Amyotrophic Lateral Sclerosis and Frontotemporal Degeneration, 2015; Early Online: 1–4
ORIGINAL ARTICLE
Amyotrophic Lateral Sclerosis and Frontotemporal Degeneration Downloaded from informahealthcare.com by University Library Utrecht on 03/13/15 For personal use only.
No evidence of association between polymorphisms in four genes and sporadic amyotrophic lateral sclerosis in Han Chinese Ran An1, Jing Xi1, Xinglong Yang1, Xiaoli yao2 & Yanming Xu1 1Department
of Neurology, West China Hospital, Sichuan University, Chengdu, Sichuan Province, and of Neurology, National Key Clinical Department and Key Discipline of Neurology, the First Affiliated Hospital Sun Yat-Sen University, Guangzhou, P.R. China
2Department
Abstract The four single nucleotide polymorphisms (SNPs) rs34517613, rs3849943, rs8141797 and rs6703183, each located in a different gene, have recently been associated with risk of developing sporadic amyotrophic lateral sclerosis (SALS) in European and northern Chinese populations, but no data are yet available for other ethnic groups. Here we explored the possible association between these four SNPs and SALS in Han Chinese primarily from southern and south-western China. A total of 298 individuals with SALS from three centres in mainland China and 486 unrelated healthy controls were recruited. All subjects were successfully genotyped using the ligase detection reaction (LDR). We found no evidence that any of these SNPs are associated with risk of disease in either heterozygous or homozygous individuals (p 0.05). Subgroup analysis based on gender showed a similar lack of association. However, subgroup analysis based on spinal- or bulbar-onset SALS revealed significant differences in the genotype distributions (p 0.009) and minor allele frequencies of rs6703183 (p 0.004). In conclusion, it may be premature to conclude associations between these four SNPs and SALS, which should be examined in additional ethnic groups. Key words: Amyotrophic lateral sclerosis, rs34517613, rs3849943, rs8141797, rs6703183
Introduction Amyotrophic lateral sclerosis (ALS) is a rapidlyprogressing and ultimately fatal neurodegenerative disease characterized by selective loss of upper and lower motor neurons from the spinal cord, brainstem and cerebral cortex (1). ALS is thought to be multifactorial, with both environmental and genetic causes. Recently, the single nucleotide polymorphism (SNP) rs34517613 in the keratin 18 pseudogene 55 (KRT18P55) and the SNP rs3849943 in the chromosome 9 open reading frame 72 gene (C9orf72) have been associated with elevated risk of sporadic ALS (SALS) in European populations (2). In a study conducted with Han Chinese from northern China, the SNP rs8141797 in the sushi domain-containing 2 gene (SUSD2) and the SNP rs6703183 in the calcium/calmodulin-dependent protein kinase IG gene (CAMK1G) were also associated with elevated risk of SALS (3). Since SALS is known to reflect a complex interplay of genetic and environmental factors, we wished
to verify these associations in a different population. Therefore we conducted a relatively large casecontrol study involving nearly 300 patients and nearly 500 controls from northern, south-western and southern China. Patients and methods The study protocol was approved by the ethics committee of Sichuan University and written informed consent was obtained from participants. The study included 298 Han Chinese patients whom two specialists independently diagnosed as having definite or probable SALS based on revised El Escorial criteria. Patients were recruited mainly from outpatient clinics at the First Affiliated Hospital of Sun Yat-sen University in southern China, and West China Hospital of Sichuan University in south-west China. A smaller number of patients were recruited from the Second Affiliated Hospital of Hebei Medical University in northern China. In parallel, 486 unrelated Han Chinese healthy controls were recruited
Correspondence: Y. Xu, Department of Neurology, West China Hospital, Sichuan University, Chengdu, Sichuan Province, 610041, P.R. China. Fax: 86 2885423550. E-mail: [email protected] (Received 6 October 2014; accepted 14 December 2014) ISSN 2167-8421 print/ISSN 2167-9223 online © 2015 Informa Healthcare DOI: 10.3109/21678421.2014.999790
2
R. An et al. Table I. Primers used in ligase detection reactions to genotype polymorphisms potentially linked to sporadic amyotrophic lateral sclerosis in Han Chinese. Gene
Base change
rs34517613
KRT18P55
C T
rs3849943
C9orf72
A G
rs8141797
SUSD2
A G
rs6703183
CAMK1G
C T
Amyotrophic Lateral Sclerosis and Frontotemporal Degeneration Downloaded from informahealthcare.com by University Library Utrecht on 03/13/15 For personal use only.
Polymorphism
LDR product (bp)
Primer CCTGAGGTTAAAATTGAGTGG (F) TTTCTTTTTCCCTGGACACC (R) AATCTAACGATCACTTCTGC (F) CTGTGCTAGAATTTTGGACC (R) TCCAGCAGCACGTACTCTC (F) CTTCGGAGACCCACACTTTG (R) ACTCCCCTACCTCACACATC (F) GTCATAGTCAAGTGGTCAAG (R)
96 89 98 100
CAMK1G: calcium/calmodulin-dependent protein kinase IG gene; C9orf72: chromosome 9 open reading frame 72 gene; F: forward primer; KRT18P55: keratin 18 pseudogene 55 gene; R: reverse primer; SUSD2: sushi domain-containing 2 gene.
from health centres of the three hospitals; the controls were well matched to patients in terms of gender and age. Genomic DNA was extracted from peripheral blood leukocytes using a standard phenol-chloroform method. All four SNPs were successfully genotyped in all subjects using the ligase detection reaction ((4), Table I). Differences in genotype and minor allele frequencies between patients and controls were assessed for significance using the c2 test. The Hardy-Weinberg equilibrium (HWE) calculator (www.genes.org. uk/software/hardy-weinberg.shtml) was used to determine whether the genotype distributions of any of the SNPs deviated from HWE. All statistical tests were performed using SPSS 17.0 (Chicago, IL, USA). Two-tailed p 0.05 was defined as the threshold of significance. Results We analysed the genotype and minor allele frequencies for all four SNPs in 298 SALS patients (153 males; mean age, 53.9 11.8 years; range 24–84 years) and in 486 healthy controls (276 males; mean age, 54.7 11.0 years; range 30–88 years). Allele and genotype distributions for each SNP in both groups showed no significant deviation from HWE. Genotype and minor allele frequencies for the four SNPs showed no significant differences between
patients and controls (Table II). Similarly, subgroup analysis by gender showed no significant differences in genotype distributions or minor allele frequencies between patients and controls for any of the SNPs (Tables III, IV). However, subgroup analysis by spinal- or bulbar-onset SALS revealed significant differences in both genotype distributions and minor allele frequencies at SNP rs6703183 (Table V). Discussion This relatively large SNP study failed to find evidence that the SNPs rs34517613, rs3849943, rs8141797 and rs6703183 are associated with risk of SALS in Han Chinese from three regions of China. These results are inconsistent with previous findings in Europeans and in Han Chinese from the north of the country (2,3). There are probably several factors behind these discrepant findings, one of which is likely to be ethnic differences. For example, the frequency of the minor T allele in rs34517613 is 10.80% among Europeans (2) but only 0.17% in our study of Chinese from different parts of the country. Many casecontrol association studies from various parts of Europe have suggested that hexanucleotide repeat expansion within the first intron of the C9orf72 gene is associated with risk of ALS (5–8). The same expansion appears to contribute little or nothing to risk of ALS in various parts of Asia (5,9–12), including in
Table II. Genotype and minor allele frequencies in Han Chinese patients with sporadic amyotrophic lateral sclerosis (SALS) and healthy controls. Minor allele frequency, n (%)
Genotype frequencies Polymorphism rs34517613 rs3849943 rs8141797 rs6703183
Genotypes
SALS (n 298)
CC/TC/TT AA/GA/GG AA/GA/GG CC/TC/TT
297/1/0 258/39/1 242/54/2 123/135/40
Controls Hardy-Weinberg (n 486) (SALS/control) 485/1/0 426/56/4 377/101/8 217/210/59
0.98/0.98 0.71/0.16 0.59/0.68 0.76/0.46
p
SALS (n 596)
Controls (n 972)
1.000 1 (0.17) 1 (0.10) 0.581 41 (6.88) 64 (6.58) 0.309 58 (9.73) 117 (12.04) 0.635 215 (36.07) 328 (33.74)
p
OR (95% CI)
1.000 0.821 0.159 0.347
0.613 (0.038–9.815) 0.954 (0.636–1.432) 1.269 (0.910–1.770) 0.903 (0.729–1.117)
I: confidence interval; Hardy-Weinberg: Hardy-Weinberg equilibrium coefficient; OR: odds ratio; SALS: sporadic amyotrophic C lateral sclerosis.
Gene polymorphisms and sporadic ALS
3
Table III. Genotype frequencies in Han Chinese with sporadic amyotrophic lateral sclerosis (SALS) and healthy controls, stratified by gender. Male
Amyotrophic Lateral Sclerosis and Frontotemporal Degeneration Downloaded from informahealthcare.com by University Library Utrecht on 03/13/15 For personal use only.
Polymorphism rs34517613 rs3849943 rs8141797 rs6703183
Genotypes
SALS (n 202)
Controls (n 290)
CC/TC/TT AA/GA/GG AA/GA/GG CC/TC/TT
202/0/0 178/23/1 160/40/2 76/102/24
289/1/0 252/34/4 213/72/5 138/116/36
Female SALS (n 96)
Controls (n 196)
1.000 — 95/1/0 0.688 1.118 (0.648–1.930) 80/16/0 0.142 1.377 (0.897–2.113) 82/14/0 0.028a 0.664 (0.461–0.958) 47/33/16
196/0/0 174/20/2 164/29/3 81/93/22
p
OR (95% CI)
p
OR (95% CI)
0.329 — 0.194 0.632 (0.315–1.268) 0.701 1.143 (0.578–2.260) 0.217 1.362 (0.834–2.225)
I: confidence interval; OR: odds ratio; SALS: sporadic amyotrophic lateral sclerosis. C —: Because the genotype ‘TC TT’ at rs34517613 did not occur in any of the males with SALS or in any of the female controls, we cannot calculate the corresponding OR value. a No significant difference after Bonferroni adjustment.
China (13–15). Our finding of no association between another SNP of C9orf72, rs3849943, and risk of SALS extends these previous results, strengthening the argument that genetic variants in the C9orf72 gene do not affect susceptibility of mainland Chinese to SALS. This also strengthens the evidence that genetic determinants of SALS vary significantly between ethnicities. Our findings contradict a previous genetic association study showing that SNPs rs8141797 and rs6703183 are associated with risk of SALS in individuals from northern China (3). While that study analysed a larger group of patients (706) and controls (1777) than we did, we suspect that our contrasting results reflect differences not in statistical
power but in genetic background: the previous study examined only individuals from northern China, whereas we recruited individuals mainly from the south and south-west, together with a smaller number from the north. Although that study and ours involved primarily Han Chinese, this ethnic group can show substantial genetic variation (13–15), presumably due to a long history of intermarriage among genetic subpopulations in the country. It is also possible that our results differ from the previous study in northern China because of differences in environmental exposure. Environmental factors are known to contribute to an increased risk of ALS. For example, lead, mercury, selenium, zinc and copper are environmental risk factors of ALS
Table IV. Minor allele frequencies in Han Chinese with sporadic amyotrophic lateral sclerosis (SALS) and healthy controls, stratified by gender. Minor allele frequency, n (%) Male Polymorphism Genotypes rs34517613 rs3849943 rs8141797 rs6703183
SALS (n 404)
Controls (n 580)
CC/TC/TT 0 (0) 1 (0.17) AA/GA/GG 25 (6.19) 42 (7.24) AA/GA/GG 44 (10.89) 82 (14.14) CC/TC/TT 150 (37.13) 188 (32.41)
p
Female OR (95% CI)
SALS (n 192)
Controls (n 392)
1.000 — 1 (0.52) 0 (0) 0.519 1.183 (0.709–1.975) 16 (8.33) 24 (6.12) 0.134 1.347 (0.912–1.991) 14 (7.29) 35 (8.93) 0.125 0.812 (0.622–1.060) 65 (33.85) 137 (34.95)
p
OR (95% CI)
0.329 — 0.320 0.717 (0.372–1.385) 0.503 1.246 (0.654–2.377) 0.794 1.050 (0.729–1.511)
I: confidence interval; OR: odds ratio; SALS: sporadic amyotrophic lateral sclerosis. C —: Because the genotype ‘TC TT’ at rs34517613 did not occur in any of the males with SALS or in any of the female controls, we can not calculate the corresponding OR value. Table V. Genotype and minor allele frequencies in Han Chinese patients with sporadic amyotrophic lateral sclerosis (SALS), stratified by site of onset. Minor allele frequency, n (%)
Initial symptoms
Polymorphism rs34517613 rs3849943 rs8141797 rs6703183
Genotypes CC/TC/TT AA/GA/GG AA/GA/GG CC/TC/TT
Spinal Bulbar onset onset (n 233) (n 65) 233/0/0 202/30/1 187/44/2 87/110/36
64/1/0 56/9/0 55/10/0 36/25/4
p
OR (95% CI)
Spinal onset (n 466)
0.218 — 0 0.910 1.047 (0.471–2.328) 32 0.426 0.739 (0.350–1.560) 48 0.009 0.480 (0.275–0.837) 182
Bulbar onset (n 130)
(0) 1 (0.77) (6.87) 9 (6.92) (10.3) 10 (7.69) (39.06) 33 (25.39)
p
OR (95% CI)
0.218 0.982 0.375 0.004
— 1.009 (0.469–2.171) 0.726 (0.356–1.477) 0.531 (0.343–0.822)
I: confidence interval; OR: odds ratio; SALS: sporadic amyotrophic lateral sclerosis. C —: Because the genotype ‘TC TT’ at rs34517613 did not occur in any of spinal-onset SALS, we can not calculate the corresponding OR value.
Amyotrophic Lateral Sclerosis and Frontotemporal Degeneration Downloaded from informahealthcare.com by University Library Utrecht on 03/13/15 For personal use only.
4
R. An et al.
(16), and risk of the disease is higher in populations living close to water bodies where cyanobacterial blooms occur and in populations that obtain their domestic water from surface water and shallow wells (17). This may reflect the association between the neurotoxin b-methylamino-l-alanine (BMAA) produced by cyanobacteria and risk of ALS. Given the potential for large differences between northern and southern China in levels of BMAA or heavy metals in drinking water, future studies should examine whether these environmental factors may help explain the significant difference in SNP associations among Han Chinese. We cannot exclude that our negative findings reflect inadequate statistical power which resulted from the limited sample size and/or low risk allele frequency in our study, since the highest power in our study was less than 80%. This highlights the need for larger studies in additional ethnic groups. Our subgroup analysis by gender showed no significant effect of gender on genotype distributions or minor allele frequencies for any of the SNPs in either patients or controls. However, genotype distributions and minor allele frequencies at rs6703183 did differ significantly between patients with spinal- or bulbar-onset SALS (genotypes, p 0.009; minor allele frequencies, p 0.004). However, compared with the control groups, respectively, there were no significant differences (data not shown). There was a literature that indicated specific SNPs seem to be associated with gender, site of onset of sporadic ALS (18). Therefore we suggest that SNP rs6703183 is likely to be more common in patients with spinal-onset SALS than in patients with bulbar-onset disease. In summary, although we failed to find any evidence that SNPs rs34517613, rs3849943, rs8141797 or rs6703183 are associated with risk of SALS in Han Chinese, our data do suggest that the rs6703183 polymorphism may be more common in patients with spinal-onset SALS than in those with bulbaronset disease. Since our sample was relatively small, all these results should be verified and extended in much larger and ethnically diverse study populations. Such work may help clarify not only genetic determinants of the disease but also the relative contributions of genetic and environmental risk factors. Acknowledgements The study was supported by the Sichuan Key Project of Science and Technology and the Sichuan Applied Basic Research of Science and Technology. We thank all the subjects and their families who participated in this study. Declaration of interest: The authors declare no actual or potential conflicts of interest. The authors alone are responsible for the content and writing of the paper.
References 1. Brooks BR, Miller RG, Swash M, Munsat TL. El Escorial revisited: revised criteria for the diagnosis of amyotrophic lateral sclerosis. Amyotroph Lateral Scler Other Motor Neuron Disord. 2000;1:293–9. 2. Fogh I, Ratti A, Gellera C, Lin K, Tiloca C, Moskvina V, et al. A genome-wide association meta-analysis identifies a novel locus at 17q11.2 associated with sporadic amyotrophic lateral sclerosis. Hum Mol Genet. 2014;23:2220–31. 3. Deng M, Wei L, Zuo X, Tian YH, Xie F, Hu PP, et al. Genome-wide association analyses in Han Chinese identify two new susceptibility loci for amyotrophic lateral sclerosis. Nat Genet. 2013;45:697–700. 4. Thomas G, Sinville R, Sutton S, Farquar H, Hammer RP, Soper SA, et al. Capillary and microelectrophoretic separations of ligase detection reaction products produced from low-abundant point mutations in genomic DNA. Electrophoresis. 2004;25:1668–77. 5. Sabatelli M, Conte A, Zollino M. Clinical and genetic heterogeneity of amyotrophic lateral sclerosis. Clin Genet. 2013;83:408–6. 6. Smith BN, Newhouse S, Shatunov A, Vance C, Topp S, Johnson L, et al. The C9orf72 expansion mutation is a common cause of ALS/–FTD in Europe and has a single founder. Eur J Hum Genet. 2013;21:102–8. 7. Mok KY, Koutsis G, Schottlaender LV, Polke J, Panas M, Houlden H. High frequencies of the expanded C9orf72 hexanucleotide repeat in familial and sporadic Greek ALS patients. Neurobiol Aging. 2012;33:1851,e1–5. 8. Renton AE, Majounie E, Waite A, Simon-Sanchez J, Rollinson S, Gibbs JR, et al. A hexanucleotide repeat expansion in C9orf72 is the cause of chromosome 9p21-linked ALS-FTD. Neuron. 2011;72:257–68. 9. Tomiyama H. C9orf72 in Japanese amyotrophic lateral sclerosis (ALS). Rinsho, Shinkeiqaku. 2013;53:1074–6. 10. Alavi A, Nafissi S, Rohani M, Shahidi G, Zamani B, Shamshiri H, et al. Repeat expansion in C9orf72 is not a major cause of amyotrophic lateral sclerosis among Iranian patients. Neurobiol Aging. 2014;35:267,e1–7. 11. Jang JH, Kwon MJ, Choi WJ, Oh KW, Koh SH, Ki CS, et al. Analysis of the C9orf72 hexanucleotide repeat expansion in Korean patients with familial and sporadic amyotrophic lateral sclerosis. Neurobiol Aging. 2013;34:1311,e7–9. 12. Oqaki K, Li Y, Atsuta N, Tomiyama H, Funayama M, Watanabe H, et al. Analysis of C9orf72 repeat expansion in 563 Japanese patients with amyotrophic lateral sclerosis. Neurobiol Aging. 2012;33:2527,e11–6. 13. Zou ZY, Li XG, Liu MS, Cui LY. Screening for C9orf72 repeat expansions in Chinese amyotrophic lateral sclerosis patients. Neurobiol Aging. 2013;34:1710,e5–6. 14. Liu R, Tang L, Cai B, Liu X, Ye X, Ma Y, et al. C9orf72 repeat expansions are not detected in Chinese patients with familial ALS. Amyotroph Lateral Scler Frontotemporal Degener. 2013;14:630–1. 15. Tsai CP, Soong BW, Tu PH, Lin KP, Fuh JL, Tsai PC, et al. A hexanucleotide repeat expansion in C9orf72 causes familial and sporadic ALS in Taiwan. Neurobiol Aging. 2012;33: 2232.e11–2232. 16. Trojsi F, Monsurro MR, Tedeschi G. Exposure to Environmental Toxicants and Pathogenesis of Amyotrophic Lateral Sclerosis: State of the Art and Research Perspectives. Int J Mol Sci. 2013;14:15286–311. 17. Bradley WG, Borenstein AR, Nelson LM, Codd GA, Rosen BH, Stommel EW, et al. Is exposure to cyanobacteria an environmental risk factor for amyotrophic lateral sclerosis and other neurodegenerative diseases? Amyotroph Lateral Scler Frontotemporal Degener. 2013;14:325–33. 18. Dunckley T, Huentelman MJ, Craiq DW, Pearson JV, Szelinger S, Joshipura K, et al. Whole-genome analysis of sporadic amyotrophic lateral sclerosis. N Engl J Med. 2007; 357:775–88.
ORIGINAL ARTICLE
Amyotrophic Lateral Sclerosis and Frontotemporal Degeneration Downloaded from informahealthcare.com by University Library Utrecht on 03/13/15 For personal use only.
No evidence of association between polymorphisms in four genes and sporadic amyotrophic lateral sclerosis in Han Chinese Ran An1, Jing Xi1, Xinglong Yang1, Xiaoli yao2 & Yanming Xu1 1Department
of Neurology, West China Hospital, Sichuan University, Chengdu, Sichuan Province, and of Neurology, National Key Clinical Department and Key Discipline of Neurology, the First Affiliated Hospital Sun Yat-Sen University, Guangzhou, P.R. China
2Department
Abstract The four single nucleotide polymorphisms (SNPs) rs34517613, rs3849943, rs8141797 and rs6703183, each located in a different gene, have recently been associated with risk of developing sporadic amyotrophic lateral sclerosis (SALS) in European and northern Chinese populations, but no data are yet available for other ethnic groups. Here we explored the possible association between these four SNPs and SALS in Han Chinese primarily from southern and south-western China. A total of 298 individuals with SALS from three centres in mainland China and 486 unrelated healthy controls were recruited. All subjects were successfully genotyped using the ligase detection reaction (LDR). We found no evidence that any of these SNPs are associated with risk of disease in either heterozygous or homozygous individuals (p 0.05). Subgroup analysis based on gender showed a similar lack of association. However, subgroup analysis based on spinal- or bulbar-onset SALS revealed significant differences in the genotype distributions (p 0.009) and minor allele frequencies of rs6703183 (p 0.004). In conclusion, it may be premature to conclude associations between these four SNPs and SALS, which should be examined in additional ethnic groups. Key words: Amyotrophic lateral sclerosis, rs34517613, rs3849943, rs8141797, rs6703183
Introduction Amyotrophic lateral sclerosis (ALS) is a rapidlyprogressing and ultimately fatal neurodegenerative disease characterized by selective loss of upper and lower motor neurons from the spinal cord, brainstem and cerebral cortex (1). ALS is thought to be multifactorial, with both environmental and genetic causes. Recently, the single nucleotide polymorphism (SNP) rs34517613 in the keratin 18 pseudogene 55 (KRT18P55) and the SNP rs3849943 in the chromosome 9 open reading frame 72 gene (C9orf72) have been associated with elevated risk of sporadic ALS (SALS) in European populations (2). In a study conducted with Han Chinese from northern China, the SNP rs8141797 in the sushi domain-containing 2 gene (SUSD2) and the SNP rs6703183 in the calcium/calmodulin-dependent protein kinase IG gene (CAMK1G) were also associated with elevated risk of SALS (3). Since SALS is known to reflect a complex interplay of genetic and environmental factors, we wished
to verify these associations in a different population. Therefore we conducted a relatively large casecontrol study involving nearly 300 patients and nearly 500 controls from northern, south-western and southern China. Patients and methods The study protocol was approved by the ethics committee of Sichuan University and written informed consent was obtained from participants. The study included 298 Han Chinese patients whom two specialists independently diagnosed as having definite or probable SALS based on revised El Escorial criteria. Patients were recruited mainly from outpatient clinics at the First Affiliated Hospital of Sun Yat-sen University in southern China, and West China Hospital of Sichuan University in south-west China. A smaller number of patients were recruited from the Second Affiliated Hospital of Hebei Medical University in northern China. In parallel, 486 unrelated Han Chinese healthy controls were recruited
Correspondence: Y. Xu, Department of Neurology, West China Hospital, Sichuan University, Chengdu, Sichuan Province, 610041, P.R. China. Fax: 86 2885423550. E-mail: [email protected] (Received 6 October 2014; accepted 14 December 2014) ISSN 2167-8421 print/ISSN 2167-9223 online © 2015 Informa Healthcare DOI: 10.3109/21678421.2014.999790
2
R. An et al. Table I. Primers used in ligase detection reactions to genotype polymorphisms potentially linked to sporadic amyotrophic lateral sclerosis in Han Chinese. Gene
Base change
rs34517613
KRT18P55
C T
rs3849943
C9orf72
A G
rs8141797
SUSD2
A G
rs6703183
CAMK1G
C T
Amyotrophic Lateral Sclerosis and Frontotemporal Degeneration Downloaded from informahealthcare.com by University Library Utrecht on 03/13/15 For personal use only.
Polymorphism
LDR product (bp)
Primer CCTGAGGTTAAAATTGAGTGG (F) TTTCTTTTTCCCTGGACACC (R) AATCTAACGATCACTTCTGC (F) CTGTGCTAGAATTTTGGACC (R) TCCAGCAGCACGTACTCTC (F) CTTCGGAGACCCACACTTTG (R) ACTCCCCTACCTCACACATC (F) GTCATAGTCAAGTGGTCAAG (R)
96 89 98 100
CAMK1G: calcium/calmodulin-dependent protein kinase IG gene; C9orf72: chromosome 9 open reading frame 72 gene; F: forward primer; KRT18P55: keratin 18 pseudogene 55 gene; R: reverse primer; SUSD2: sushi domain-containing 2 gene.
from health centres of the three hospitals; the controls were well matched to patients in terms of gender and age. Genomic DNA was extracted from peripheral blood leukocytes using a standard phenol-chloroform method. All four SNPs were successfully genotyped in all subjects using the ligase detection reaction ((4), Table I). Differences in genotype and minor allele frequencies between patients and controls were assessed for significance using the c2 test. The Hardy-Weinberg equilibrium (HWE) calculator (www.genes.org. uk/software/hardy-weinberg.shtml) was used to determine whether the genotype distributions of any of the SNPs deviated from HWE. All statistical tests were performed using SPSS 17.0 (Chicago, IL, USA). Two-tailed p 0.05 was defined as the threshold of significance. Results We analysed the genotype and minor allele frequencies for all four SNPs in 298 SALS patients (153 males; mean age, 53.9 11.8 years; range 24–84 years) and in 486 healthy controls (276 males; mean age, 54.7 11.0 years; range 30–88 years). Allele and genotype distributions for each SNP in both groups showed no significant deviation from HWE. Genotype and minor allele frequencies for the four SNPs showed no significant differences between
patients and controls (Table II). Similarly, subgroup analysis by gender showed no significant differences in genotype distributions or minor allele frequencies between patients and controls for any of the SNPs (Tables III, IV). However, subgroup analysis by spinal- or bulbar-onset SALS revealed significant differences in both genotype distributions and minor allele frequencies at SNP rs6703183 (Table V). Discussion This relatively large SNP study failed to find evidence that the SNPs rs34517613, rs3849943, rs8141797 and rs6703183 are associated with risk of SALS in Han Chinese from three regions of China. These results are inconsistent with previous findings in Europeans and in Han Chinese from the north of the country (2,3). There are probably several factors behind these discrepant findings, one of which is likely to be ethnic differences. For example, the frequency of the minor T allele in rs34517613 is 10.80% among Europeans (2) but only 0.17% in our study of Chinese from different parts of the country. Many casecontrol association studies from various parts of Europe have suggested that hexanucleotide repeat expansion within the first intron of the C9orf72 gene is associated with risk of ALS (5–8). The same expansion appears to contribute little or nothing to risk of ALS in various parts of Asia (5,9–12), including in
Table II. Genotype and minor allele frequencies in Han Chinese patients with sporadic amyotrophic lateral sclerosis (SALS) and healthy controls. Minor allele frequency, n (%)
Genotype frequencies Polymorphism rs34517613 rs3849943 rs8141797 rs6703183
Genotypes
SALS (n 298)
CC/TC/TT AA/GA/GG AA/GA/GG CC/TC/TT
297/1/0 258/39/1 242/54/2 123/135/40
Controls Hardy-Weinberg (n 486) (SALS/control) 485/1/0 426/56/4 377/101/8 217/210/59
0.98/0.98 0.71/0.16 0.59/0.68 0.76/0.46
p
SALS (n 596)
Controls (n 972)
1.000 1 (0.17) 1 (0.10) 0.581 41 (6.88) 64 (6.58) 0.309 58 (9.73) 117 (12.04) 0.635 215 (36.07) 328 (33.74)
p
OR (95% CI)
1.000 0.821 0.159 0.347
0.613 (0.038–9.815) 0.954 (0.636–1.432) 1.269 (0.910–1.770) 0.903 (0.729–1.117)
I: confidence interval; Hardy-Weinberg: Hardy-Weinberg equilibrium coefficient; OR: odds ratio; SALS: sporadic amyotrophic C lateral sclerosis.
Gene polymorphisms and sporadic ALS
3
Table III. Genotype frequencies in Han Chinese with sporadic amyotrophic lateral sclerosis (SALS) and healthy controls, stratified by gender. Male
Amyotrophic Lateral Sclerosis and Frontotemporal Degeneration Downloaded from informahealthcare.com by University Library Utrecht on 03/13/15 For personal use only.
Polymorphism rs34517613 rs3849943 rs8141797 rs6703183
Genotypes
SALS (n 202)
Controls (n 290)
CC/TC/TT AA/GA/GG AA/GA/GG CC/TC/TT
202/0/0 178/23/1 160/40/2 76/102/24
289/1/0 252/34/4 213/72/5 138/116/36
Female SALS (n 96)
Controls (n 196)
1.000 — 95/1/0 0.688 1.118 (0.648–1.930) 80/16/0 0.142 1.377 (0.897–2.113) 82/14/0 0.028a 0.664 (0.461–0.958) 47/33/16
196/0/0 174/20/2 164/29/3 81/93/22
p
OR (95% CI)
p
OR (95% CI)
0.329 — 0.194 0.632 (0.315–1.268) 0.701 1.143 (0.578–2.260) 0.217 1.362 (0.834–2.225)
I: confidence interval; OR: odds ratio; SALS: sporadic amyotrophic lateral sclerosis. C —: Because the genotype ‘TC TT’ at rs34517613 did not occur in any of the males with SALS or in any of the female controls, we cannot calculate the corresponding OR value. a No significant difference after Bonferroni adjustment.
China (13–15). Our finding of no association between another SNP of C9orf72, rs3849943, and risk of SALS extends these previous results, strengthening the argument that genetic variants in the C9orf72 gene do not affect susceptibility of mainland Chinese to SALS. This also strengthens the evidence that genetic determinants of SALS vary significantly between ethnicities. Our findings contradict a previous genetic association study showing that SNPs rs8141797 and rs6703183 are associated with risk of SALS in individuals from northern China (3). While that study analysed a larger group of patients (706) and controls (1777) than we did, we suspect that our contrasting results reflect differences not in statistical
power but in genetic background: the previous study examined only individuals from northern China, whereas we recruited individuals mainly from the south and south-west, together with a smaller number from the north. Although that study and ours involved primarily Han Chinese, this ethnic group can show substantial genetic variation (13–15), presumably due to a long history of intermarriage among genetic subpopulations in the country. It is also possible that our results differ from the previous study in northern China because of differences in environmental exposure. Environmental factors are known to contribute to an increased risk of ALS. For example, lead, mercury, selenium, zinc and copper are environmental risk factors of ALS
Table IV. Minor allele frequencies in Han Chinese with sporadic amyotrophic lateral sclerosis (SALS) and healthy controls, stratified by gender. Minor allele frequency, n (%) Male Polymorphism Genotypes rs34517613 rs3849943 rs8141797 rs6703183
SALS (n 404)
Controls (n 580)
CC/TC/TT 0 (0) 1 (0.17) AA/GA/GG 25 (6.19) 42 (7.24) AA/GA/GG 44 (10.89) 82 (14.14) CC/TC/TT 150 (37.13) 188 (32.41)
p
Female OR (95% CI)
SALS (n 192)
Controls (n 392)
1.000 — 1 (0.52) 0 (0) 0.519 1.183 (0.709–1.975) 16 (8.33) 24 (6.12) 0.134 1.347 (0.912–1.991) 14 (7.29) 35 (8.93) 0.125 0.812 (0.622–1.060) 65 (33.85) 137 (34.95)
p
OR (95% CI)
0.329 — 0.320 0.717 (0.372–1.385) 0.503 1.246 (0.654–2.377) 0.794 1.050 (0.729–1.511)
I: confidence interval; OR: odds ratio; SALS: sporadic amyotrophic lateral sclerosis. C —: Because the genotype ‘TC TT’ at rs34517613 did not occur in any of the males with SALS or in any of the female controls, we can not calculate the corresponding OR value. Table V. Genotype and minor allele frequencies in Han Chinese patients with sporadic amyotrophic lateral sclerosis (SALS), stratified by site of onset. Minor allele frequency, n (%)
Initial symptoms
Polymorphism rs34517613 rs3849943 rs8141797 rs6703183
Genotypes CC/TC/TT AA/GA/GG AA/GA/GG CC/TC/TT
Spinal Bulbar onset onset (n 233) (n 65) 233/0/0 202/30/1 187/44/2 87/110/36
64/1/0 56/9/0 55/10/0 36/25/4
p
OR (95% CI)
Spinal onset (n 466)
0.218 — 0 0.910 1.047 (0.471–2.328) 32 0.426 0.739 (0.350–1.560) 48 0.009 0.480 (0.275–0.837) 182
Bulbar onset (n 130)
(0) 1 (0.77) (6.87) 9 (6.92) (10.3) 10 (7.69) (39.06) 33 (25.39)
p
OR (95% CI)
0.218 0.982 0.375 0.004
— 1.009 (0.469–2.171) 0.726 (0.356–1.477) 0.531 (0.343–0.822)
I: confidence interval; OR: odds ratio; SALS: sporadic amyotrophic lateral sclerosis. C —: Because the genotype ‘TC TT’ at rs34517613 did not occur in any of spinal-onset SALS, we can not calculate the corresponding OR value.
Amyotrophic Lateral Sclerosis and Frontotemporal Degeneration Downloaded from informahealthcare.com by University Library Utrecht on 03/13/15 For personal use only.
4
R. An et al.
(16), and risk of the disease is higher in populations living close to water bodies where cyanobacterial blooms occur and in populations that obtain their domestic water from surface water and shallow wells (17). This may reflect the association between the neurotoxin b-methylamino-l-alanine (BMAA) produced by cyanobacteria and risk of ALS. Given the potential for large differences between northern and southern China in levels of BMAA or heavy metals in drinking water, future studies should examine whether these environmental factors may help explain the significant difference in SNP associations among Han Chinese. We cannot exclude that our negative findings reflect inadequate statistical power which resulted from the limited sample size and/or low risk allele frequency in our study, since the highest power in our study was less than 80%. This highlights the need for larger studies in additional ethnic groups. Our subgroup analysis by gender showed no significant effect of gender on genotype distributions or minor allele frequencies for any of the SNPs in either patients or controls. However, genotype distributions and minor allele frequencies at rs6703183 did differ significantly between patients with spinal- or bulbar-onset SALS (genotypes, p 0.009; minor allele frequencies, p 0.004). However, compared with the control groups, respectively, there were no significant differences (data not shown). There was a literature that indicated specific SNPs seem to be associated with gender, site of onset of sporadic ALS (18). Therefore we suggest that SNP rs6703183 is likely to be more common in patients with spinal-onset SALS than in patients with bulbar-onset disease. In summary, although we failed to find any evidence that SNPs rs34517613, rs3849943, rs8141797 or rs6703183 are associated with risk of SALS in Han Chinese, our data do suggest that the rs6703183 polymorphism may be more common in patients with spinal-onset SALS than in those with bulbaronset disease. Since our sample was relatively small, all these results should be verified and extended in much larger and ethnically diverse study populations. Such work may help clarify not only genetic determinants of the disease but also the relative contributions of genetic and environmental risk factors. Acknowledgements The study was supported by the Sichuan Key Project of Science and Technology and the Sichuan Applied Basic Research of Science and Technology. We thank all the subjects and their families who participated in this study. Declaration of interest: The authors declare no actual or potential conflicts of interest. The authors alone are responsible for the content and writing of the paper.
References 1. Brooks BR, Miller RG, Swash M, Munsat TL. El Escorial revisited: revised criteria for the diagnosis of amyotrophic lateral sclerosis. Amyotroph Lateral Scler Other Motor Neuron Disord. 2000;1:293–9. 2. Fogh I, Ratti A, Gellera C, Lin K, Tiloca C, Moskvina V, et al. A genome-wide association meta-analysis identifies a novel locus at 17q11.2 associated with sporadic amyotrophic lateral sclerosis. Hum Mol Genet. 2014;23:2220–31. 3. Deng M, Wei L, Zuo X, Tian YH, Xie F, Hu PP, et al. Genome-wide association analyses in Han Chinese identify two new susceptibility loci for amyotrophic lateral sclerosis. Nat Genet. 2013;45:697–700. 4. Thomas G, Sinville R, Sutton S, Farquar H, Hammer RP, Soper SA, et al. Capillary and microelectrophoretic separations of ligase detection reaction products produced from low-abundant point mutations in genomic DNA. Electrophoresis. 2004;25:1668–77. 5. Sabatelli M, Conte A, Zollino M. Clinical and genetic heterogeneity of amyotrophic lateral sclerosis. Clin Genet. 2013;83:408–6. 6. Smith BN, Newhouse S, Shatunov A, Vance C, Topp S, Johnson L, et al. The C9orf72 expansion mutation is a common cause of ALS/–FTD in Europe and has a single founder. Eur J Hum Genet. 2013;21:102–8. 7. Mok KY, Koutsis G, Schottlaender LV, Polke J, Panas M, Houlden H. High frequencies of the expanded C9orf72 hexanucleotide repeat in familial and sporadic Greek ALS patients. Neurobiol Aging. 2012;33:1851,e1–5. 8. Renton AE, Majounie E, Waite A, Simon-Sanchez J, Rollinson S, Gibbs JR, et al. A hexanucleotide repeat expansion in C9orf72 is the cause of chromosome 9p21-linked ALS-FTD. Neuron. 2011;72:257–68. 9. Tomiyama H. C9orf72 in Japanese amyotrophic lateral sclerosis (ALS). Rinsho, Shinkeiqaku. 2013;53:1074–6. 10. Alavi A, Nafissi S, Rohani M, Shahidi G, Zamani B, Shamshiri H, et al. Repeat expansion in C9orf72 is not a major cause of amyotrophic lateral sclerosis among Iranian patients. Neurobiol Aging. 2014;35:267,e1–7. 11. Jang JH, Kwon MJ, Choi WJ, Oh KW, Koh SH, Ki CS, et al. Analysis of the C9orf72 hexanucleotide repeat expansion in Korean patients with familial and sporadic amyotrophic lateral sclerosis. Neurobiol Aging. 2013;34:1311,e7–9. 12. Oqaki K, Li Y, Atsuta N, Tomiyama H, Funayama M, Watanabe H, et al. Analysis of C9orf72 repeat expansion in 563 Japanese patients with amyotrophic lateral sclerosis. Neurobiol Aging. 2012;33:2527,e11–6. 13. Zou ZY, Li XG, Liu MS, Cui LY. Screening for C9orf72 repeat expansions in Chinese amyotrophic lateral sclerosis patients. Neurobiol Aging. 2013;34:1710,e5–6. 14. Liu R, Tang L, Cai B, Liu X, Ye X, Ma Y, et al. C9orf72 repeat expansions are not detected in Chinese patients with familial ALS. Amyotroph Lateral Scler Frontotemporal Degener. 2013;14:630–1. 15. Tsai CP, Soong BW, Tu PH, Lin KP, Fuh JL, Tsai PC, et al. A hexanucleotide repeat expansion in C9orf72 causes familial and sporadic ALS in Taiwan. Neurobiol Aging. 2012;33: 2232.e11–2232. 16. Trojsi F, Monsurro MR, Tedeschi G. Exposure to Environmental Toxicants and Pathogenesis of Amyotrophic Lateral Sclerosis: State of the Art and Research Perspectives. Int J Mol Sci. 2013;14:15286–311. 17. Bradley WG, Borenstein AR, Nelson LM, Codd GA, Rosen BH, Stommel EW, et al. Is exposure to cyanobacteria an environmental risk factor for amyotrophic lateral sclerosis and other neurodegenerative diseases? Amyotroph Lateral Scler Frontotemporal Degener. 2013;14:325–33. 18. Dunckley T, Huentelman MJ, Craiq DW, Pearson JV, Szelinger S, Joshipura K, et al. Whole-genome analysis of sporadic amyotrophic lateral sclerosis. N Engl J Med. 2007; 357:775–88.
