containing 10% FBS and treated with the six PAEs at different concentrations (10, 50, 100, 500 lM and 1 mM) at 37 C for 4 h. The 100 lL MTT solution diluted with medium was added to the cells for incubation of additional 4 h. The supernatant was removed, and then 150 lL of DMSO was added to dissolve formazan. The absorbance reading at 490 nm was recorded using a microplate reader. Luciferase reporter assay HeLa cells were seeded in 24-well plates at a density of 105 cells per well for 18 h prior to be transiently transfected with pcDNA3.1(þ)-hGR, pGL6-TA-GRE-Luc and pRL-SV40 using Lipofectamine 2000. For each tested chemical, three concentrations (1, 100 nM and 10 lM) were evaluated in HeLa cells. The luciferase activity was measured on a SpectraMax i3x microplate reader (Molecular Devices, Sunnyvale, CA, USA) using a Dual-Glo Luciferase Assay System (Promega, Madison, WI, USA).[27] Real-time quantitative PCR HepG2 cells and A549 cells were seeded in 6-well plates at a density of 2.5 105 cells per well, cultured for 16 h, and
JOURNAL OF ENVIRONMENTAL SCIENCE AND HEALTH, PART A
3
Figure 2. Cytotoxicity of DEHP (A), DINP (B), DBP (C), DIBP (D), DEP (E), and DMP (F) in HeLa cells. Results are given as means ± SD of three independent experiments and normalized to DMSO control group. , , , statistically significant differences (P < 0.05, P < 0.01 and P < 0.001).
treated with the test chemicals respectively for 24 h. Total RNA was extracted with the Trizol reagent (Transgen, Beijing, China), following the manufacturers’ protocol. Reverse transcription reactions were performed with total RNAs (500 ng per sample) using reverse transcriptional kit. Real-time quantitative PCR analysis was conducted using
quantitative PCR kit. The cycling parameters were 94 C for 10 min; 40 circles of 94 C for 5 s, 60 C for 30 s; 94 C for 10 s, 65 C for 60 s, 97 C for 10 s; cooling to 37 C for 30 s. Primers used in this study were shown in Table 1. HPRT and GADPH were served as the normalization genes and the relative expression was calculated by the DDCt method.
4
Y. LENG ET AL.
Molecular docking The three-dimensional structure of the GR ligand binding domain (GR-LBD) was downloaded from Protein Data Bank (ID 4UDC) firstly.[28] The receptor preparation was performed by removing the agonist DEX and then adding the hydrogen atoms. The structures of DEHP and DINP were generated using GaussView and then the energy minimization was performed using Gaussian 09W. Subsequently, both DEHP and DINP were docked into the ligand binding cavity of GR-LBD by AutoDockTools. Ten independent docking procedures for each PAE were performed in this work. The predicted poses of PAEs with lowest binding energies were selected for the sequential studies. Molecular dynamics simulations In addition, the binding stabilities of PAEs with GR-LBD was assessed by molecular dynamics simulations. The CHARMM36 all-atom force field was employed in GROMACS 2019.[29] The topologies of both DEHP and DINP were generated using the CGenFF server. The PAEGR-LBD complex was located in a cubic box with simple point charge water models. Then sodium ions were added to achieve electrostatic neutrality. After the energy minimization, the system was equilibrated at constant pressure and temperature with position restraints on both PAE and GR-LBD. The root mean squared deviation (RMSD) values of PAE and GR-LBD, compared with the docking structure and the crystal structure respectively, were calculated during 20 ns molecular dynamics simulation.
Results and discussion Viability and cytotoxicity
Figure 3. Effects of the tested PAEs on the activation of GR in HeLa cells. (A) DEHP and DINP, (B) DBP and DIBP, (C) DEP and DMP. The treated cells were incubated with the tested PAEs in the presence of 1.39 nM (EC50) DEX. The induction by 1.39 nM DEX was set at 100%. Results are given as means ± SD of three independent experiments and normalized to DEX control group. , , , statistically significant differences (P < 0.05, P < 0.01 and P < 0.001), compared with positive control (¼100%).
To assess the cytotoxicity of the selected PAEs, we used MTT assay to explore how PAEs at different concentrations (10, 50, 100, 500 lM and 1 mM) interacted with HeLa cells. No cytotoxic effects were observed in HeLa cells exposed to the selected PAEs (10–50 lM). However, the highest tested concentration (1 mM) of PAEs caused significant cytotoxic effects in the MTT assays of HeLa cells except for DEHP (P < 0.05) (Figure 2). The MTT results for high concentrations of DBP, DEP and DIBP showed dose-dependent effects to a greater content compared to DINP and DMP. Cell viability of HeLa cells was significantly reduced by DBP, DEP, DIBP, DINP and DMP at high concentration (1 mM) compared to the control. DBP, DEP and DIBP dose-dependently induced higher cytotoxic effects on HeLa cells compared with DINP and DMP. Preliminary results showed that 10 lM represented a non-toxic concentration for all six PAEs. GR transcriptional response induced by single PAEs The ability of single PAEs to activate GR was determined on the HeLa cell lines (Figure. 3). The treated cells were
JOURNAL OF ENVIRONMENTAL SCIENCE AND HEALTH, PART A
5
Figure 4. The synergistic effects of DEHP and DINP on DEX-induced expression of glucocorticoid-responsive genes. HepG2 (or A549) cells were incubated with 10, 100 nM and 1 lM DEHP (or DINP) in the presence of 1 lM DEX. (A) The relative mRNA levels of PEPCK, FAS and MKP-1 with the treatment of 10, 100 nM and 1 lM DEHP in the presence of 1 lM DEX. (B) The relative mRNA levels of PEPCK, FAS and MKP-1 with the treatment of 10, 100 nM and 1 lM DINP in the presence of 1 lM DEX. Results are given as means ± SD of three independent experiments and normalized to DEX control group. , , , statistically significant differences (P < 0.05, P < 0.01 and P < 0.001, respectively).
incubated with the tested PAEs in the presence of 1.39 nM (EC50) DEX. The induction by 1.39 nM DEX was set at 100%. None of the chemicals elicited GR agonistic response in this cell line. Effects of single PAEs on DEX-mediated GR transcriptional response The co-incubation of single PAEs with DEX failed to exhibit any antagonistic effect in the HeLa cell line. However, cotreatment of DEHP and DINP with DEX, exhibited a synergistic effect on GR transactivity. Co-exposure of DEX with DEHP and DINP significantly increased the DEX-mediated GR response to 131.06 ± 2.02% and 142.11 ± 6.72%, respectively (P < 0.01). A dose-dependent increase in GR activities was observed in both chemicals, but with different tendencies. After co-treatment with DEX, DEHP enhanced DEXmediated GR response at the highest concentration (10 lM) while DINP showed the synergistic effect at both 100 nM and 10 lM. HeLa cells contained sufficient endogenous GR. As expected, DEX effectively induced reporter gene transactivation compared to the control (P < 0.001). None of the six
PAEs exhibited an agonistic effect in the HeLa cell line. However, we observed, for the first time, that only DEHP and DINP (co-treated with DEX) can synergistically activate GR at high concentrations (DINP > DEHP). DEHP and DINP may act as novel ligands to induce GR conformation at the molecular level at high concentrations. Similar effects were also shown by other EDCs, such as pesticides. Single pesticides failed to be identified as GR agonists but 12 of the 34 candidate pesticides showed GR agonistic activity cotreated with DEX.[30] Modulation of glucocorticoid-responsive gene expression of DEHP and DINP To verify the transcriptional synergy potency of 2 candidate PAEs (DEHP and DINP) via GR, we performed the mRNA analysis of 3 endogenous GC-sensitive genes, including PEPCK, FAS and MKP-1, in HepG2 cells and A549 cells. Exposure to the GR agonist DEX (1 lM) for 24 h induced the upregulation of mRNA level of PEPCK, FAS and MKP-1 (Figure 4). In Figure 4A and 4B, consistent with the reporter assays, 100 nM DEHP and DINP co-treated with DEX enhanced DEX-induced increase of PEPCK mRNA by
6
Y. LENG ET AL.
48.54% and 19.39%, respectively. FAS mRNA levels were increased in a synergistic manner in the presence of DEX by all three doses of DEHP and DINP. Moreover, 10 nM DINP increased MKP-1 mRNA levels, indicating a synergistic effect (Figure 4B).
The expression of 3 GR-regulated genes, including PEPCK, FAS and MKP-1 was evaluated, some of which (PEPCK, FAS) were reportedly involved in glucose and fat metabolism.[31,32] MKP-1 was more likely to play a role in anti-inflammatory activities of GCs.[31] The genes mentioned above were greatly transactivated by DEX in both HepG2 cells and A549 cells.[33,34] The results implied that treatment of DEHP and DINP combined with DEX exhibited synergistic effects on DEX-induced GRE activity strongly at the transcriptional level. These results were in agreement with the reporter gene results and further confirmed the synergy potency of DEHP and DINP to enhance the DEX-induced transactivation. Binding poses of PAEs with GR The results of molecular docking showed that both DEHP (Figure 5A) and DINP (Figure 5B) can fit into the ligand binding cavity of GR-LBD. Clearly, these two PAEs bind to the active site of GR-LBD in a similar manner to the crystal pose of DEX. Regarding the synergistic agonist observed from combinations of PAE (DEHP or DINP) and DEX (Figure 3A), computational alignment of their respective binding conformations (Figure 5A and 5B) supports the possibility that both PAE (DEHP or DINP) and DEX can bind to GR-LBD simultaneously. Furthermore, the amino acid residues of GR-LBD that lie within 4 Å away from DEHP and DINP are shown in Figure 5C and 5D, respectively. Totally, 14 residues in the hydrophobic cavity are revealed to involve in formation of the hydrophobic interactions with DINP (Table 2). Interestingly, these 14 residues also hydrophobically interacted with DEHP. In addition to the aforementioned residues, Ile559 and Met639 also make hydrophobic interactions with DEHP. As illustrated in Figure 5C and Table 2, DEHP forms a hydrogen bond with Met560, which contributes to the stability of DEHP-GR-LBD binding. Met560 forms a hydrogen bond with DINP, while Asn564 forms two hydrogen bonds with DINP (Figure 5D; Table 2). In summary, both hydrophobic interactions and hydrogen bonding interactions are the dominant forces to stabilize PAE-GR-LBD binding.
Figure 5. The computational alignment of the predicted poses of PAEs and the crystal pose of DEX (A, B) as well as the structural details of GR-PAEs binding (C, D). (A) DEHP, cyan; DEX, yellow. (B) DINP, magenta; DEX, yellow. (C) DEHP, cyan. (D) DINP, magenta.
Binding stabilities of PAEs with GR The dynamic binding process of PAEs with GR was assessed by MD simulations and their RMSD values have been
Table 2. The results of molecular docking and molecular dynamics simulations between PAEs and GR. Compound DEHP
Hydrogen bonds Met560
DINP
Met560, Asn564
Hydrophobic contacts Ile559, Met560, Leu563, Leu566, Trp600, Met601, Met604, Ala605, Leu608, Phe623, Met639, Met646, Leu732, Ile747, Phe749, Leu753 Met560, Leu563, Leu566, Trp600, Met601, Met604, Ala605, Leu608, Phe623, Met646, Leu732, Ile747, Phe749, Leu753
RMSD (nm) for GR 0.11 ± 0.01
RMSD (nm) for PAE 0.38 ± 0.05
0.14 ± 0.01
0.37 ± 0.07
JOURNAL OF ENVIRONMENTAL SCIENCE AND HEALTH, PART A
7
Figure 6. The variations of RMSD values for DEHP (left) and DINP (right).
shown in Figure 6. As illustrated in Table 2, the average RMSD values of the backbone of protein for DEHP-GRLBD and DINP-GR-LBD were 0.11 and 0.14 nm, respectively, indicating that PAEs produce only a slight structural disturbance of GR-LBD. By contrast, PAEs undergo a significant structural disturbance compared with their initial docking structures during MD simulation. As shown in Figure 6, both DEHP and DINP basically achieve stability in the GR binding pocket after 10 ns. The average RMSD values of DEHP and DINP are 0.38 and 0.37 nm, respectively (Table 2).
[2]
[3]
[4]
[5]
Conclusions This study was conducted to evaluate whether the six tested PAEs presented biphasic effects to modulate the endocrine system on human GR. DEHP and DINP exhibited a synergistic effect on DEX-induced transactivation of GR and the expression of GR-mediated genes (PEPCK, FAS and MKP1), as determined in reporter gene and mRNA analysis. Moreover, the results of docking and molecular dynamics simulations confirm that hydrophobic interactions may stabilize the binding between molecules and GR molecular. In conclusion, DEHP and DINP may be synergic with DEX via GR signal transduction pathway in vitro. The possibility of PAEs to exert deleterious effects should be further evaluated.
[6]
[7]
[8]
Disclosure statement The authors declare that they have no actual or competing of interests. [9]
Funding This work was supported by the National Natural Science Foundation of China (U19A2035), the Science and Technology Development Project Foundation of Jilin Province (20180201062SF), and the Agricultural Science and Technology Innovation Program of Jilin Province (CXGC2017JQ006 and CXGC2017JQ010).
References [1]
Roslev, P.; Vorkamp, K.; Aarup, J.; Frederiksen, K.; Nielsen, P. H. Degradation of Phthalate Esters in an Activated Sludge Wastewater Treatment Plant. Water Res. 2007, 41, 969–976. DOI: 10.1016/j.watres.2006.11.049.
[10]
[11]
Martino-Andrade, A. J.; Chahoud, I. Reproductive Toxicity of Phthalate Esters. Mol. Nutr. Food Res. 2010, 54, 148–157. DOI: 10.1002/mnfr.200800312. Sibali, L. L.; Okonkwo, J. O.; Mccrindle, R. I. Determination of Selected Phthalate Esters Compounds in Water and Sediments by Capillary Gas Chromatography and Flame Ionization Detector. J. Environ. Sci. Health, Part A: Toxic/Hazard. Subst. Environ. Eng. 2013, 48, 1365–1377. DOI: 10.1080/10934529. 2013.781884. Zhang, J.; Li, T.; Zhang, T.; Xue, P.; Guan, T.; Yuan, Y.; Yu, H. Receptor-Based Fluorescence Polarization Assay to Detect Phthalate Esters in Chinese Spirits. Food Anal. Methods 2017, 10, 1293–1300. DOI: 10.1007/s12161-016-0682-4. Net, S.; Delmont, A.; Sempere, R.; Paluselli, A.; Ouddane, B. Reliable Quantification of Phthalates in Environmental Matrices (Air, Water, Sludge, Sediment and Soil): A Review. Sci. Total Environ. 2015, 515–516, 162–180. DOI: 10.1016/j.scitotenv.2015. 02.013. Mortensen, G. K.; Main, K. M.; Andersson, A. M.; Leffers, H.; Skakkebaek, N. E. J. A.; Chemistry, B. Determination of Phthalate Monoesters in Human Milk, Consumer Milk, and Infant Formula by Tandem Mass Spectrometry (LC–MS–MS). Anal. Bioanal. Chem. 2005, 382, 1084–1092. DOI: 10.1007/ s00216-005-3218-0. Gardner, S. T.; Wood, A. T.; Lester, R.; Onkst, P. E.; Burnham, N.; Perygin, D. H.; Rayburn, J. Assessing Differences in Toxicity and Teratogenicity of Three Phthalates, Diethyl Phthalate, Di-n-Propyl Phthalate, and Di-n-Butyl Phthalate, Using Xenopus laevis Embryos. J. Toxicol. Environ. Health Part A 2016, 79, 71–82. DOI: 10.1080/15287394.2015.1106994. Johansson, H. K. L.; Jacobsen, P. R.; Hass, U.; Svingen, T.; Vinggaard, A. M.; Isling, L. K.; Axelstad, M.; Christiansen, S.; Boberg, J. Perinatal Exposure to Mixtures of Endocrine Disrupting Chemicals Reduces Female Rat Follicle Reserves and Accelerates Reproductive Aging. Reprod. Toxicol. 2016, 61, 186–194. DOI: 10.1016/j.reprotox.2016.03.045. Le Moal, J.; Sharpe, R. M.; Jorgensen, N.; Levine, H.; Jurewicz, J.; Mendiola, J.; Swan, S. H.; Virtanen, H.; Christin-Maitre, S.; Cordier, S.; HURGENT Network. Toward a Multi-Country Monitoring System of Reproductive Health in the Context of Endocrine Disrupting Chemical Exposure. Eur J. Public Health 2016, 26, 76–83. DOI: 10.1093/eurpub/ckv153. Kay, V. R.; Bloom, M. S.; Foster, W. G. Reproductive and Developmental Effects of Phthalate Diesters in Males. Crit. Rev. Toxicol. 2014, 44, 467–498. DOI: 10.3109/10408444.2013. 875983. Sheikh, I. A. Stereoselectivity and the Potential Endocrine Disrupting Activity of Di-(2-Ethylhexyl)Phthalate (DEHP) Against Human Progesterone Receptor: A Computational Perspective. J. Appl. Toxicol. 2016, 36, 741–747. DOI: 10.1002/ jat.3302.
8
Y. LENG ET AL.
[12]
Barnes, P. J. Anti-Inflammatory Actions of Glucocorticoids: molecular Mechanisms. Clin. Sci. 1998, 94, 557–572. DOI: 10. 1042/cs0940557. Zhang, T.; Zhong, S.; Li, T.; Zhang, J. Saponins as Modulators of Nuclear Receptors. Crit. Rev. Food Sci. Nutr. 2020, 60, 94–107. DOI: 10.1080/10408398.2018.1514580. Charmandari, E.; Tsigos, C.; Chrousos, G. Endocrinology of the Stress Response. Annu. Rev. Physiol. 2005, 67, 259–284. Zhang, T.; Liang, Y.; Zhang, J. Natural and Synthetic Compounds as Dissociated Agonists of Glucocorticoid Receptor. Pharmacol. Res. 2020, 156, 104802DOI: 10.1016/j. phrs.2020.104802. Guan, T.; Sun, Y.; Yu, H.; Li, T.; Zhang, J.; Zhang, T. A Fluorescence Polarization Assay for Bisphenol Analogs in Soybean Oil Using Glucocorticoid Receptor. Eur. J. Lipid Sci. Technol. 2017, 119, 1700042. DOI: 10.1002/ejlt.201700042. Hench, P. S.; Kendall, E. C.; Slocumb, C. H.; Polley, H. F. Effects of Cortisone Acetate and Pituitary ACTH on Rheumatoid Arthritis, Rheumatic Fever and Certain Other Conditions. Arch. Intern. Med. (Chic) 1950, 85, 545–666. DOI: 10.1001/archinte.1950.00230100002001. Kirwan, J. R.; Balint, G.; Szebenyi, B. Anniversary: 50 Years of Glucocorticoid Treatment in Rheumatoid Arthritis. Rheumatology (Oxford) 1999, 38, 100–102. DOI: 10.1093/ rheumatology/38.2.100. Almawi, W. Y.; Melemedjian, O. K. Molecular Mechanisms of Glucocorticoid Antiproliferative Effects: Antagonism of Transcription Factor Activity by Glucocorticoid Receptor. J. Leukoc. Biol. 2002, 71, 9–15. Vandevyver, S.; Dejager, L.; Libert, C. On the Trail of the Glucocorticoid Receptor: Into the Nucleus and Back. Traffic 2012, 13, 364–374. DOI: 10.1111/j.1600-0854.2011.01288.x. Lefstin, J. A.; Yamamoto, K. R. Allosteric Effects of DNA on Transcriptional Regulators. Nature 1998, 392, 885–888. DOI: 10.1038/31860. Klopcic, I.; Kolsek, K.; Dolenc, M. S. Glucocorticoid-like Activity of Propylparaben, Butylparaben, Diethylhexyl Phthalate and Tetramethrin Mixtures Studied in the MDA-kb2 Cell Line. Toxicol. Lett. 2015, 232, 376–383. DOI: 10.1016/j.toxlet.2014.11. 019. Singh, N.; Dalal, V.; Kumar, P. Molecular Docking and Simulation Analysis for Elucidation of Toxic Effects of Dicyclohexyl Phthalate (DCHP) in Glucocorticoid ReceptorMediated Adipogenesis. Mol. Simul. 2020, 46, 9–21. DOI: 10. 1080/08927022.2019.1662002. Sargis, R. M.; Johnson, D. N.; Choudhury, R. A.; Brady, M. J. Environmental Endocrine Disruptors Promote Adipogenesis in the 3T3-L1 Cell Line through Glucocorticoid Receptor
[13]
[14] [15]
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33]
[34]
Activation. Obesity (Silver Spring) 2010, 18, 1283–1288. DOI: 10.1038/oby.2009.419. Zhang, T.; Liang, Y.; Zuo, P.; Yan, M.; Jing, S.; Li, T.; Wang, Y.; Zhang, J.; Wei, Z. Identification of 20(R, S)-Protopanaxadiol and 20(R, S)-Protopanaxatriol for Potential Selective Modulation of Glucocorticoid Receptor. Food Chem. Toxicol. 2019, 131, 110642. DOI: 10.1016/j.fct.2019.110642. Mosmann, T. Rapid Colorimetric Assay for Cellular Growth and Survival: Application to Proliferation and Cytotoxicity Assays. J. Immunol. Methods. 1983, 65, 55–63. DOI: 10.1016/ 0022-1759(83)90303-4. Zhang, T.; Zhong, S.; Wang, Y.; Dong, S.; Guan, T.; Hou, L.; Xing, X.; Zhang, J.; Li, T. In Vitro and In Silico Perspectives on Estrogenicity of Tanshinones from Salvia miltiorrhiza. Food Chem. 2019, 270, 281–286. DOI: 10.1016/j.foodchem.2018.07. 098. Edman, K.; Hosseini, A.; Bjursell, M. K.; Aagaard, A.; Wissler, L.; Gunnarsson, A.; Kaminski, T.; K€ ohler, C.; B€ackstr€om, S.; Jensen, T. J.; et al. Ligand Binding Mechanism in Steroid Receptors: From Conserved Plasticity to Differential Evolutionary Constraints. Structure 2015, 23, 2280–2290. DOI: 10.1016/j.str.2015.09.012. Zhang, J.; Zhang, T.; Guan, T.; Yu, H.; Li, T. In Vitro and In Silico Assessment of the Structure-Dependent Binding of Bisphenol Analogues to Glucocorticoid Receptor. Anal. Bioanal. Chem. 2017, 409, 2239–2246. DOI: 10.1007/s00216-016-0168-7. Zhang, J.; Zhang, J.; Liu, R.; Gan, J.; Liu, J.; Liu, W. EndocrineDisrupting Effects of Pesticides through Interference with Human Glucocorticoid Receptor. Environ. Sci. Technol. 2016, 50, 435–443. DOI: 10.1021/acs.est.5b03731. Sch€acke, H.; Rehwinkel, H.; Asadullah, K.; Cato, A. C. B. Insight into the Molecular Mechanisms of Glucocorticoid Receptor Action Promotes Identification of Novel Ligands with an Improved Therapeutic Index. Exp. Dermatol. 2006, 15, 565–573. DOI: 10.1111/j.1600-0625.2006.00453.x. Van Raalte, D. H.; Ouwens, D. M.; Diamant, M. Novel Insights into Glucocorticoid-Mediated Diabetogenic Effects: Towards Expansion of Therapeutic Options? Eur. J. Clin. Invest. 2009, 39, 81–93. DOI: 10.1111/j.1365-2362.2008.02067.x. Haridas, V.; Xu, Z.-X.; Kitchen, D.; Jiang, A.; Michels, P.; Gutterman, J. The Anticancer Plant Triterpenoid, Avicin D, Regulates Glucocorticoid Receptor Signaling: Implications for Cellular Metabolism. PloS One. 2011, 6, e28037. DOI: 10.1371/ journal.pone.0028037. Xiang, G.; Fan, M.; Ma, Y.; Wang, M.; Gao, J.; Chen, J.; Li, X.; Xue, W.; Wang, Y.; Gao, H.; Shen.; et al. Anti-inflammatory Actions of Caesalpinin M2 in Experimental Colitis as a Selective Glucocoricoid Receptor Modulator . Biochem. Pharmacol. 2018, 150, 150–159. DOI: 10.1016/j.bcp.2018.02.003.
![[No title available]](/assets/img/hold.png)
