RESEARCH ARTICLE
NMDA Receptor Antagonist Attenuates Bleomycin-Induced Acute Lung Injury Yang Li1, Yong Liu1, XiangPing Peng1, Wei Liu1,3, FeiYan Zhao1, DanDan Feng1, JianZhong Han1, YanHong Huang1, SiWei Luo4, Lian Li1, Shao Jie Yue2, QingMei Cheng1, XiaoTing Huang1, ZiQiang Luo1* 1 Department of Physiology, Xiangya School of Medicine, Central South University, Changsha, Hunan, China, 2 Department of Pediatrics, Xiangya Hospital, Central South University, Changsha, Hunan, China, 3 Xiangya Nursing School, Central South University, Changsha, Hunan, China, 4 Xiangya School of Medicine, Central South University, Changsha, Hunan, China
a11111
* [email protected]
Abstract OPEN ACCESS Citation: Li Y, Liu Y, Peng X, Liu W, Zhao F, Feng D, et al. (2015) NMDA Receptor Antagonist Attenuates Bleomycin-Induced Acute Lung Injury. PLoS ONE 10(5): e0125873. doi:10.1371/journal.pone.0125873 Academic Editor: Bernhard Ryffel, French National Centre for Scientific Research, FRANCE Received: January 5, 2015 Accepted: March 26, 2015 Published: May 5, 2015 Copyright: © 2015 Li et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper. Funding: Funding from the National Natural Science Foundation of China (http://www.nsfc.gov.cn/) grant numbers 81270121, 30870916, 81100057; China Hnan Provincial Science & Technology Department, Provincial Natural Science Foundation of Hunan (http://www.hnst.gov.cn/zxgz/zkjj/) grant number 12JJ2049; the Education Department of Hunan Province, Innovation Fund for Institution of Higher Education of Hunan Province (http://gov.hnedu.cn/ index.html) grant number 11K076; and Central South University, The Open-End Fund for the Valuable and Precision Instrument of Central South University
Background Glutamate is a major neurotransmitter in the central nervous system (CNS). Large amount of glutamate can overstimulate N-methyl-D-aspartate receptor (NMDAR), causing neuronal injury and death. Recently, NMDAR has been reported to be found in the lungs. The aim of this study is to examine the effects of memantine, a NMDAR channel blocker, on bleomycininduced lung injury mice.
Methods C57BL/6 mice were intratracheally injected with bleomycin (BLM) to induce lung injury. Mice were randomized to receive saline, memantine (Me), BLM, BLM plus Me. Lungs and BALF were harvested on day 3 or 7 for further evaluation.
Results BLM caused leukocyte infiltration, pulmonary edema and increase in cytokines, and imposed significant oxidative stress (MDA as a marker) in lungs. Memantine significantly mitigated the oxidative stress, lung inflammatory response and acute lung injury caused by BLM. Moreover, activation of NMDAR enhances CD11b expression on neutrophils.
Conclusions Memantine mitigates oxidative stress, lung inflammatory response and acute lung injury in BLM challenged mice.
PLOS ONE | DOI:10.1371/journal.pone.0125873 May 5, 2015
1 / 14
Memantine Attenuates Bleomycin-Induced Acute Lung Injury
(http://www.csu.edu.cn/) grant number 2012-02,201212. The funders had no role in design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist.
Introduction The development and progression of many acute and chronic lung disorders are associated with excessive or unresolved inflammation, which can result in cell injury and other pathological consequences. Bleomycin (BLM) is widely used to induce acute lung injury (ALI) and fibrosis in murine models. Intranasal administration of BLM leads to the early stage of inflammatory response and the late stage of collagen deposition. The pathological alterations include injuries of alveolar epithelial cells (AECs) and vascular endothelial cells (VECs), alveolar neutrophilic recruitment, and up-regulation of pro-inflammatory cytokines [1–3]. Furthermore, it is well known that activated and accumulated inflammatory cells in the lungs release toxic reactive oxygen species (ROS) that leading to lung injury [4]. Glutamate (Glu) is the main excitatory neurotransmitter in the central nervous system (CNS). Under pathological conditions, extracellular glutamate concentrations are increased by abnormal release and/or clearance. This causes overstimulation of glutamate receptors, resulting in neuronal injury or death, known as excitotoxicity [5]. Glutamate neurotoxicity plays an important role in many neurological disorders [6]. The functions of glutamate and its receptors have been well-characterized in the central nervous system. N-methyl-D-aspartate (NMDA) receptors (NMDARs) are the principal receptors in mediating Glu neurotoxicity [7]. It has been reported that NMDAR presents in non-neuronal tissues and cells, including kidney, lung, urogenital tract, pancreatic β cells, and blood vessels [8–11]. Functional NMDARs are expressed on mononuclear leukocytes, neutrophils and alveolar macrophages [12–14]. NMDAR activation leads to increased recruitment of mononuclear leukocytes, neutrophils and macrophage in retina and striatum [15], and up-regulation of neutrophils activation [16]. Similar to neurons, mononuclear leukocytes and neutrophils can release glutamate, which can further exacerbate blood brain-barrier-injury [12, 13]. Several lines of evidence indicate that NMDARs play an important role in regulating inflammation in neuronal and non-neuronal cells and tissues, such as chronic morphine-induced neuroinflammation, retinal damage, arthritis and cardiac inflammation [15, 17–19]. Activation of NMDA receptors can induce acute high-permeability edema in isolated rat lungs [20]. Our previous work also showed that Glu (0.5g/kg, ip) in vivo provoked acute lung injury [21] and NMDAR antagonist MK-801 attenuated hyperoxia induced lung injury [22]. BLM, a chemotherapeutic drug used clinically for treatment of a variety of human malignancies, has been shown to induce, at the high doses, lung injury and pulmonary fibrosis in patients [23]. Therefore, BLM is used widely as an agent to induce experimental lung fibrosis in rodents [24]. Intratracheally administration of BLM causes acute lung inflammation during the first week and pulmonary fibrosis in the second and third week post BLM [25]. It was demonstrated that treatment with dexamethasone in the first three days after BLM challenge prevented the development of BLM induced fibrosis [26]. This indicates that the acute inflammation reaction plays a major role in the development of pulmonary fibrosis induced by BLM. Although there have been reported that, NMDARs play an important role in allergic, heat, LPS and hyperoxia-induced acute lung injury [22, 27–30], the role of NMDARs in BLM induced-lung injury remains unclear. In order to investigate the mechanism of BLM-induced lung injury, we hypothesize that activation of NMDAR mediates BLM-induced acute lung injury, and that blocking NMDAR could attenuate lung injury. Our results showed that NMDAR antagonist memantine attenuated BLM-induced early inflammation and suggested that memantine may protect lungs from BLM-induced fibrosis.
PLOS ONE | DOI:10.1371/journal.pone.0125873 May 5, 2015
2 / 14
Memantine Attenuates Bleomycin-Induced Acute Lung Injury
Materials and Methods Ethics statement The Ethics Committee of Institute of Clinical Pharmacology at Central South University (Changsha, China) approved the experiments, which were performed in accordance with the guidelines of National Institutes of Health. Before surgeries, mice were anesthetized with chloral hydrate (400mg/kg given i.p.), and necessary efforts were taken to minimize suffering.
Animal model and experimental design Female C57BL/6 mice, weighting 18–20 g, were purchased from JingDa Laboratory Animal Company (Changsha, China) and were maintained in 12-hour light, 12-hour dark cycles with free access to food and water in accordance with guidelines from the Committee on Research Animal Welfare of Central South University, Changsha, China. Mice were randomly divided into four groups: (1)intratracheal saline plus intraperitoneal saline (Con); (2)intratracheal saline plus memantine (Me, 10mg/kg/day); (3)intratracheal bleomycine (BLM, 5mg/kg) plus intraperitoneal saline (BLM); (4)intratracheal BLM plus memantine (BLM+Me). After being anesthetized, mice were intratracheally injected with 5mg/kg bleomycin (Tokyo, Japan) in 50 μl saline on Day 0. Memantine (Sigma, St. Louis, MO) was administered intraperitoneally every day from Day 0. At 3 or 7days, animals were sacrificed under anesthesia and exsanguination. BALF and lung tissues were collected for the following assays. Total 320 mice were used in experiments.
Histological analysis The left lobe from non-lavaged lung was fixed with 4% paraformaldehyde in phosphate-buffered saline for 24 h and then embedded in paraffin. Five-micron thick sections were stained with Hematoxylin Eosin (HE). Alveolitis was determined with the H&E stained sections according to previously published criteria [31]. Briefly, inflammatory infiltration and the area of involved lesions of lung sections were graded: grade 0, normal tissue; grade 1, (50% of the slide). The mean score from all examined fields was calculated as the inflammation score (IS).
Wet/Dry weight ratio assay The lungs were collected and weighed before and after being dried in the incubator at 60C, for 72 h.
Bronchoalveolar lavage The mice were anesthetized and a plastic cannula was inserted into the trachea. Lavage was performed with a 0.8 ml of 0.9% saline solution. This procedure was repeated three times. The bronchoalveolar lavage fluid (BALF) samples were centrifuged, and the cell pellets were resuspended in PBS and the supernatant were stored at -80°C for further research.
Glutamate concentration in the BALF The concentration of glutamate in BALF from Day 3 was measured by OPA-FMOC-CL precolumn derivatization high performance liquid chromatography (HPLC) (G4212A, Agilent 1290, U.S.A.) using ultraviolet detection. Two microliters of BALF, 5μl Borate saline buffer were mixed and reacted for 0.2min at room temperature. Then a 1μl OPA solution and a 1μl FMOC-CL solution were added into the mixture and mixed. Then a 4μl aliquot of the reaction
PLOS ONE | DOI:10.1371/journal.pone.0125873 May 5, 2015
3 / 14
Memantine Attenuates Bleomycin-Induced Acute Lung Injury
mixture was injected into the HPLC system. The separation was performed on a Aglient Zorbax AAA column (5μm, 4.6×150mm) with the mobile phase of 20mmol•L-1sodium acetate buffer (PH 7.2), 100μl Triethylamine and 2.5ml tetrahydrofuran (phase A) and a mixture of V: V:V = 1:2:2, 20mmol•L-1sodium acetate buffer(PH 7.2), Acetonitrile and Methyl alcohol (phase B). The analysis was performed with a linear gradient from A:B (99.5:0.5) to 45% B within 25min; 100% B within 26.1min; then eluted with 100% B for 30min to elute other components. The flow rate was set to 200μl/min. The signal A and signal B wave lengths were 338nm and 262nm, respectively. The concentration of glutamate in BALF of Day 7 was measured using a commercially available kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).
Real-time PCR Total RNA was extracted from whole lung with Trizol reagent (Invitrogen, USA), and the synthesis of the cDNA was performed with random hexamers. The primers were used as following, IL-1β (forward primer, 5’-GCCCATCCTCTGTGACTCAT-3’, reverse primer, 5’AGGCCACAGGTATTTTGTCG-3’), β-actin(forward primer,5’- GGCTGTATTCCCCTCCAT3’, reverse primer,5’-CCAGTTGGTAACAATGCCATGT-3’), TNFα (forward primer, 5’ACAGCAAGGGACTAGCCAGGAG-3’, reverse primer, 5’- GGAGTGCCTCTTCTGCCAGTTC3’), IL-10 (forward primer, 5’-GGGTTGCCAAGCCTTATCGGAA-3’, reverse primer, 5’CTGCTCCACTGCCTTGCTCTTA-3’). A SYBR Green quantitative PCR was done on Bio-Rad real-time PCR system. Each experiment was performed in duplicate and repeated three times.
Preparation of lung tissue for biochemical analyses Oxidative stress was evaluated by detecting lung homogenate levels of malondialdehyde (MDA). The MDA concentrations were determined by measurement of thiobarbituric acid (TBA) reactivity according to commercially available kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). TBA was added into lung homogenate, and the mixture was centrifuged. The supernatant was obtained then measured at 532nm with a spectrophotometer. Neutrophil accumulation was determined by myeloperoxidase (MPO) activity of lung homogenate. The assay of MDA and MPO were performed following the instructions of the detection kits (Jiancheng Biotech, Nanjing, China).
Pulmonary vascular permeability Mice were sacrificed on Day 3. Evans blue dye (20 mg/kg) in 250 μl of 0.9% saline was infused into tail vein and allowed to circulate for 60 min. BALF were collected and centrifuged at 14,000 ×g revolution/min for 20 min at 4°C, then the supernatant was removed to measure the optical density at 620 nm.
ELISA An enzyme-linked immunosorbent assay (ELISA) was used to detect concentrations of the cytokines tumor necrosis factor alpha (TNFα), interleukin-1 beta (IL-1β) and interleukin-10 (IL10) in lungs. The lungs were homogenized in phosphate-buffered saline (PBS, pH 7.4), and centrifuged at 10,000×g to removed insoluble debris. The supernatants were assayed with ELISA kit according to the manufacturer’s instructions (CUSABIO, China).
PLOS ONE | DOI:10.1371/journal.pone.0125873 May 5, 2015
4 / 14
Memantine Attenuates Bleomycin-Induced Acute Lung Injury
CD11b expression on neutrophils NMDA was added into 100 μl anticoagulated whole peripheral blood to a final concentration of 10-6 M, and then the mixture was further incubated for 4 h. Fluorescein isothiocyanate (FITC)-conjugated mouse anti-human CD11b antibody (Biolegend) was added and the mixture was incubated on ice for 30 min. Neutrophils were obtained from the whole peripheral blood and the cells were washed twice in PBS containing 0.2% BSA. The histograms were acquired on a FACS Calibur instrument using CELLQUEST software (Becton Dickinson).
Statistics Comparisons were made by using one-way analysis of variance followed by the StudentNewman-Keuls (SNK) test for multiple comparisons or the nonparametric test (Mann-Whitney U test), depending on the distribution of the data. P
NMDA Receptor Antagonist Attenuates Bleomycin-Induced Acute Lung Injury Yang Li1, Yong Liu1, XiangPing Peng1, Wei Liu1,3, FeiYan Zhao1, DanDan Feng1, JianZhong Han1, YanHong Huang1, SiWei Luo4, Lian Li1, Shao Jie Yue2, QingMei Cheng1, XiaoTing Huang1, ZiQiang Luo1* 1 Department of Physiology, Xiangya School of Medicine, Central South University, Changsha, Hunan, China, 2 Department of Pediatrics, Xiangya Hospital, Central South University, Changsha, Hunan, China, 3 Xiangya Nursing School, Central South University, Changsha, Hunan, China, 4 Xiangya School of Medicine, Central South University, Changsha, Hunan, China
a11111
* [email protected]
Abstract OPEN ACCESS Citation: Li Y, Liu Y, Peng X, Liu W, Zhao F, Feng D, et al. (2015) NMDA Receptor Antagonist Attenuates Bleomycin-Induced Acute Lung Injury. PLoS ONE 10(5): e0125873. doi:10.1371/journal.pone.0125873 Academic Editor: Bernhard Ryffel, French National Centre for Scientific Research, FRANCE Received: January 5, 2015 Accepted: March 26, 2015 Published: May 5, 2015 Copyright: © 2015 Li et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper. Funding: Funding from the National Natural Science Foundation of China (http://www.nsfc.gov.cn/) grant numbers 81270121, 30870916, 81100057; China Hnan Provincial Science & Technology Department, Provincial Natural Science Foundation of Hunan (http://www.hnst.gov.cn/zxgz/zkjj/) grant number 12JJ2049; the Education Department of Hunan Province, Innovation Fund for Institution of Higher Education of Hunan Province (http://gov.hnedu.cn/ index.html) grant number 11K076; and Central South University, The Open-End Fund for the Valuable and Precision Instrument of Central South University
Background Glutamate is a major neurotransmitter in the central nervous system (CNS). Large amount of glutamate can overstimulate N-methyl-D-aspartate receptor (NMDAR), causing neuronal injury and death. Recently, NMDAR has been reported to be found in the lungs. The aim of this study is to examine the effects of memantine, a NMDAR channel blocker, on bleomycininduced lung injury mice.
Methods C57BL/6 mice were intratracheally injected with bleomycin (BLM) to induce lung injury. Mice were randomized to receive saline, memantine (Me), BLM, BLM plus Me. Lungs and BALF were harvested on day 3 or 7 for further evaluation.
Results BLM caused leukocyte infiltration, pulmonary edema and increase in cytokines, and imposed significant oxidative stress (MDA as a marker) in lungs. Memantine significantly mitigated the oxidative stress, lung inflammatory response and acute lung injury caused by BLM. Moreover, activation of NMDAR enhances CD11b expression on neutrophils.
Conclusions Memantine mitigates oxidative stress, lung inflammatory response and acute lung injury in BLM challenged mice.
PLOS ONE | DOI:10.1371/journal.pone.0125873 May 5, 2015
1 / 14
Memantine Attenuates Bleomycin-Induced Acute Lung Injury
(http://www.csu.edu.cn/) grant number 2012-02,201212. The funders had no role in design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist.
Introduction The development and progression of many acute and chronic lung disorders are associated with excessive or unresolved inflammation, which can result in cell injury and other pathological consequences. Bleomycin (BLM) is widely used to induce acute lung injury (ALI) and fibrosis in murine models. Intranasal administration of BLM leads to the early stage of inflammatory response and the late stage of collagen deposition. The pathological alterations include injuries of alveolar epithelial cells (AECs) and vascular endothelial cells (VECs), alveolar neutrophilic recruitment, and up-regulation of pro-inflammatory cytokines [1–3]. Furthermore, it is well known that activated and accumulated inflammatory cells in the lungs release toxic reactive oxygen species (ROS) that leading to lung injury [4]. Glutamate (Glu) is the main excitatory neurotransmitter in the central nervous system (CNS). Under pathological conditions, extracellular glutamate concentrations are increased by abnormal release and/or clearance. This causes overstimulation of glutamate receptors, resulting in neuronal injury or death, known as excitotoxicity [5]. Glutamate neurotoxicity plays an important role in many neurological disorders [6]. The functions of glutamate and its receptors have been well-characterized in the central nervous system. N-methyl-D-aspartate (NMDA) receptors (NMDARs) are the principal receptors in mediating Glu neurotoxicity [7]. It has been reported that NMDAR presents in non-neuronal tissues and cells, including kidney, lung, urogenital tract, pancreatic β cells, and blood vessels [8–11]. Functional NMDARs are expressed on mononuclear leukocytes, neutrophils and alveolar macrophages [12–14]. NMDAR activation leads to increased recruitment of mononuclear leukocytes, neutrophils and macrophage in retina and striatum [15], and up-regulation of neutrophils activation [16]. Similar to neurons, mononuclear leukocytes and neutrophils can release glutamate, which can further exacerbate blood brain-barrier-injury [12, 13]. Several lines of evidence indicate that NMDARs play an important role in regulating inflammation in neuronal and non-neuronal cells and tissues, such as chronic morphine-induced neuroinflammation, retinal damage, arthritis and cardiac inflammation [15, 17–19]. Activation of NMDA receptors can induce acute high-permeability edema in isolated rat lungs [20]. Our previous work also showed that Glu (0.5g/kg, ip) in vivo provoked acute lung injury [21] and NMDAR antagonist MK-801 attenuated hyperoxia induced lung injury [22]. BLM, a chemotherapeutic drug used clinically for treatment of a variety of human malignancies, has been shown to induce, at the high doses, lung injury and pulmonary fibrosis in patients [23]. Therefore, BLM is used widely as an agent to induce experimental lung fibrosis in rodents [24]. Intratracheally administration of BLM causes acute lung inflammation during the first week and pulmonary fibrosis in the second and third week post BLM [25]. It was demonstrated that treatment with dexamethasone in the first three days after BLM challenge prevented the development of BLM induced fibrosis [26]. This indicates that the acute inflammation reaction plays a major role in the development of pulmonary fibrosis induced by BLM. Although there have been reported that, NMDARs play an important role in allergic, heat, LPS and hyperoxia-induced acute lung injury [22, 27–30], the role of NMDARs in BLM induced-lung injury remains unclear. In order to investigate the mechanism of BLM-induced lung injury, we hypothesize that activation of NMDAR mediates BLM-induced acute lung injury, and that blocking NMDAR could attenuate lung injury. Our results showed that NMDAR antagonist memantine attenuated BLM-induced early inflammation and suggested that memantine may protect lungs from BLM-induced fibrosis.
PLOS ONE | DOI:10.1371/journal.pone.0125873 May 5, 2015
2 / 14
Memantine Attenuates Bleomycin-Induced Acute Lung Injury
Materials and Methods Ethics statement The Ethics Committee of Institute of Clinical Pharmacology at Central South University (Changsha, China) approved the experiments, which were performed in accordance with the guidelines of National Institutes of Health. Before surgeries, mice were anesthetized with chloral hydrate (400mg/kg given i.p.), and necessary efforts were taken to minimize suffering.
Animal model and experimental design Female C57BL/6 mice, weighting 18–20 g, were purchased from JingDa Laboratory Animal Company (Changsha, China) and were maintained in 12-hour light, 12-hour dark cycles with free access to food and water in accordance with guidelines from the Committee on Research Animal Welfare of Central South University, Changsha, China. Mice were randomly divided into four groups: (1)intratracheal saline plus intraperitoneal saline (Con); (2)intratracheal saline plus memantine (Me, 10mg/kg/day); (3)intratracheal bleomycine (BLM, 5mg/kg) plus intraperitoneal saline (BLM); (4)intratracheal BLM plus memantine (BLM+Me). After being anesthetized, mice were intratracheally injected with 5mg/kg bleomycin (Tokyo, Japan) in 50 μl saline on Day 0. Memantine (Sigma, St. Louis, MO) was administered intraperitoneally every day from Day 0. At 3 or 7days, animals were sacrificed under anesthesia and exsanguination. BALF and lung tissues were collected for the following assays. Total 320 mice were used in experiments.
Histological analysis The left lobe from non-lavaged lung was fixed with 4% paraformaldehyde in phosphate-buffered saline for 24 h and then embedded in paraffin. Five-micron thick sections were stained with Hematoxylin Eosin (HE). Alveolitis was determined with the H&E stained sections according to previously published criteria [31]. Briefly, inflammatory infiltration and the area of involved lesions of lung sections were graded: grade 0, normal tissue; grade 1, (50% of the slide). The mean score from all examined fields was calculated as the inflammation score (IS).
Wet/Dry weight ratio assay The lungs were collected and weighed before and after being dried in the incubator at 60C, for 72 h.
Bronchoalveolar lavage The mice were anesthetized and a plastic cannula was inserted into the trachea. Lavage was performed with a 0.8 ml of 0.9% saline solution. This procedure was repeated three times. The bronchoalveolar lavage fluid (BALF) samples were centrifuged, and the cell pellets were resuspended in PBS and the supernatant were stored at -80°C for further research.
Glutamate concentration in the BALF The concentration of glutamate in BALF from Day 3 was measured by OPA-FMOC-CL precolumn derivatization high performance liquid chromatography (HPLC) (G4212A, Agilent 1290, U.S.A.) using ultraviolet detection. Two microliters of BALF, 5μl Borate saline buffer were mixed and reacted for 0.2min at room temperature. Then a 1μl OPA solution and a 1μl FMOC-CL solution were added into the mixture and mixed. Then a 4μl aliquot of the reaction
PLOS ONE | DOI:10.1371/journal.pone.0125873 May 5, 2015
3 / 14
Memantine Attenuates Bleomycin-Induced Acute Lung Injury
mixture was injected into the HPLC system. The separation was performed on a Aglient Zorbax AAA column (5μm, 4.6×150mm) with the mobile phase of 20mmol•L-1sodium acetate buffer (PH 7.2), 100μl Triethylamine and 2.5ml tetrahydrofuran (phase A) and a mixture of V: V:V = 1:2:2, 20mmol•L-1sodium acetate buffer(PH 7.2), Acetonitrile and Methyl alcohol (phase B). The analysis was performed with a linear gradient from A:B (99.5:0.5) to 45% B within 25min; 100% B within 26.1min; then eluted with 100% B for 30min to elute other components. The flow rate was set to 200μl/min. The signal A and signal B wave lengths were 338nm and 262nm, respectively. The concentration of glutamate in BALF of Day 7 was measured using a commercially available kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).
Real-time PCR Total RNA was extracted from whole lung with Trizol reagent (Invitrogen, USA), and the synthesis of the cDNA was performed with random hexamers. The primers were used as following, IL-1β (forward primer, 5’-GCCCATCCTCTGTGACTCAT-3’, reverse primer, 5’AGGCCACAGGTATTTTGTCG-3’), β-actin(forward primer,5’- GGCTGTATTCCCCTCCAT3’, reverse primer,5’-CCAGTTGGTAACAATGCCATGT-3’), TNFα (forward primer, 5’ACAGCAAGGGACTAGCCAGGAG-3’, reverse primer, 5’- GGAGTGCCTCTTCTGCCAGTTC3’), IL-10 (forward primer, 5’-GGGTTGCCAAGCCTTATCGGAA-3’, reverse primer, 5’CTGCTCCACTGCCTTGCTCTTA-3’). A SYBR Green quantitative PCR was done on Bio-Rad real-time PCR system. Each experiment was performed in duplicate and repeated three times.
Preparation of lung tissue for biochemical analyses Oxidative stress was evaluated by detecting lung homogenate levels of malondialdehyde (MDA). The MDA concentrations were determined by measurement of thiobarbituric acid (TBA) reactivity according to commercially available kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). TBA was added into lung homogenate, and the mixture was centrifuged. The supernatant was obtained then measured at 532nm with a spectrophotometer. Neutrophil accumulation was determined by myeloperoxidase (MPO) activity of lung homogenate. The assay of MDA and MPO were performed following the instructions of the detection kits (Jiancheng Biotech, Nanjing, China).
Pulmonary vascular permeability Mice were sacrificed on Day 3. Evans blue dye (20 mg/kg) in 250 μl of 0.9% saline was infused into tail vein and allowed to circulate for 60 min. BALF were collected and centrifuged at 14,000 ×g revolution/min for 20 min at 4°C, then the supernatant was removed to measure the optical density at 620 nm.
ELISA An enzyme-linked immunosorbent assay (ELISA) was used to detect concentrations of the cytokines tumor necrosis factor alpha (TNFα), interleukin-1 beta (IL-1β) and interleukin-10 (IL10) in lungs. The lungs were homogenized in phosphate-buffered saline (PBS, pH 7.4), and centrifuged at 10,000×g to removed insoluble debris. The supernatants were assayed with ELISA kit according to the manufacturer’s instructions (CUSABIO, China).
PLOS ONE | DOI:10.1371/journal.pone.0125873 May 5, 2015
4 / 14
Memantine Attenuates Bleomycin-Induced Acute Lung Injury
CD11b expression on neutrophils NMDA was added into 100 μl anticoagulated whole peripheral blood to a final concentration of 10-6 M, and then the mixture was further incubated for 4 h. Fluorescein isothiocyanate (FITC)-conjugated mouse anti-human CD11b antibody (Biolegend) was added and the mixture was incubated on ice for 30 min. Neutrophils were obtained from the whole peripheral blood and the cells were washed twice in PBS containing 0.2% BSA. The histograms were acquired on a FACS Calibur instrument using CELLQUEST software (Becton Dickinson).
Statistics Comparisons were made by using one-way analysis of variance followed by the StudentNewman-Keuls (SNK) test for multiple comparisons or the nonparametric test (Mann-Whitney U test), depending on the distribution of the data. P
