G Model MICRES-25635; No. of Pages 6
ARTICLE IN PRESS Microbiological Research xxx (2013) xxx–xxx
Contents lists available at ScienceDirect
Microbiological Research journal homepage: www.elsevier.com/locate/micres
The two-component system NisK/NisR contributes to the virulence of Streptococcus suis serotype 2 Juan Xu a,b , Shulin Fu a,b , Manli Liu c , Qiaoxia Xu a,b , Weicheng Bei a,b , Huanchun Chen a,b , Chen Tan a,b,∗ a
Division of Animal Infectious Disease, State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan, Hubei 430070, China College of Animal Science and Veterinary Medicine, Huazhong Agricultural University, Wuhan, Hubei 430070, China c Center of Bio-Pesticide Engineering Research, Hubei Academy of Agricultural Science, Wuhan, Hubei 430064, China b
a r t i c l e
i n f o
Article history: Received 25 September 2013 Accepted 9 November 2013 Available online xxx Keywords: Streptococcus suis serotype 2 NisKR Virulence
a b s t r a c t Two-component signal-transduction systems (TCSTSs) may regulate some virulence factors in response to external stimuli, and thus allowing Streptococcus suis serotype 2 to interact with the host, promote survival, and cause disease. Here, a mutant of the NisKR TCSTS had attenuated virulence in vitro, as exemplified by lowered hemolytic activity, reduced adherence to epithelial cells, increased elimination by macrophages, and decreased resistance to killing by neutrophils. Results also showed that this system is important for the ability of S. suis serotype 2 to survive and proliferate in an in vivo mouse model. Thus, the NisKR system plays a significant role in pathogenesis, both in colonization and invasive disease. Crown Copyright © 2013 Published by Elsevier GmbH. All rights reserved.
1. Introduction Streptococcus suis serotype 2 is an important swine pathogen, causing arthritis, endocarditis, meningitis, pneumonia, and septicemia (Lun et al., 2007). It is also a major zoonotic agent that can cause life-threatening infections in humans. Two recent largescale outbreaks of S. suis serotype 2 in China were associated with streptococcal toxic shock syndrome, manifesting as acute high fever, multiple organ failure, short course of disease, and high lethality. These outbreaks were of major concern for global public health (Tang et al., 2006). Despite the growing significance of such infections, little is known about the underlying mechanism that this emerging organism has evolved to enhance its pathogenicity. To shed light on the cause of the high virulence of the epidemic outbreak strains of S. suis serotype 2, the complete genomic sequences of two highly virulent S. suis serotype 2 isolates were determined. A novel pathogenicity island (PAI), referred to as 89 K, was identified, and found to be specific to Chinese epidemic strains (Chen et al., 2007). Molecular mechanisms such as quorum sensing, two two-component signal transduction systems (TCSTS), and ABC transporters are often associated with putative PAIs, where they
∗ Corresponding author at: State Key Laboratory of Agricultural Microbiology, Laboratory of Animal Infectious Diseases, College of Animal Science and Veterinary Medicine, Huazhong Agricultural University, Wuhan, Hubei 430070, China. Tel.: +86 27 87288629; fax: +86 27 87282608. E-mail address: [email protected] (C. Tan).
enable the PAI to respond to environmental signals and perform its essential function of contributing to the virulence of the pathogen (Brown et al., 2001; Schmidt and Hensel, 2004; Gal-Mor and Finlay, 2006). Further analysis of 89 K identified two TCSTS. One of which, called SalK/SalR, proved to be essential for full virulence of the highly pathogenic S. suis serotype 2 isolate (Li et al., 2008), while the other appeared to be orthologous to the NisK/NisR system of Lactococcus lactis, a nisin-regulated TCSTS (Kuipers et al., 1995). Two-component systems composed of a membrane-bound sensor protein and a cytoplasmic response regulator are commonly used by bacteria to influence the transcription of specific genes or operons, and to mediate cellular changes in response to environmental stimuli. In the NisK/NisR system, NisK is sensor protein and NisR serves as a response regulator. Recent results have implicated critical roles for these systems in the regulation of a variety of essential processes, including cell-cycle progression, pathogenicity, and developmental pathways (Hoch, 2000). To date, SalK/SalR, CiaRH, Ihk/Irr, VirR/VirS, and two orphan response regulators, RevS and CovR, have been described, all of which have been implicated in the virulence of S. suis serotype 2 (Pan et al., 2009; Wu et al., 2009; Li et al., 2011; Han et al., 2012; Wang et al., 2012). However, the NisK/NisR system has not previously been reported in S. suis serotype 2. In view of the research described above, we assumed that the NisK/NisR TCSTS might be linked to the pathogenicity of S. suis serotype 2. In vivo and in vitro virulence assays using a nisKR deletion mutant confirmed that this TCSTS is important for pathogenesis of S. suis serotype 2.
0944-5013/$ – see front matter. Crown Copyright © 2013 Published by Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.micres.2013.11.002
Please cite this article in press as: Xu J, et al. The two-component system NisK/NisR contributes to the virulence of Streptococcus suis serotype 2. Microbiol Res (2013), http://dx.doi.org/10.1016/j.micres.2013.11.002
G Model MICRES-25635; No. of Pages 6
ARTICLE IN PRESS J. Xu et al. / Microbiological Research xxx (2013) xxx–xxx
2 Table 1 Strains, plasmids and primer used in this study. Strains, plasmids and primers
Description
Source
Bacterial strains S. suis 2 SC19 NisKR E. coli DH5a
Serotype 2, clinical isolated virulent strain, mrp + ef + sly+ The deletion mutant of nisKR with background of SC19 Cloning host for maintaining the recombinant plasmids
This work Promega
Plasmids pSET4s pSET4SnisKR
E. coli–S. suis shuttle vector; replication function of pG + host3 and pUC19, lacZ SpcR A recombinant vector with the background of pSET4s, designed for knockout of nisKR
Takamatsu et al. (2001) This work
Primers
Nucleotide sequence (5 –3 )
Restriction sites
P1 P2 P3 P4 P5 P6 P7 P8 P9 P10
CCCCAAGCTTTAGTCTTCGATTGTCAAAGGG CCCCGTCGACTCTTGGATATCGTAATTTTGAATAC CCCCGTCGACAATTAAATAATATCACAAAATACAAAAT CGCCGGATCCATTCAATTGCTTTTTATTTTAAATC AATCACAATCAGAGAAAAATCATTTT TCAGCGATGCCTTTCTCTA TGCACACTCTTGTTCCAGTA TTCAATTAATCCAATCAAGACACAG CTGACGAGCATCACAAAAATC AAGTAAGTGTAAACCTATTCATTGT
HindIII SalI SalI BamHI
2. Materials and methods
of the highest dilution of supernatant that induced at least 50% lysis of erythrocytes.
2.1. Bacterial strains, plasmids, and growth conditions 2.4. Invasion and adherence assays The bacterial strains and plasmids used in this study are listed in Table 1. S. suis serotype 2 strains were grown in tryptic soy broth (TSB) medium or plated on tryptic-soy agar (TSA) (Difco, Detroit, MI, USA) containing 10% newborn bovine serum (Sijiqing Biological Engineering Materials Co. Ltd., Hangzhou, China). Escherichia coli DH5á was cultured in Luria–Bertani (LB) liquid medium or plated on LB agar. If required, spectinomycin (spc) was added to the plate or broth at the following concentrations: 100 g/ml for S. suis serotype 2, 50 g/ml for E. coli strain DH5á. 2.2. Construction of a NisK/NisR knockout mutant DNA sequences flanking nisKR were amplified from the chromosomal DNA of S. suis SC19 using PCR with two pairs of specific primers (P1/P2 and P3/P4), carrying HindIII/SalI and SalI/BamHI restriction enzyme sites, respectively (Table 1). Digested PCR fragments were directly cloned into a pSET4s vector. This knockout vector, named pSET4s-NisKR, was transformed into SC19 as previously described (Takamatsu et al., 2001). The resultant strains were selected at 28 ◦ C in spectinomycin (100 g/ml), and subsequently passaged at 37 ◦ C in the absence of spectinomycin selection as described by Takamatsu. The suspected mutant was verified by PCR using three pairs of primers: P5/P6 (flanking nisKR), P7/P8 (between nisKR), P9/P10 (a 961-bp fragment part of the SpcR gene in pSET4s).
2.3. Hemolytic activity Hemolysin activity was determined as previously described (Jacobs et al., 1994) with minor modification. Briefly, serial twofold dilutions (150 l) of culture supernatant of the wide-type and the nisKR mutant were prepared in 96-well microplates with 10 mM phosphate-buffered saline (PBS) buffer (PH 7.4) as the diluent. Next, 150 l of 2% sheep red blood cells in phosphate-buffered saline (PBS) were added to each well. The plates were incubated for 2 h at 37 ◦ C, and then centrifuged at 6000 × g for 10 min. Supernatant (150 l) was transferred to a new 96-well plate and the optical density determined at 540 nm using a micro-ELISA reader (Bio-Tek, Synergy, HT). Hemolysin units were determined as the reciprocal
The cell invasion and adherence assays were performed as previously described (Segura and Gottschalk, 2002) with some modifications. Bacteria were centrifuged, washed twice with PBS, and resuspended at 106 CFU/ml in RPMI 1640 medium without antibiotics. Confluent monolayers of Hela cells (CCL-2) grown in 24-well plates were infected at a multiplicity of infection (MOI) of 10 bacteria per cell. The plates were centrifuged at 800 × g for 10 min and incubated in RPMI 1640 medium for 2 h at 37 ◦ C with 5% CO2 . The monolayers were then washed three times with PBS. Gentamycin (100 g/well) and penicillin-G (5 g/well) was added and the plates were incubated for 45 min at 37 ◦ C in 5% CO2 . The monolayers were then washed three times with PBS. Cells were disrupted by pipetting 1 ml sterile deionized water into each well. Serial dilutions of the lysates were plated onto TSB agar to enumerate invading bacteria. To confirm that all the extracellular bacteria were killed by the antibiotic, 200 l of the final PBS wash solution was plated on TSB agar. Total cell-associated bacteria were also quantified as described above but without antibiotic treatment. Adherent bacteria were calculated by subtracting invading bacteria from total bacteria. The results were expressed as the adherence or invasion rate relative to that of the wild-type set as 100%. All assays were performed in triplicate and repeated three times. 2.5. PMN-mediated killing assay Polymorphonuclear leukocytes (PMNs, also called neutrophils) were isolated from heparinized venous blood of healthy piglets by sedimentation in 6% dextran, as previously described (Baltimore et al., 1977). Killing experiments of S. suis serotype 2 by pig PMNs were performed as previously described (Fittipaldi et al., 2008), with minor modifications. Briefly, S. suis serotype 2 in exponential phase were washed and resuspended in RPMI 1640. Bacteria were opsonized in 50% normal pig serum at 37 ◦ C for 30 min and then concentrated to 105 CFU/ml in RPMI 1640. Bacteria (106 ) were mixed with PMNs (105 ) in 96-well plates. For each strain, samples lacking PMNs were served as controls. The mixture was centrifuged at 380 × g for 5 min at 4 ◦ C and incubated for 1 or 2 h at 37 ◦ C under 5% CO2 . Cells were lysed with sterile deionized water and serial dilutions of the lysates were plated on TSB agar. Colonies were
Please cite this article in press as: Xu J, et al. The two-component system NisK/NisR contributes to the virulence of Streptococcus suis serotype 2. Microbiol Res (2013), http://dx.doi.org/10.1016/j.micres.2013.11.002
G Model MICRES-25635; No. of Pages 6
ARTICLE IN PRESS J. Xu et al. / Microbiological Research xxx (2013) xxx–xxx
counted and the percentage of S. suis serotype 2 killed was measured as follows: [1 − (CFUPMN+ /CFUPMN− )] × 100%. All assays were performed in triplicate and repeated three times. 2.6. Bacterial survival following phagocytosis Phagocytosis and intracellular survival assays were performed as described previously (Segura et al., 1998; Olvera et al., 2009), with some modifications. RAW264.7 macrophage cells were seeded in 24-well plates at 106 cells/well. Cells were infected with logphase bacteria at a bacteria-to-cell ration of 10:1 and incubation proceeded for 30 min at 37 ◦ C to allow uptake of bacteria. Then wells were washed three times and RPMI 1640 containing gentamycin (100 g/well) and penicillin-G (5 g/well) was added. Phagocyted bacteria were determined by cells lysis and plating of serial dilutions. At various intervals (1 h or 2 h post antibiotics treatment), wells were washed again with PBS and cells were lysed with 1 ml sterile deionized water and physical disruption by pipetting. Surviving bacteria were counted by plating serial dilutions on TSB agar. The results were expressed as the percentage decrease in the initial number (100%) of viable intracellular bacteria at 1 h and 2 h postinfection time. All assays were performed in triplicate and repeated three times.
3
the experiment. All animal experiments were conducted in strict accordance with the recommendations in the China Regulations for the Administration of Affairs Concerning Experimental Animals (1988) and the Hubei Regulations for the Administration of Affairs Concerning Experimental Animals (2005). 2.8. Analysis of colonization ability Forty-nine 6-week-old female BALB/c mice were divided into two groups and intravenously injected with WT and nisKR S. suis at a dose of 5 × 107 CFU in TSB. Mice infected with sterile TSB were used as controls. At each designated time, three infected and one non-infected mice were sacrificed, and tissues were weighed and homogenized in sterile PBS. The presence of WT or nisKR in blood and organs was determined by plating on TSB agar. 2.9. Statistical analysis All assays were performed in triplicate and repeated at least three times on different days. Where appropriate, data were expressed as mean ± SD. The difference between two groups was analyzed using the Student’s t-test, and survival analysis was carried out using the log-rank test. P values < 0.05 were considered significant and are indicated as *p < 0.05, **p < 0.01, and ***p < 0.001.
2.7. Experimental infections of BALB/c mice 3. Results For virulence studies, six-week-old female specific pathogenfree (SPF) BALB/c mice (10 mice per group) were challenged intraperitoneally with 1 ml of WT or nisKR S. suis at approximately 8 × 108 CFU/ml in TSB. Mice infected with sterile TSB were used as controls. The infected mice were monitored for clinical signs and survival time for 2 weeks. The animals were euthanized at the end of the experimental period or at a particular clinical score during
3.1. Construction and characterization of a NisKR-defective mutant The nisKR knockout mutant was constructed by homologous recombination and the double-crossover event was confirmed by PCR (Fig. 1B). The growth of the mutant strain in TSB containing 10%
Fig. 1. Genomic organization of NisKR in S. suis SC84, and confirmation of the knockout mutant nisKR. (A) Genomic organization of the NisKR locus in S. suis SC84. (B) Confirmation of the nisKR mutant by PCR using primers pairs P5/P6 (flanking nisKR), P7/P8 (between nisKR), P9/P10 (a 961-bp fragment part of the SpcR gene). M1 (2000 bp marker), M2 (15,000 bp marker). (C) Growth curves of the wild-type and nisKR mutant. Bacteria were cultured in TSB containing 10% newborn bovine serum at 37 ◦ C. Absorbance at 600 nm was measured at intervals of 1 h. Results shown are representative of three independent experiments.
Please cite this article in press as: Xu J, et al. The two-component system NisK/NisR contributes to the virulence of Streptococcus suis serotype 2. Microbiol Res (2013), http://dx.doi.org/10.1016/j.micres.2013.11.002
G Model MICRES-25635; No. of Pages 6
ARTICLE IN PRESS J. Xu et al. / Microbiological Research xxx (2013) xxx–xxx
4
Table 2 The viable counts of the wild-type and nisKR mutant (CFU/ml). Time (h)
1 2 3 4 5 6 7 8 9 10 11
nisKR
WT 1#
2#
3#
1#
2#
3#
3.2 × 106 4.3 × 107 5.2 × 108 1.9 × 109 2.0 × 109 2.5 × 109 1.8 × 109 1.6 × 109 1.8 × 109 1.6 × 109 1.3 × 109
3.4 × 106 4.4 × 107 4.6 × 108 2.0 × 109 1.5 × 109 2.7 × 109 2.0 × 109 1.2 × 109 1.3 × 109 1.0 × 109 1.4 × 109
2.5 × 106 3.8 × 107 5.3 × 108 1.3 × 109 1.7 × 109 2.0 × 109 1.6 × 109 1.2 × 109 1.0 × 109 1.3 × 109 1.3 × 109
3.5 × 106 3.6 × 107 4.5 × 108 1.8 × 109 1.1 × 109 1.7 × 109 1.3 × 109 1.2 × 109 2.0 × 109 1.1 × 109 1.0 × 109
3.1 × 106 3.2 × 107 4.2 × 108 1.7 × 109 1.4 × 109 2.2 × 109 1.4 × 109 1.3 × 109 1.4 × 109 1.0 × 109 1.1 × 109
2.7 × 106 3.1 × 107 3.8 × 108 1.4 × 109 1.7 × 109 1.9 × 109 1.6 × 109 1.6 × 109 1.7 × 109 9.0 × 108 1.1 × 109
Fig. 2. Titration of hemolytic activity of S. suis serotype 2 culture supernatants. The horizontal line means the highest dilution of supernatant inducing at least 50% lysis of erythrocytes.
newborn bovine serum showed no significant difference to that of the wild-type (Fig. 1C and Table 2). However, the hemolytic titer of the nisKR mutant was more than twofold lower than that of wild-type (Fig. 2), suggesting that NisKR inactivation would reduce the hemolytic activity of S. suis serotype 2.
3.2. Contribution of NisKR to in vitro adhesion and invasion The results demonstrated that the nisKR mutant displayed significantly less adherence (a 85.4% decrease in adherence) to HeLa cells compared with the wild-type (P < 0.001) (Fig. 3A), indicating a role for NisKR as an important mediator of the cellular adhesion process. Moreover, the invasion capacity of the nisKR mutant was significantly reduced (a 90.9% decrease in invasion) (P < 0.05) (Fig. 3B), suggesting that NisKR may also play a role in S. suis serotype 2 host cell invasion.
Fig. 4. Decreased resistance of nisKR to PMN-mediated killing. Wild-type or mutant strain nisKR were co-incubated, respectively, with PMNs at a bacteriato-cell ration of 10:1. At each time, PMNs were lysed and bacteria were plated on growth agar. Colonies were enumerated and the percent of bacteria killed was calculated. Data are expressed as the mean ± SD of three independent experiments. *** Indicates significance at P < 0.001, * indicates significance at P < 0.05.
3.3. Decreased resistance of nisKR to PMN-mediated killing The results showed that nisKR exhibited a significantly higher mortality rate compared to the wild-type following a 1 h (P < 0.001) and 2 h (P < 0.05) (Fig. 4) incubation, a 19.8% and 4.81% decrease in morality rate, respectively. These results indicated that disruption of NisKR decreases resistance of this pathogen to killing by PMNs. 3.4. Effect of NisKR on phagocytosis by RAW264.7 cells Following co-incubation with RAW264.7 cells for 30 min, a significant higher number of the nisKR mutant compared with the wild type were phagocytosed (P < 0.001) (Fig. 5A). Furthermore, the intracellular survival rate of the nisKR mutant was significantly lower than that of the wild type at 1 h (P < 0.001) and 2 h (P < 0.01) post antibiotics treatment (Fig. 5B). These results indicated that
Fig. 3. Interaction of the two strains with HeLa cells. (A) The nisKR mutant showed reduced levels of adherence to HeLa cells. The results were determined following a 1-h incubation of various S. suis strains with HeLa cells at a MOI of 10, followed by extensive washing of non-adherent bacteria and cell lysis to retrieve 100-l aliquots of total cell-associated bacteria for viable plate counts. Adherent bacteria were calculated by subtracting invading bacteria from total bacteria. The results shown are the means ± SD of three independent experiments. *** Indicates significance at P < 0.001. (B) The ability of nisKR to invade HeLa cells was decreased compared to the wild-type. Gentamycin (100 g/well) and penicillin-G (5 g/well) were added to obtain only intracellular bacteria. The results shown are the means ± SD of three independent experiments. * Indicates significance at P < 0.05.
Please cite this article in press as: Xu J, et al. The two-component system NisK/NisR contributes to the virulence of Streptococcus suis serotype 2. Microbiol Res (2013), http://dx.doi.org/10.1016/j.micres.2013.11.002
G Model MICRES-25635; No. of Pages 6
ARTICLE IN PRESS J. Xu et al. / Microbiological Research xxx (2013) xxx–xxx
5
Fig. 5. Interaction of the wild type and the nisKR mutant with RAW264.7 cells. (A) Phagocytosis of the wild type and the nisKR mutant by RAW264.7 cells after a 30 min infection time. (B) Intracellular survival of the wild type and the nisKR mutant with RAW264.7 cells. The wild-type or mutant strains were incubated with RAW264.7 cells, respectively, at a bacteria-to-cell ratio of 10:1. Phagocytosis proceeded at 37 ◦ C for 30 min and then RPMI 1640 containing gentamycin (100 g/well) and penicillin-G (5 g/well) were added. At different intervals (1 h or 2 h post antibiotic treatment), viable intracellular bacteria were recovered by plating serial dilutions of cell lysis on TSB agar. The results are presented as the mean ± SD of three independent experiments.
deletion of NisKR render S. suis serotype 2 more vulnerable to both phagocytosis and bactericidal activity of RAW264.7 cells. 3.5. Virulence attenuation of the nisKR mutant in a BALB/c mouse model An experimental infection model in mice was designed to assess the role of NisKR in virulence. Almost all mice in the wild-type group presented severe clinical signs of infection, such as weight loss, eyes abscess, rough coat, lethargy, and shivering, within 24 h while the 10 mice challenged with nisKR showed slightly swollen eyes and lethargy (data not shown). Only four animals from the wild-type group survived at day 1 post-infection, and only two animals survived to day 2, while nine of the animals from the nisKR group survived to day 2 post-infection, and had recovered from the infection symptoms by day 5 (Fig. S1). All nine animals challenged with nisKR survived over the 14-day period of observation. Supplementary material related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.micres. 2013.11.002. To better evaluate the virulence attenuation of the nisKR mutant, colonization experiments were performed. As shown in Fig. S2, bacterial counts recovered from heart, lung, brain, and blood of nisKR-infected mice were lower than those of wild-typeinfected mice at each time point. Moreover, nisKR could not be isolated from any of these tissues or blood on days 5 and 6 postinfection, while enormous wild-type strain could still be isolated from blood, heart, and lung throughout the course of the experiment. All of the results strongly suggested the importance of the NisK/NisR system in the pathogenesis of S. suis serotype 2. Supplementary material related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.micres. 2013.11.002. 4. Discussion S. suis serotype 2 is one of the most important swine pathogens, and is an emerging, life-threatening zoonotic agent in both pigs and humans. Development of the disease requires the pathogenic bacteria to efficiently adapt to different niches inside and outside of their host organisms, which is frequently mediated by TCSTSs. Therefore, TCSTSs can be considered prerequisites for bacterial pathogenicity (Mahan et al., 1993; Beier and Gross, 2006). The NisKR TCSTS is located in a putative PAI in S. suis serotype 2 outbreak isolates, wherein another TCSTS SalK/SalR is found to be requisite for the full virulence of S. suis serotype 2 (Li et al., 2008). Therefore, it is necessary to explore the function of the NisKR TCSTS in the pathogenesis of S. suis serotype 2.
In this study, a deletion mutant was constructed to assess the role of NisKR in the pathogenesis of S. suis serotype 2. Results showed that compared with the wild type the mutant strain exhibited decreased hemolytic activity that is often associated with the virulence and pathogenicity of several Gram-positive and Gramnegative bacterial species (Johnson, 1991; Marshall and Ziegler, 1991; Sobel, 1991). More importantly, the nisKR mutant exhibited highly attenuated virulence compared to the wild-type strain in the BALB/c mouse model, which was similar to the results of the deletion of the TCSTS CiaRH, VirR/VirS and IhK/IrR mutant (Li et al., 2011; Han et al., 2012; Wang et al., 2012), indicating definitely that NisKR plays an important role in the virulence of S. suis serotype 2. Outcomes of the mouse experimental infections suggested that the lethality of this pathogen was eliminated by deletion of NisKR. S. suis serotype 2 is considered an important zoonotic pathogen causing infections in humans, pigs and so on, therefore cells originates from different hosts (Lalonde et al., 2000; Pan et al., 2009; Li et al., 2013) were applied to test if NisKR contributed to the virulence of S. suis 2. Bacterial attachments to epithelial cells, colonization of mucosal surfaces, and interaction with respiratory epithelial cells are prerequisites for the induction of streptococcal infection (Lalonde et al., 2000). Polymorphonuclear leukocytes play an important role in host defense system’s response to bacterial infectious (Chabot-Roy et al., 2006), and macrophages could combine potent anti-microbial functions with the ability to induce local inflammation and a systemic immune response (Frankenberg et al., 2008). Pathogens are mainly eliminated through phagocytosis, followed by intracellular digestion. In the present study, we tested the ability of the nisKR mutant to adhere to and invade HeLa cells, and found that both the adherence and invasion ability of the nisKR mutant was greatly decreased. Furthermore, the PMN-mediated killing assay and phagocytosis intracellular survival assays indicated that the nisKR mutant was less able to resist phagocytosis and killing by RAW264.7 cells and PMNs, which resembled the results of the deletion of the TCSTS SalKR, IhKR and CiaRH mutant (Li et al., 2008, 2011; Han et al., 2012). It is reasonable to speculate that deletion of NisKR may cause defects in some surface proteins and consequently lead to more vulnerability of S. suis 2 to both phagocytosis and bactericidal activity of PMNs and RAW264.7 cells or alter production of some bacterial factors that affect normal PMN and RAW264.7 cell function during interaction between bacterium and cells. In addition, in colonization experiments, lower bacterial counts and higher clearance efficiency in tissues of nisKR-infected mice indicated that the ability of nisKR to colonize and thereby survive in vivo was impaired. It could be inferred that this dissemination failure may be partially due to the reduced capacity to adhere to and invade epithelial cells, and the greater susceptibility of the mutant to host immune cells.
Please cite this article in press as: Xu J, et al. The two-component system NisK/NisR contributes to the virulence of Streptococcus suis serotype 2. Microbiol Res (2013), http://dx.doi.org/10.1016/j.micres.2013.11.002
G Model MICRES-25635; No. of Pages 6
ARTICLE IN PRESS J. Xu et al. / Microbiological Research xxx (2013) xxx–xxx
6
Together, our study identified a novel TCSTS NisK/NisR contributing to the virulence of S. suis serotype 2 in both vitro and vivo models of infection, suggesting the important roles of the TCSTS NisK/NisR in the pathogenesis of S. suis serotype 2 infection. Acknowledgments This study was supported by Grants from the National Natural Science Foundation of China (NSFC) (No. 31101844), the National Basic Research Program (also called the 973 Program) (No. 2012CB518803) from the Ministry of Science and Technology of China and the Fundamental Research Funds for the Central Universities. References Baltimore RS, Kasper DL, Baker CJ, Goroff DK. Antigenic specificity of opsonophagocytic antibodies in rabbit anti-sera to group B Streptococci. J Immunol 1977;118(2):673–8. Beier D, Gross R. Regulation of bacterial virulence by two-component systems. Curr Opin Microbiol 2006;9(2):143–52. Brown JS, Gilliland SM, Holden DW. A Streptococcus pneumoniae pathogenicity island encoding an ABC transporter involved in iron uptake and virulence. Mol Microbiol 2001;40(3):572–85. Chabot-Roy G, Willson P, Segura M, Lacouture S, Gottschalk M. Phagocytosis and killing of Streptococcus suis by porcine neutrophils. Microb Pathog 2006;41(1):21–32. Chen C, Tang J, Dong W, et al. A glimpse of streptococcal toxic shock syndrome from comparative genomics of S. suis 2 Chinese isolates. PLoS ONE 2007;2(3):e315. Fittipaldi N, Sekizaki T, Takamatsu D, de la Cruz Domínguez-Punaro M, Harel J, Bui NK, Vollmer W, Gottschalk M. Significant contribution of the pgdA gene to the virulence of Streptococcus suis. Mol Microbiol 2008;70(5):1120–35. Frankenberg T, Kirschne KS, Häcker H, Häcker G. Phagocytosis-induced apoptosis of macrophages is linked to uptake: killing and degradation of bacteria. Eur J Immunol 2008;38(1):204–15. Gal-Mor O, Finlay BB. Pathogenicity islands: a molecular toolbox for bacterial virulence. Cell Microbiol 2006;8(11):1707–19. Han H, Liu C, Wang Q, et al. The two-component system Ihk/Irr contributes to the virulence of Streptococcus suis serotype 2 strain 05ZYH33 through alteration of the bacterial cell metabolism. Microbiology 2012;158(7):1852–66. Hoch JA. Two-component and phosphorelay signal transduction. Curr Opin Microbiol 2000;3(2):165–70. Jacobs AA, Loeffen PL, van den Berg AJ, Storm PK. Identification: purification, and characterization of a thiol-activated hemolysin (suilysin) of Streptococcus suis. Infect Immun 1994;62(5):1742–8.
Johnson JR. Virulence factors in Escherichia coli urinary tract infection. Clin Microbiol Rev 1991;4(1):80–128. Kuipers OP, Beerthuyzen MM, de Ruyter PG, Luesink EJ, de Vos WM. Autoregulation of nisin biosynthesis in Lactococcus lactis by signal transduction. J Biol Chem 1995;270(45):27299–304. Lalonde M, Segura M, Lacouture S, Gottschalk M. Interactions between Streptococcus suis serotype 2 and different epithelial cell lines. Microbiology 2000;146(8):1913–21. Li J, Tan C, Zhou Y, Fu S, Hu L, Hu J, Chen H, Bei W. The two-component regulatory system CiaRH contributes to the virulence of Streptococcus suis 2. Vet Microbiol 2011;148(1):99–104. Li M, Wang C, Feng Y, et al. SalK/SalR, a two-component signal transduction system, is essential for full virulence of highly invasive Streptococcus suis serotype 2. PLoS ONE 2008;3(5):e2080. Li W, Wan Y, Tao Z, Chen H, Zhou R. A novel fibronectin-binding protein of Streptococcus suis serotype 2 contributes to epithelial cell invasion and in vivo dissemination. Vet Microbiol 2013;162(1):186–94. Lun ZR, Wang QP, Chen XG, Li AX, Zhu XQ. Streptococcus suis: an emerging zoonotic pathogen. Lancet Infect Dis 2007;7(3):201–9. Mahan MJ, Slauch JM, Mekalanos JJ. Selection of bacterial virulence genes that are specifically induced in host tissues. Science 1993;259(5095):686–8. Marshall NE, Ziegler HK. Role of bacterial hemolysin production in induction of macrophage Ia expression during infection with Listeria monocytogenes. J Immunol 1991;147(7):2324–32. Olvera A, Ballester M, Nofrarías M, Sibila M, Aragon V. Differences in phagocytosis susceptibility in Haemophilus parasuis strains. Vet Res 2009;40(3):24. Pan X, Ge J, Li M, et al. The orphan response regulator CovR: a globally negative modulator of virulence in Streptococcus suis serotype 2. J Bacteriol 2009;191(8):2601–12. Schmidt H, Hensel M. Pathogenicity islands in bacterial pathogenesis. Clin Microbiol Rev 2004;17(1):14–56. Segura M, Gottschalk M. Streptococcus suis interactions with the murine macrophage cell line J774: adhesion and cytotoxicity. Infect Immun 2002;70(8): 4312–22. Segura MA, Cléroux P, Gottschalk M. Streptococcus suis and group B Streptococcus differ in their interactions with murine macrophages. FEMS Immunol Med Microbiol 1998;21(3):189–95. Sobel JD. Bacterial etiologic agents in the pathogenesis of urinary tract infection. Med Clin North Am 1991;75(2):253–73. Takamatsu D, Osaki M, Sekizaki T. Thermosensitive suicide vectors for gene replacement in Streptococcus suis. Plasmid 2001;46(2):140–8. Tang J, Wang C, Feng Y, et al. Streptococcal toxic shock syndrome caused by Streptococcus suis serotype 2. PLoS Med 2006;3(5):e151. Wang H, Shen X, Zhao Y, Wang M, Zhong Q, Chen T, Hu F, Li M. Identification and proteome analysis of the two-component VirR/VirS system in epidemic Streptococcus suis serotype 2. FEMS Microbiol Lett 2012;333(2):160–8. Wu T, Chang H, Tan C, Bei W, Chen H. The orphan response regulator RevSC21 controls the attachment of Streptococcus suis serotype-2 to human laryngeal epithelial cells and the expression of virulence genes. FEMS Microbiol Lett 2009;292(2):170–81.
Please cite this article in press as: Xu J, et al. The two-component system NisK/NisR contributes to the virulence of Streptococcus suis serotype 2. Microbiol Res (2013), http://dx.doi.org/10.1016/j.micres.2013.11.002
ARTICLE IN PRESS Microbiological Research xxx (2013) xxx–xxx
Contents lists available at ScienceDirect
Microbiological Research journal homepage: www.elsevier.com/locate/micres
The two-component system NisK/NisR contributes to the virulence of Streptococcus suis serotype 2 Juan Xu a,b , Shulin Fu a,b , Manli Liu c , Qiaoxia Xu a,b , Weicheng Bei a,b , Huanchun Chen a,b , Chen Tan a,b,∗ a
Division of Animal Infectious Disease, State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan, Hubei 430070, China College of Animal Science and Veterinary Medicine, Huazhong Agricultural University, Wuhan, Hubei 430070, China c Center of Bio-Pesticide Engineering Research, Hubei Academy of Agricultural Science, Wuhan, Hubei 430064, China b
a r t i c l e
i n f o
Article history: Received 25 September 2013 Accepted 9 November 2013 Available online xxx Keywords: Streptococcus suis serotype 2 NisKR Virulence
a b s t r a c t Two-component signal-transduction systems (TCSTSs) may regulate some virulence factors in response to external stimuli, and thus allowing Streptococcus suis serotype 2 to interact with the host, promote survival, and cause disease. Here, a mutant of the NisKR TCSTS had attenuated virulence in vitro, as exemplified by lowered hemolytic activity, reduced adherence to epithelial cells, increased elimination by macrophages, and decreased resistance to killing by neutrophils. Results also showed that this system is important for the ability of S. suis serotype 2 to survive and proliferate in an in vivo mouse model. Thus, the NisKR system plays a significant role in pathogenesis, both in colonization and invasive disease. Crown Copyright © 2013 Published by Elsevier GmbH. All rights reserved.
1. Introduction Streptococcus suis serotype 2 is an important swine pathogen, causing arthritis, endocarditis, meningitis, pneumonia, and septicemia (Lun et al., 2007). It is also a major zoonotic agent that can cause life-threatening infections in humans. Two recent largescale outbreaks of S. suis serotype 2 in China were associated with streptococcal toxic shock syndrome, manifesting as acute high fever, multiple organ failure, short course of disease, and high lethality. These outbreaks were of major concern for global public health (Tang et al., 2006). Despite the growing significance of such infections, little is known about the underlying mechanism that this emerging organism has evolved to enhance its pathogenicity. To shed light on the cause of the high virulence of the epidemic outbreak strains of S. suis serotype 2, the complete genomic sequences of two highly virulent S. suis serotype 2 isolates were determined. A novel pathogenicity island (PAI), referred to as 89 K, was identified, and found to be specific to Chinese epidemic strains (Chen et al., 2007). Molecular mechanisms such as quorum sensing, two two-component signal transduction systems (TCSTS), and ABC transporters are often associated with putative PAIs, where they
∗ Corresponding author at: State Key Laboratory of Agricultural Microbiology, Laboratory of Animal Infectious Diseases, College of Animal Science and Veterinary Medicine, Huazhong Agricultural University, Wuhan, Hubei 430070, China. Tel.: +86 27 87288629; fax: +86 27 87282608. E-mail address: [email protected] (C. Tan).
enable the PAI to respond to environmental signals and perform its essential function of contributing to the virulence of the pathogen (Brown et al., 2001; Schmidt and Hensel, 2004; Gal-Mor and Finlay, 2006). Further analysis of 89 K identified two TCSTS. One of which, called SalK/SalR, proved to be essential for full virulence of the highly pathogenic S. suis serotype 2 isolate (Li et al., 2008), while the other appeared to be orthologous to the NisK/NisR system of Lactococcus lactis, a nisin-regulated TCSTS (Kuipers et al., 1995). Two-component systems composed of a membrane-bound sensor protein and a cytoplasmic response regulator are commonly used by bacteria to influence the transcription of specific genes or operons, and to mediate cellular changes in response to environmental stimuli. In the NisK/NisR system, NisK is sensor protein and NisR serves as a response regulator. Recent results have implicated critical roles for these systems in the regulation of a variety of essential processes, including cell-cycle progression, pathogenicity, and developmental pathways (Hoch, 2000). To date, SalK/SalR, CiaRH, Ihk/Irr, VirR/VirS, and two orphan response regulators, RevS and CovR, have been described, all of which have been implicated in the virulence of S. suis serotype 2 (Pan et al., 2009; Wu et al., 2009; Li et al., 2011; Han et al., 2012; Wang et al., 2012). However, the NisK/NisR system has not previously been reported in S. suis serotype 2. In view of the research described above, we assumed that the NisK/NisR TCSTS might be linked to the pathogenicity of S. suis serotype 2. In vivo and in vitro virulence assays using a nisKR deletion mutant confirmed that this TCSTS is important for pathogenesis of S. suis serotype 2.
0944-5013/$ – see front matter. Crown Copyright © 2013 Published by Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.micres.2013.11.002
Please cite this article in press as: Xu J, et al. The two-component system NisK/NisR contributes to the virulence of Streptococcus suis serotype 2. Microbiol Res (2013), http://dx.doi.org/10.1016/j.micres.2013.11.002
G Model MICRES-25635; No. of Pages 6
ARTICLE IN PRESS J. Xu et al. / Microbiological Research xxx (2013) xxx–xxx
2 Table 1 Strains, plasmids and primer used in this study. Strains, plasmids and primers
Description
Source
Bacterial strains S. suis 2 SC19 NisKR E. coli DH5a
Serotype 2, clinical isolated virulent strain, mrp + ef + sly+ The deletion mutant of nisKR with background of SC19 Cloning host for maintaining the recombinant plasmids
This work Promega
Plasmids pSET4s pSET4SnisKR
E. coli–S. suis shuttle vector; replication function of pG + host3 and pUC19, lacZ SpcR A recombinant vector with the background of pSET4s, designed for knockout of nisKR
Takamatsu et al. (2001) This work
Primers
Nucleotide sequence (5 –3 )
Restriction sites
P1 P2 P3 P4 P5 P6 P7 P8 P9 P10
CCCCAAGCTTTAGTCTTCGATTGTCAAAGGG CCCCGTCGACTCTTGGATATCGTAATTTTGAATAC CCCCGTCGACAATTAAATAATATCACAAAATACAAAAT CGCCGGATCCATTCAATTGCTTTTTATTTTAAATC AATCACAATCAGAGAAAAATCATTTT TCAGCGATGCCTTTCTCTA TGCACACTCTTGTTCCAGTA TTCAATTAATCCAATCAAGACACAG CTGACGAGCATCACAAAAATC AAGTAAGTGTAAACCTATTCATTGT
HindIII SalI SalI BamHI
2. Materials and methods
of the highest dilution of supernatant that induced at least 50% lysis of erythrocytes.
2.1. Bacterial strains, plasmids, and growth conditions 2.4. Invasion and adherence assays The bacterial strains and plasmids used in this study are listed in Table 1. S. suis serotype 2 strains were grown in tryptic soy broth (TSB) medium or plated on tryptic-soy agar (TSA) (Difco, Detroit, MI, USA) containing 10% newborn bovine serum (Sijiqing Biological Engineering Materials Co. Ltd., Hangzhou, China). Escherichia coli DH5á was cultured in Luria–Bertani (LB) liquid medium or plated on LB agar. If required, spectinomycin (spc) was added to the plate or broth at the following concentrations: 100 g/ml for S. suis serotype 2, 50 g/ml for E. coli strain DH5á. 2.2. Construction of a NisK/NisR knockout mutant DNA sequences flanking nisKR were amplified from the chromosomal DNA of S. suis SC19 using PCR with two pairs of specific primers (P1/P2 and P3/P4), carrying HindIII/SalI and SalI/BamHI restriction enzyme sites, respectively (Table 1). Digested PCR fragments were directly cloned into a pSET4s vector. This knockout vector, named pSET4s-NisKR, was transformed into SC19 as previously described (Takamatsu et al., 2001). The resultant strains were selected at 28 ◦ C in spectinomycin (100 g/ml), and subsequently passaged at 37 ◦ C in the absence of spectinomycin selection as described by Takamatsu. The suspected mutant was verified by PCR using three pairs of primers: P5/P6 (flanking nisKR), P7/P8 (between nisKR), P9/P10 (a 961-bp fragment part of the SpcR gene in pSET4s).
2.3. Hemolytic activity Hemolysin activity was determined as previously described (Jacobs et al., 1994) with minor modification. Briefly, serial twofold dilutions (150 l) of culture supernatant of the wide-type and the nisKR mutant were prepared in 96-well microplates with 10 mM phosphate-buffered saline (PBS) buffer (PH 7.4) as the diluent. Next, 150 l of 2% sheep red blood cells in phosphate-buffered saline (PBS) were added to each well. The plates were incubated for 2 h at 37 ◦ C, and then centrifuged at 6000 × g for 10 min. Supernatant (150 l) was transferred to a new 96-well plate and the optical density determined at 540 nm using a micro-ELISA reader (Bio-Tek, Synergy, HT). Hemolysin units were determined as the reciprocal
The cell invasion and adherence assays were performed as previously described (Segura and Gottschalk, 2002) with some modifications. Bacteria were centrifuged, washed twice with PBS, and resuspended at 106 CFU/ml in RPMI 1640 medium without antibiotics. Confluent monolayers of Hela cells (CCL-2) grown in 24-well plates were infected at a multiplicity of infection (MOI) of 10 bacteria per cell. The plates were centrifuged at 800 × g for 10 min and incubated in RPMI 1640 medium for 2 h at 37 ◦ C with 5% CO2 . The monolayers were then washed three times with PBS. Gentamycin (100 g/well) and penicillin-G (5 g/well) was added and the plates were incubated for 45 min at 37 ◦ C in 5% CO2 . The monolayers were then washed three times with PBS. Cells were disrupted by pipetting 1 ml sterile deionized water into each well. Serial dilutions of the lysates were plated onto TSB agar to enumerate invading bacteria. To confirm that all the extracellular bacteria were killed by the antibiotic, 200 l of the final PBS wash solution was plated on TSB agar. Total cell-associated bacteria were also quantified as described above but without antibiotic treatment. Adherent bacteria were calculated by subtracting invading bacteria from total bacteria. The results were expressed as the adherence or invasion rate relative to that of the wild-type set as 100%. All assays were performed in triplicate and repeated three times. 2.5. PMN-mediated killing assay Polymorphonuclear leukocytes (PMNs, also called neutrophils) were isolated from heparinized venous blood of healthy piglets by sedimentation in 6% dextran, as previously described (Baltimore et al., 1977). Killing experiments of S. suis serotype 2 by pig PMNs were performed as previously described (Fittipaldi et al., 2008), with minor modifications. Briefly, S. suis serotype 2 in exponential phase were washed and resuspended in RPMI 1640. Bacteria were opsonized in 50% normal pig serum at 37 ◦ C for 30 min and then concentrated to 105 CFU/ml in RPMI 1640. Bacteria (106 ) were mixed with PMNs (105 ) in 96-well plates. For each strain, samples lacking PMNs were served as controls. The mixture was centrifuged at 380 × g for 5 min at 4 ◦ C and incubated for 1 or 2 h at 37 ◦ C under 5% CO2 . Cells were lysed with sterile deionized water and serial dilutions of the lysates were plated on TSB agar. Colonies were
Please cite this article in press as: Xu J, et al. The two-component system NisK/NisR contributes to the virulence of Streptococcus suis serotype 2. Microbiol Res (2013), http://dx.doi.org/10.1016/j.micres.2013.11.002
G Model MICRES-25635; No. of Pages 6
ARTICLE IN PRESS J. Xu et al. / Microbiological Research xxx (2013) xxx–xxx
counted and the percentage of S. suis serotype 2 killed was measured as follows: [1 − (CFUPMN+ /CFUPMN− )] × 100%. All assays were performed in triplicate and repeated three times. 2.6. Bacterial survival following phagocytosis Phagocytosis and intracellular survival assays were performed as described previously (Segura et al., 1998; Olvera et al., 2009), with some modifications. RAW264.7 macrophage cells were seeded in 24-well plates at 106 cells/well. Cells were infected with logphase bacteria at a bacteria-to-cell ration of 10:1 and incubation proceeded for 30 min at 37 ◦ C to allow uptake of bacteria. Then wells were washed three times and RPMI 1640 containing gentamycin (100 g/well) and penicillin-G (5 g/well) was added. Phagocyted bacteria were determined by cells lysis and plating of serial dilutions. At various intervals (1 h or 2 h post antibiotics treatment), wells were washed again with PBS and cells were lysed with 1 ml sterile deionized water and physical disruption by pipetting. Surviving bacteria were counted by plating serial dilutions on TSB agar. The results were expressed as the percentage decrease in the initial number (100%) of viable intracellular bacteria at 1 h and 2 h postinfection time. All assays were performed in triplicate and repeated three times.
3
the experiment. All animal experiments were conducted in strict accordance with the recommendations in the China Regulations for the Administration of Affairs Concerning Experimental Animals (1988) and the Hubei Regulations for the Administration of Affairs Concerning Experimental Animals (2005). 2.8. Analysis of colonization ability Forty-nine 6-week-old female BALB/c mice were divided into two groups and intravenously injected with WT and nisKR S. suis at a dose of 5 × 107 CFU in TSB. Mice infected with sterile TSB were used as controls. At each designated time, three infected and one non-infected mice were sacrificed, and tissues were weighed and homogenized in sterile PBS. The presence of WT or nisKR in blood and organs was determined by plating on TSB agar. 2.9. Statistical analysis All assays were performed in triplicate and repeated at least three times on different days. Where appropriate, data were expressed as mean ± SD. The difference between two groups was analyzed using the Student’s t-test, and survival analysis was carried out using the log-rank test. P values < 0.05 were considered significant and are indicated as *p < 0.05, **p < 0.01, and ***p < 0.001.
2.7. Experimental infections of BALB/c mice 3. Results For virulence studies, six-week-old female specific pathogenfree (SPF) BALB/c mice (10 mice per group) were challenged intraperitoneally with 1 ml of WT or nisKR S. suis at approximately 8 × 108 CFU/ml in TSB. Mice infected with sterile TSB were used as controls. The infected mice were monitored for clinical signs and survival time for 2 weeks. The animals were euthanized at the end of the experimental period or at a particular clinical score during
3.1. Construction and characterization of a NisKR-defective mutant The nisKR knockout mutant was constructed by homologous recombination and the double-crossover event was confirmed by PCR (Fig. 1B). The growth of the mutant strain in TSB containing 10%
Fig. 1. Genomic organization of NisKR in S. suis SC84, and confirmation of the knockout mutant nisKR. (A) Genomic organization of the NisKR locus in S. suis SC84. (B) Confirmation of the nisKR mutant by PCR using primers pairs P5/P6 (flanking nisKR), P7/P8 (between nisKR), P9/P10 (a 961-bp fragment part of the SpcR gene). M1 (2000 bp marker), M2 (15,000 bp marker). (C) Growth curves of the wild-type and nisKR mutant. Bacteria were cultured in TSB containing 10% newborn bovine serum at 37 ◦ C. Absorbance at 600 nm was measured at intervals of 1 h. Results shown are representative of three independent experiments.
Please cite this article in press as: Xu J, et al. The two-component system NisK/NisR contributes to the virulence of Streptococcus suis serotype 2. Microbiol Res (2013), http://dx.doi.org/10.1016/j.micres.2013.11.002
G Model MICRES-25635; No. of Pages 6
ARTICLE IN PRESS J. Xu et al. / Microbiological Research xxx (2013) xxx–xxx
4
Table 2 The viable counts of the wild-type and nisKR mutant (CFU/ml). Time (h)
1 2 3 4 5 6 7 8 9 10 11
nisKR
WT 1#
2#
3#
1#
2#
3#
3.2 × 106 4.3 × 107 5.2 × 108 1.9 × 109 2.0 × 109 2.5 × 109 1.8 × 109 1.6 × 109 1.8 × 109 1.6 × 109 1.3 × 109
3.4 × 106 4.4 × 107 4.6 × 108 2.0 × 109 1.5 × 109 2.7 × 109 2.0 × 109 1.2 × 109 1.3 × 109 1.0 × 109 1.4 × 109
2.5 × 106 3.8 × 107 5.3 × 108 1.3 × 109 1.7 × 109 2.0 × 109 1.6 × 109 1.2 × 109 1.0 × 109 1.3 × 109 1.3 × 109
3.5 × 106 3.6 × 107 4.5 × 108 1.8 × 109 1.1 × 109 1.7 × 109 1.3 × 109 1.2 × 109 2.0 × 109 1.1 × 109 1.0 × 109
3.1 × 106 3.2 × 107 4.2 × 108 1.7 × 109 1.4 × 109 2.2 × 109 1.4 × 109 1.3 × 109 1.4 × 109 1.0 × 109 1.1 × 109
2.7 × 106 3.1 × 107 3.8 × 108 1.4 × 109 1.7 × 109 1.9 × 109 1.6 × 109 1.6 × 109 1.7 × 109 9.0 × 108 1.1 × 109
Fig. 2. Titration of hemolytic activity of S. suis serotype 2 culture supernatants. The horizontal line means the highest dilution of supernatant inducing at least 50% lysis of erythrocytes.
newborn bovine serum showed no significant difference to that of the wild-type (Fig. 1C and Table 2). However, the hemolytic titer of the nisKR mutant was more than twofold lower than that of wild-type (Fig. 2), suggesting that NisKR inactivation would reduce the hemolytic activity of S. suis serotype 2.
3.2. Contribution of NisKR to in vitro adhesion and invasion The results demonstrated that the nisKR mutant displayed significantly less adherence (a 85.4% decrease in adherence) to HeLa cells compared with the wild-type (P < 0.001) (Fig. 3A), indicating a role for NisKR as an important mediator of the cellular adhesion process. Moreover, the invasion capacity of the nisKR mutant was significantly reduced (a 90.9% decrease in invasion) (P < 0.05) (Fig. 3B), suggesting that NisKR may also play a role in S. suis serotype 2 host cell invasion.
Fig. 4. Decreased resistance of nisKR to PMN-mediated killing. Wild-type or mutant strain nisKR were co-incubated, respectively, with PMNs at a bacteriato-cell ration of 10:1. At each time, PMNs were lysed and bacteria were plated on growth agar. Colonies were enumerated and the percent of bacteria killed was calculated. Data are expressed as the mean ± SD of three independent experiments. *** Indicates significance at P < 0.001, * indicates significance at P < 0.05.
3.3. Decreased resistance of nisKR to PMN-mediated killing The results showed that nisKR exhibited a significantly higher mortality rate compared to the wild-type following a 1 h (P < 0.001) and 2 h (P < 0.05) (Fig. 4) incubation, a 19.8% and 4.81% decrease in morality rate, respectively. These results indicated that disruption of NisKR decreases resistance of this pathogen to killing by PMNs. 3.4. Effect of NisKR on phagocytosis by RAW264.7 cells Following co-incubation with RAW264.7 cells for 30 min, a significant higher number of the nisKR mutant compared with the wild type were phagocytosed (P < 0.001) (Fig. 5A). Furthermore, the intracellular survival rate of the nisKR mutant was significantly lower than that of the wild type at 1 h (P < 0.001) and 2 h (P < 0.01) post antibiotics treatment (Fig. 5B). These results indicated that
Fig. 3. Interaction of the two strains with HeLa cells. (A) The nisKR mutant showed reduced levels of adherence to HeLa cells. The results were determined following a 1-h incubation of various S. suis strains with HeLa cells at a MOI of 10, followed by extensive washing of non-adherent bacteria and cell lysis to retrieve 100-l aliquots of total cell-associated bacteria for viable plate counts. Adherent bacteria were calculated by subtracting invading bacteria from total bacteria. The results shown are the means ± SD of three independent experiments. *** Indicates significance at P < 0.001. (B) The ability of nisKR to invade HeLa cells was decreased compared to the wild-type. Gentamycin (100 g/well) and penicillin-G (5 g/well) were added to obtain only intracellular bacteria. The results shown are the means ± SD of three independent experiments. * Indicates significance at P < 0.05.
Please cite this article in press as: Xu J, et al. The two-component system NisK/NisR contributes to the virulence of Streptococcus suis serotype 2. Microbiol Res (2013), http://dx.doi.org/10.1016/j.micres.2013.11.002
G Model MICRES-25635; No. of Pages 6
ARTICLE IN PRESS J. Xu et al. / Microbiological Research xxx (2013) xxx–xxx
5
Fig. 5. Interaction of the wild type and the nisKR mutant with RAW264.7 cells. (A) Phagocytosis of the wild type and the nisKR mutant by RAW264.7 cells after a 30 min infection time. (B) Intracellular survival of the wild type and the nisKR mutant with RAW264.7 cells. The wild-type or mutant strains were incubated with RAW264.7 cells, respectively, at a bacteria-to-cell ratio of 10:1. Phagocytosis proceeded at 37 ◦ C for 30 min and then RPMI 1640 containing gentamycin (100 g/well) and penicillin-G (5 g/well) were added. At different intervals (1 h or 2 h post antibiotic treatment), viable intracellular bacteria were recovered by plating serial dilutions of cell lysis on TSB agar. The results are presented as the mean ± SD of three independent experiments.
deletion of NisKR render S. suis serotype 2 more vulnerable to both phagocytosis and bactericidal activity of RAW264.7 cells. 3.5. Virulence attenuation of the nisKR mutant in a BALB/c mouse model An experimental infection model in mice was designed to assess the role of NisKR in virulence. Almost all mice in the wild-type group presented severe clinical signs of infection, such as weight loss, eyes abscess, rough coat, lethargy, and shivering, within 24 h while the 10 mice challenged with nisKR showed slightly swollen eyes and lethargy (data not shown). Only four animals from the wild-type group survived at day 1 post-infection, and only two animals survived to day 2, while nine of the animals from the nisKR group survived to day 2 post-infection, and had recovered from the infection symptoms by day 5 (Fig. S1). All nine animals challenged with nisKR survived over the 14-day period of observation. Supplementary material related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.micres. 2013.11.002. To better evaluate the virulence attenuation of the nisKR mutant, colonization experiments were performed. As shown in Fig. S2, bacterial counts recovered from heart, lung, brain, and blood of nisKR-infected mice were lower than those of wild-typeinfected mice at each time point. Moreover, nisKR could not be isolated from any of these tissues or blood on days 5 and 6 postinfection, while enormous wild-type strain could still be isolated from blood, heart, and lung throughout the course of the experiment. All of the results strongly suggested the importance of the NisK/NisR system in the pathogenesis of S. suis serotype 2. Supplementary material related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.micres. 2013.11.002. 4. Discussion S. suis serotype 2 is one of the most important swine pathogens, and is an emerging, life-threatening zoonotic agent in both pigs and humans. Development of the disease requires the pathogenic bacteria to efficiently adapt to different niches inside and outside of their host organisms, which is frequently mediated by TCSTSs. Therefore, TCSTSs can be considered prerequisites for bacterial pathogenicity (Mahan et al., 1993; Beier and Gross, 2006). The NisKR TCSTS is located in a putative PAI in S. suis serotype 2 outbreak isolates, wherein another TCSTS SalK/SalR is found to be requisite for the full virulence of S. suis serotype 2 (Li et al., 2008). Therefore, it is necessary to explore the function of the NisKR TCSTS in the pathogenesis of S. suis serotype 2.
In this study, a deletion mutant was constructed to assess the role of NisKR in the pathogenesis of S. suis serotype 2. Results showed that compared with the wild type the mutant strain exhibited decreased hemolytic activity that is often associated with the virulence and pathogenicity of several Gram-positive and Gramnegative bacterial species (Johnson, 1991; Marshall and Ziegler, 1991; Sobel, 1991). More importantly, the nisKR mutant exhibited highly attenuated virulence compared to the wild-type strain in the BALB/c mouse model, which was similar to the results of the deletion of the TCSTS CiaRH, VirR/VirS and IhK/IrR mutant (Li et al., 2011; Han et al., 2012; Wang et al., 2012), indicating definitely that NisKR plays an important role in the virulence of S. suis serotype 2. Outcomes of the mouse experimental infections suggested that the lethality of this pathogen was eliminated by deletion of NisKR. S. suis serotype 2 is considered an important zoonotic pathogen causing infections in humans, pigs and so on, therefore cells originates from different hosts (Lalonde et al., 2000; Pan et al., 2009; Li et al., 2013) were applied to test if NisKR contributed to the virulence of S. suis 2. Bacterial attachments to epithelial cells, colonization of mucosal surfaces, and interaction with respiratory epithelial cells are prerequisites for the induction of streptococcal infection (Lalonde et al., 2000). Polymorphonuclear leukocytes play an important role in host defense system’s response to bacterial infectious (Chabot-Roy et al., 2006), and macrophages could combine potent anti-microbial functions with the ability to induce local inflammation and a systemic immune response (Frankenberg et al., 2008). Pathogens are mainly eliminated through phagocytosis, followed by intracellular digestion. In the present study, we tested the ability of the nisKR mutant to adhere to and invade HeLa cells, and found that both the adherence and invasion ability of the nisKR mutant was greatly decreased. Furthermore, the PMN-mediated killing assay and phagocytosis intracellular survival assays indicated that the nisKR mutant was less able to resist phagocytosis and killing by RAW264.7 cells and PMNs, which resembled the results of the deletion of the TCSTS SalKR, IhKR and CiaRH mutant (Li et al., 2008, 2011; Han et al., 2012). It is reasonable to speculate that deletion of NisKR may cause defects in some surface proteins and consequently lead to more vulnerability of S. suis 2 to both phagocytosis and bactericidal activity of PMNs and RAW264.7 cells or alter production of some bacterial factors that affect normal PMN and RAW264.7 cell function during interaction between bacterium and cells. In addition, in colonization experiments, lower bacterial counts and higher clearance efficiency in tissues of nisKR-infected mice indicated that the ability of nisKR to colonize and thereby survive in vivo was impaired. It could be inferred that this dissemination failure may be partially due to the reduced capacity to adhere to and invade epithelial cells, and the greater susceptibility of the mutant to host immune cells.
Please cite this article in press as: Xu J, et al. The two-component system NisK/NisR contributes to the virulence of Streptococcus suis serotype 2. Microbiol Res (2013), http://dx.doi.org/10.1016/j.micres.2013.11.002
G Model MICRES-25635; No. of Pages 6
ARTICLE IN PRESS J. Xu et al. / Microbiological Research xxx (2013) xxx–xxx
6
Together, our study identified a novel TCSTS NisK/NisR contributing to the virulence of S. suis serotype 2 in both vitro and vivo models of infection, suggesting the important roles of the TCSTS NisK/NisR in the pathogenesis of S. suis serotype 2 infection. Acknowledgments This study was supported by Grants from the National Natural Science Foundation of China (NSFC) (No. 31101844), the National Basic Research Program (also called the 973 Program) (No. 2012CB518803) from the Ministry of Science and Technology of China and the Fundamental Research Funds for the Central Universities. References Baltimore RS, Kasper DL, Baker CJ, Goroff DK. Antigenic specificity of opsonophagocytic antibodies in rabbit anti-sera to group B Streptococci. J Immunol 1977;118(2):673–8. Beier D, Gross R. Regulation of bacterial virulence by two-component systems. Curr Opin Microbiol 2006;9(2):143–52. Brown JS, Gilliland SM, Holden DW. A Streptococcus pneumoniae pathogenicity island encoding an ABC transporter involved in iron uptake and virulence. Mol Microbiol 2001;40(3):572–85. Chabot-Roy G, Willson P, Segura M, Lacouture S, Gottschalk M. Phagocytosis and killing of Streptococcus suis by porcine neutrophils. Microb Pathog 2006;41(1):21–32. Chen C, Tang J, Dong W, et al. A glimpse of streptococcal toxic shock syndrome from comparative genomics of S. suis 2 Chinese isolates. PLoS ONE 2007;2(3):e315. Fittipaldi N, Sekizaki T, Takamatsu D, de la Cruz Domínguez-Punaro M, Harel J, Bui NK, Vollmer W, Gottschalk M. Significant contribution of the pgdA gene to the virulence of Streptococcus suis. Mol Microbiol 2008;70(5):1120–35. Frankenberg T, Kirschne KS, Häcker H, Häcker G. Phagocytosis-induced apoptosis of macrophages is linked to uptake: killing and degradation of bacteria. Eur J Immunol 2008;38(1):204–15. Gal-Mor O, Finlay BB. Pathogenicity islands: a molecular toolbox for bacterial virulence. Cell Microbiol 2006;8(11):1707–19. Han H, Liu C, Wang Q, et al. The two-component system Ihk/Irr contributes to the virulence of Streptococcus suis serotype 2 strain 05ZYH33 through alteration of the bacterial cell metabolism. Microbiology 2012;158(7):1852–66. Hoch JA. Two-component and phosphorelay signal transduction. Curr Opin Microbiol 2000;3(2):165–70. Jacobs AA, Loeffen PL, van den Berg AJ, Storm PK. Identification: purification, and characterization of a thiol-activated hemolysin (suilysin) of Streptococcus suis. Infect Immun 1994;62(5):1742–8.
Johnson JR. Virulence factors in Escherichia coli urinary tract infection. Clin Microbiol Rev 1991;4(1):80–128. Kuipers OP, Beerthuyzen MM, de Ruyter PG, Luesink EJ, de Vos WM. Autoregulation of nisin biosynthesis in Lactococcus lactis by signal transduction. J Biol Chem 1995;270(45):27299–304. Lalonde M, Segura M, Lacouture S, Gottschalk M. Interactions between Streptococcus suis serotype 2 and different epithelial cell lines. Microbiology 2000;146(8):1913–21. Li J, Tan C, Zhou Y, Fu S, Hu L, Hu J, Chen H, Bei W. The two-component regulatory system CiaRH contributes to the virulence of Streptococcus suis 2. Vet Microbiol 2011;148(1):99–104. Li M, Wang C, Feng Y, et al. SalK/SalR, a two-component signal transduction system, is essential for full virulence of highly invasive Streptococcus suis serotype 2. PLoS ONE 2008;3(5):e2080. Li W, Wan Y, Tao Z, Chen H, Zhou R. A novel fibronectin-binding protein of Streptococcus suis serotype 2 contributes to epithelial cell invasion and in vivo dissemination. Vet Microbiol 2013;162(1):186–94. Lun ZR, Wang QP, Chen XG, Li AX, Zhu XQ. Streptococcus suis: an emerging zoonotic pathogen. Lancet Infect Dis 2007;7(3):201–9. Mahan MJ, Slauch JM, Mekalanos JJ. Selection of bacterial virulence genes that are specifically induced in host tissues. Science 1993;259(5095):686–8. Marshall NE, Ziegler HK. Role of bacterial hemolysin production in induction of macrophage Ia expression during infection with Listeria monocytogenes. J Immunol 1991;147(7):2324–32. Olvera A, Ballester M, Nofrarías M, Sibila M, Aragon V. Differences in phagocytosis susceptibility in Haemophilus parasuis strains. Vet Res 2009;40(3):24. Pan X, Ge J, Li M, et al. The orphan response regulator CovR: a globally negative modulator of virulence in Streptococcus suis serotype 2. J Bacteriol 2009;191(8):2601–12. Schmidt H, Hensel M. Pathogenicity islands in bacterial pathogenesis. Clin Microbiol Rev 2004;17(1):14–56. Segura M, Gottschalk M. Streptococcus suis interactions with the murine macrophage cell line J774: adhesion and cytotoxicity. Infect Immun 2002;70(8): 4312–22. Segura MA, Cléroux P, Gottschalk M. Streptococcus suis and group B Streptococcus differ in their interactions with murine macrophages. FEMS Immunol Med Microbiol 1998;21(3):189–95. Sobel JD. Bacterial etiologic agents in the pathogenesis of urinary tract infection. Med Clin North Am 1991;75(2):253–73. Takamatsu D, Osaki M, Sekizaki T. Thermosensitive suicide vectors for gene replacement in Streptococcus suis. Plasmid 2001;46(2):140–8. Tang J, Wang C, Feng Y, et al. Streptococcal toxic shock syndrome caused by Streptococcus suis serotype 2. PLoS Med 2006;3(5):e151. Wang H, Shen X, Zhao Y, Wang M, Zhong Q, Chen T, Hu F, Li M. Identification and proteome analysis of the two-component VirR/VirS system in epidemic Streptococcus suis serotype 2. FEMS Microbiol Lett 2012;333(2):160–8. Wu T, Chang H, Tan C, Bei W, Chen H. The orphan response regulator RevSC21 controls the attachment of Streptococcus suis serotype-2 to human laryngeal epithelial cells and the expression of virulence genes. FEMS Microbiol Lett 2009;292(2):170–81.
Please cite this article in press as: Xu J, et al. The two-component system NisK/NisR contributes to the virulence of Streptococcus suis serotype 2. Microbiol Res (2013), http://dx.doi.org/10.1016/j.micres.2013.11.002
