Biotechnol Lett DOI 10.1007/s10529-015-1817-1

ORIGINAL RESEARCH PAPER

Nisin-induced expression of a recombinant antihypertensive peptide in dairy lactic acid bacteria John A. Renye Jr. • George A. Somkuti

Received: 12 January 2015 / Accepted: 19 March 2015 Ó Springer Science+Business Media Dordrecht (outside the USA) 2015

Abstract Objective To improve the process for the production of milk-derived antihypertensive peptides, including a 12-residue peptide (FFVAPFPECVGK) from aS1casein. Results A synthetic gene encoding this peptide was cloned within the pediocin operon, replacing the nucleic acid sequence encoding the mature pediocin peptide (papA) and resulting in a translational fusion between the pediocin leader peptide and the 12-residue hypotensive (C-12) peptide. The recombinant operon was subsequently cloned immediately downstream of the nisA promoter to allow for inducible gene expression within Streptococcus thermophilus ST128, Lactococcus lactis subsp. lactis ML3 and Lactobacillus casei C2. RT-PCR was used to confirm recombinant gene expression in complex medium; and SDS-PAGE analysis showed that the pediocin secretion machinery, encoded by papC and papD, allowed for secretion of the recombinant peptide from both L.

Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture. J. A. Renye Jr. (&)  G. A. Somkuti Eastern Regional Research Center, Agricultural Research Service, United States Department of Agriculture, 600 E. Mermaid Lane, Wyndmoor, PA 19038, USA e-mail: [email protected]

lactis ML3 and L. casei C2 in a chemically defined medium. Conclusion The use of a nisin as a ‘‘food-grade’’ inducer molecule, and generally-regarded-as-safe LAB species suggests that this system could be used for the production of functional food ingredients. Keywords Antihypertensive peptide  Lactic acid bacteria  Nisin-induced expression  Pediocin

Introduction Encrypted within the primary structure of bovine milk proteins are large numbers of bioactive peptides which may impact human health. Several biological activities have been attributed to these peptides including antimicrobial, immunomodulating, antithrombotic and antihypertensive; and some have now been classified as multifunctional possessing two or more of these properties (Meisel 2004). Within the native protein sequence these peptides remain inactive, and their availability is dependent on the enzymatic hydrolysis of milk proteins during food processing and digestion. Lactic acid bacteria (LAB) used in dairy fermentations play a significant role in the degradation of milk proteins due to the presence of cell wall proteases and peptidases. These enzymes are required by the LAB to generate exogenous amino acids from the environment for growth (Savijoki et al. 2006);

123

Biotechnol Lett

however, oligopeptides which are not transported into the LAB remain in the food matrix as possible sources of bioactive peptides. Further digestions of these oligopeptides by membrane-bound LAB peptidases, following cell lysis, or by digestive enzymes present in the human gastrointestinal tract have been reported to liberate the active peptides (Meisel 2004). Milk-derived peptides with hypotensive activity have received a great deal of attention since cardiovascular disease (CVD) affects a significant proportion of the world’s population and is directly related to blood pressure level (Boelsma and Kloek 2009). There have been a number of hypotensive peptides reported which function as angiotensin I-converting enzyme (ACE) inhibitors in vitro (Fitzgerald and Meisel 2000). ACE is a key enzyme in the hydrolysis of angiotensin I to the potent vasoconstrictor, angiotensin II, and degrades bradykinin, a vasodilatory molecule of the kallikrein-kinin system (Sturrock et al. 2004). Of the milk-derived hypotensive peptides identified, a significant amount of work has focused on the tripeptides Val-Pro-Pro (VPP) and Ile-Pro-Pro (IPP), due to their potent inhibitory effects (Nakamura et al. 1995), their resistance to degradation by digestive enzymes (Fitzgerald and Meisel 2000) and their ability to be absorbed through the intestinal lumen (Foltz et al. 2007). However, there is still concern as to the efficiency of lactotripeptides in the regulation of blood pressure in humans (Boelsma and Kloek 2009). Another hypotensive peptide which may have potential as a ‘‘food-grade’’ regulator of blood pressure in humans is the 12-amino acid peptide (C-12; FFVAPFPEVFGK) isolated from a hydrolysate of bovine casein (Maruyama et al. 1985). The peptide is derived from the N-terminus of as1-casein and lowers systolic blood pressure in spontaneously hypertensive rats (Karaki et al. 1990) and in humans (Townsend et al. 2004), thus demonstrating its potential as a functional-food ingredient. A casein hydrolysate containing this peptide is currently being marketed as a food supplement (DMV International, Delhi, NY); however a source of pure peptide is not available. A synthetic gene could be constructed to allow for intracellular expression of the C-12 peptide in Escherichia coli (Lv et al. 2003) and ‘‘food-grade’’ LAB, specifically Streptococcus thermophilus (Renye and Somkuti 2008). However, both systems require lysis of the host bacterium, followed by costly purification techniques, such as HPLC, to isolate the

123

peptide for use as a functional food ingredient. In addition, E. coli models for expressing antihypertensive peptides have relied on the use of fusion proteins to protect against degradation by intracellular peptidases, thus necessitating the use of enzymatic treatments to remove the protein tag and USED non-foodgrade inducer molecules, including IPTG, to optimize peptide production (Lv et al. 2003; Liu et al. 2007). The production system described here differs from previously described systems in that the LAB hosts and nisin, used to induce recombinant gene expression, are both approved for use in food; and the prepeptide is modified by the host bacterium, allowing for secretion of the active antihypertensive peptide. To accomplish this, the gene encoding the C-12 peptide was cloned within the pediocin operon, resulting in an in-frame translational fusion with the pediocin leader peptide, which was shown to direct the secretion of pediocin from LAB hosts (Coderre and Somkuti 1999). The recombinant operon was then cloned within pMSP3535 (Bryan et al. 2000) immediately downstream of PnisA to allow for overexpression of the C-12 peptide in the presence of nisin.

Materials and methods Bacterial strains and growth media Streptococcus thermophilus ST128 and Lactococcus lactis subsp. lactis ML3 were grown in tryptone/yeast extract/lactose (TYL) broth at 37 and 34 °C, respectively, (Somkuti and Steinberg 1988), and Lactobacillus casei C2 was cultured in de Mann, Rogosa and Sharpe medium at 37 °C. Escherichia coli DH5a was grown in brain heart infusion (BHI) broth at 37 °C under aerobic conditions. When appropriate, LAB and E. coli cultures were supplemented with 15 lg erythromycin (Em) ml-1 and 150 lg Em ml-1 respectively. All bacterial strains used in this study were from an in-house culture collection. Molecular cloning procedures The vector pMSP3535 was constructed as described by Bryan et al. (2000) and provided as a gift, pUC18 was purchased from Life Technologies Inc. (Gaithersburg, MD, USA), and pPC418 (Coderre and Somkuti 1999) and pRS2 (Renye and Somkuti 2008) were

Biotechnol Lett

constructed as previously described. Restriction enzymes, T4 DNA ligase and Taq DNA polymerase were purchased from New England Biolabs (Beverly, MA, USA). Plasmids were isolated from E. coli using the Qiagen Miniprep Kit (Valencia, CA) or by alkaline lysis followed by cesium chloride/ethidium bromide ultracentrifugation (Stougaard and Molin 1981). DNA was analyzed by gel electrophoresis in TAE buffer (0.04 M Tris, 0.02 M acetic acid, 0.001 M EDTA, pH 8.0) with 1 % agarose, and DNA fragments required for cloning were purified from the gels using the Qiaex II Gel Extraction Kit (Qiagen). PCR was used to amplify the nucleic acid sequence corresponding to the C-12 aS1-casein-derived peptide using the following primers: C12Fwd (50 CCCTGGC CAATATCATTGGTGGTTTTTTTGTTGCTCCATTT30 ) and C12Rev (50 CCCGCTCAGCTTATTTAC CAAAAACTTC30 ), which included the MscI and NheI restriction endonuclease recognition sequences respectively (underlined). PCR conditions were as follows: 30 cycles: 95 °C for 30 s; 45 °C for 30 s; 74 °C for 30 s; with a final extension at 74 °C for 5 min. Transformation of freshly prepared E. coli DH5a competent cells was carried out by a heat-shock method, while S. thermophilus ST128, L. lactis subsp. lactis ML3 and L. casei C2 were electrotransformed by a standard protocol previously described (Somkuti and Steinberg 1988). Erythromycin resistant transformants were screened for the presence of recombinant plasmid by PCR using the following primers: C12Fwd; nisAFwd (50 TACGGATCAGATCTAGTCTTA30 ); and PedRev (50 GGCTGGCAATCTTGTTGT30 ). PCR amplification protocol was as follows: 35 cycles: 95 °C for 30 s, 55 °C for 30 s and 74 °C for 1 min per 1 kb DNA; with a final extension at 74 °C for 5 min. The PCR product obtained using the nisAFwd and PedRev primer set was cleaned using the QIAquick PCR Purification Kit (Qiagen). Nucleic acid sequencing was performed using an ABI PRISM 3730 (PerkinElmer, Wellesley, MA) DNA analyzer with ABI PRISM Big Dye terminator cycle sequencing reagent using the nisAFwd and PedRev primers. Obtained sequences were analyzed using Sequencher 4.9 (Gene Codes Corp., Ann Arbor, MI).

25 lg ml-1. C-12 expression was tested for in complex medium (TYL, MRS); and chemically defined medium (ZMB1) (Zhang et al. 2009), supplemented with 2 % (w/v) lactose (S. thermophilus; L. lactis) or glucose (L. casei). Following overnight growth of LAB transformants in 5 ml broth containing 15 lg Em ml-1, the cells were pelleted and washed three times in 0.1 % peptone broth. The cultures were then diluted 1.5-fold into fresh medium, and peptide expression was induced using 50 ng nisin ml-1 for up to 24 h. For reverse transcriptase PCR (RT-PCR) analysis, the cells were collected following 4 h induction and total RNA was isolated using the RiboPure-Bacteria kit (Ambion, Austin, TX). RT-PCR was performed using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA). A control reaction was performed in the absence of RT using Platinum Pfx DNA polymerase (Invitrogen) to ensure the RNA preparation was not contaminated with trace amounts of DNA. Oligonucleotide primers C12Fwd and PedRev were used for amplification. For SDS-PAGE analysis, 4 ml cell-free supernatants were collected after 4 and 24 h of nisin induction. To concentrate the C-12 peptide the culture supernatants were subjected to chloroform extraction (Burianek and Yousef 2000). Briefly, a half-volume (2 ml) of chloroform was added to the supernatants and vortexed for 10 min. The mixture was centrifuged at 75009g at 4 °C for 10 min; then aqueous and solvent phases were carefully decanted using a Pasteur pipet. Remaining solvent was driven off by a stream of air. The sediments formed at the interface and deposited on the sides of the tubes were resuspended in 400 ll sterile water. Following storage at 4 °C overnight the suspension was centrifuged at 15,7009g for 10 min. The aqueous layer was collected and run on a 12 % Bis–Tris gel (Invitrogen). Peptides were visualized by staining with silver nitrate.

Nisin induced expression of C-12 peptide

The outline for the construction of pRSC12P is shown in Fig. 1. The first stage involved construction of the recombinant pediocin operon in which the nucleic acid 2 sequence encoding the mature pediocin peptide was

Nisin (Sigma Aldrich) was dissolved in 0.02 M HCl and filter-sterilized (0.2 lm), as a stock solution of

Results and discussion Construction of pRSC12P

123

Biotechnol Lett

replaced with the synthetic gene encoding the C-12 antihypertensive peptide. The expression vector pPC418 (Coderre and Somkuti 1999) was digested with BamHI and EcoRI and a resulting 3.5 kb DNA fragment corresponding to the pediocin operon was extracted from an agarose gel and ligated into pUC18 at the corresponding sites, generating the vector p18P. Proper construction of p18P was confirmed by restriction digestion with BamHI and EcoRI, which showed a 3.5 kb band corresponding to the pediocin Fig. 1 Construction of pRSPC12. DNA fragment containing papA0 /C-12 was cloned into pUC18P generating p18PC12. The pediocin-replacement operon (papA0 /C-12-papD) was subcloned in pMSP3535 immediately downstream of the nisininducible promoter (PnisA) resulting in pRSPC12. nisR and nisK encode for the nisin regulatory elements; repD, E, G represent the pAMb1 replication genes; ori is the Gram-negative origin of replication; and Em is the erythromycin resistance gene

123

operon and a 2.7 kb band corresponding to pUC18 (data not shown). Next, the nucleic acid sequence encoding the C-12 peptide was amplified by PCR with the C12Fwd and C12Rev primer pair using the Streptococcus thermophilus expression vector pRS2 (Renye and Somkuti 2008) as template, resulting in a 71 bp DNA fragment. The C12Fwd primer was designed to contain the nucleotide sequence corresponding to the last 6 amino acids present in the pediocin leader peptide (ANIIGG), which contained a

Biotechnol Lett

MscI restriction endonuclease recognition site to be used for creation of an in-frame replacement of the pediocin structural gene (papA) with the gene encoding the C-12 peptide. The C12Rev primer was designed to contain a NheI restriction endonuclease recognition site which is also present within the intergenic region between papA and papB. The PCR fragment and p18P were digested with MscI and NheI and ligated together resulting in the vector p18PC12 (Fig. 1). Plasmid construction was confirmed initially by PCR using the C12Fwd and PedRev primer set resulting in a 0.3 kb DNA fragment (data not shown). The recombinant pediocin operon was then excised from p18PC12 with BamHI and SapI (3.7 kb) and ligated into pMSP3535, a single vector nisin-controlled expression (NICE) system (Bryan et al. 2000). The resulting vector, pRSPC12 (Fig. 1), has the recombinant pediocin operon cloned immediately down-stream of PnisA (Fig. 1). Proper construction of pRSPC12 was confirmed by PCR using the NisAFwd and PedRev primer pair resulting in the amplification of a 0.8 kb DNA fragment (data not shown). The pediocin operon was previously shown to function properly in LAB allowing for the secretion of mature pediocin and the inhibition of Listeria growth (Coderre and Somkuti 1999). In addition, the single vector NICE system was shown to function in S. thermophilus, Lactococcus lactis subsp. lactis and Lactobacillus casei, inducing the expression of pediocin, with the highest level of production observed in L. casei (Renye and Somkuti 2010). These results suggested that the construct present in pRSPC12 should result in the overexpression of the PapA/C-12 fusion peptide in the presence of exogenous nisin, and the subsequent secretion of the mature C-12 antihypertensive peptide from LAB hosts. Nisin-induced expression of C-12 Plasmid DNA was maintained in E. coli DH5a under erythromycin (Em) selection. Prior to electroporation, isolated plasmid DNA was further purified by cesium chloride/ethidium bromide gradient ultracentrifugation and analyzed by nucleic acid sequencing. The NisAFwd and PedRev primer set was used to amplify a 0.8 kb DNA fragment containing the papA-C12 translational fusion. Sequence analysis confirmed that the MscI blunt end ligation resulted in the proper in-

frame fusion between the nucleic acid sequences encoding the PapA leader peptide and the C-12 peptide and that this fusion product was maintained correctly during subsequent cloning steps (Fig. 2). Electrotransformants of S. thermophilus ST128, L. lactis subsp. lactis ML3 and L. casei C2 were grown on TYL-Em or MRS-Em agar for 48 h at 37 °C (ST128 and C2) or 34 °C (ML3). Greater than 100 potential transformants were obtained for S. thermophilus and L. casei, but only four potential transformants were obtained for L. lactis. Ten electrotransformants of S. thermophilus and L. casei and all four L. lactis electrotransformants were screened for the presence of pRSPC12 by PCR using the C-12Fwd and PedRev primer pair. Only two of the L. lactis transformants gave the expected 300 bp amplification product (Fig. 3a, lanes 1 and 4); whereas all S. thermophilus (Fig. 3a, lanes 6–15) and L. casei (Fig. 3b, lanes 1–10) transformants tested positive for pRSPC12. Initially, nisin-induced expression of the C-12 peptide was measured by RT-PCR in S. thermophilus and L. lactis grown in TYL. Cells were grown overnight in the presence of 15 lg Em ml-1 and then diluted into fresh TYL containing 50 ng nisin ml-1 to induce recombinant gene expression. Total RNA was extracted 4 h post-induction and transcription was monitored using the C12Fwd and PedRev primer set. A 300 bp DNA fragment containing C12-papB was observed confirming the presence of the operon transcript (Fig. 4). No bands were detected when the RNA prep was used as template in a PCR reaction without reverse transcriptase confirming that chromosomal DNA contamination was not a source of template for the amplification product (data not shown). Amplification of the RNA transcript was detected with or without nisin-induction suggesting that the nisA promoter is leaky in both hosts. Leakiness of the nisA promoter was reported in previous studies (Fu et al. 2005; Hazebrouck et al. 2007); including the use of the NICE system for expressing pediocin in L. casei (Renye and Somkuti 2010). Expression of the mature C-12 peptide from LAB hosts was further investigated through SDS-PAGE analysis of cell-free supernatants. Cell-free supernatants were collected after 4 h induction with nisin and either loaded directly onto the gel or subjected to chloroform extraction, with the recovered peptides concentrated tenfold in water prior to being loaded

123

Biotechnol Lett

ATGAAAAAAATTGAAAAATTAACTGAAAAAGAAATGGCCAATATCATTGGTGGTTT M K K I E K L T E K E M A N I I G G TTTTGTTGCTCCATTTCCAGAAGTTTTTGGTAAATAA F F V A P F P E V F G K STOP Fig. 2 Nucleic acid sequence analysis of the translational fusion encoding the PapA leader peptide and the C-12 peptide from pRSPC12. Sequence in blue corresponds to the pediocin leader peptide and red corresponds to the C-12 peptide

Fig. 3 PCR analysis of LAB transformants using the C12Fwd and PedRev primer set. a L. lactis (lanes 1–4) and S. thermophilus (lanes 6–15) transformants with parental ML3 (lane 5) and ST128 (lane 16) used as negative controls. b L. casei transformants (lanes 1–10). Lane M 100 bp DNA ladder

Fig. 4 RT-PCR analysis of C-12 expression in S. thermophilus and L. lactis in the presence (?N) or absence (-N) of nisin. RNA was isolated after 4 h induction period, and the C12Fwd and PedRev primer set was used for amplification. Lane M 100 bp DNA ladder

onto the gel. Initially, peptide expression was tested in complex media (TYL, MRS); however numerous peptides with molecular masses similar to the C-12 peptide were observed in cell free supernatants from the recombinant hosts and their corresponding parent cultures making it impossible to identify the recombinant peptide. To decrease the presence of contaminating peptides, the recombinant hosts were grown in a defined medium, ZMB1 (Zhang et al. 2009) supplemented with lactose (S. thermophilus, L. lactis) or glucose (L. casei), which supported the growth of all LAB hosts. Analysis of the cell-free supernatants directly showed the presence of a peptide, with a molecular mass expected for the C-12

123

peptide (*1.4 kDa), secreted from the L. casei host in the presence of nisin (Fig. 5a, ?N). A slightly larger band was also observed and may correspond to the unprocessed fusion peptide containing the pediocin leader sequence (*3.4 kDa). Peptides corresponding to the mature C-12 peptide or the fusion peptide were not observed in cell-free supernatants from the S. thermophilus or L. lactis. Following chloroform extraction and subsequent concentration of the recovered peptides, a small peptide with a molecular mass corresponding to the C-12 peptide was observed from L. lactis (Fig. 5b, ?N). Similar to what was observed for L. casei, a second larger band was also observed which may correspond to the unprocessed fusion peptide. In the absence of nisin (Fig. 5, -N) a diffuse band was observed for both L. casei and L. lactis between the two distinct bands observed in the presence of nisin, but it remains unclear as to what this band represents. Peptide bands corresponding to the mature peptide or the intact fusion peptide were not observed in cell-free supernatants from recombinant S. thermophilus grown in ZMB1 medium. This may be due to a low level of expression, since the NICE system is less effective in S. thermophilus compared to the other two LAB hosts (Renye and Somkuti 2010). In addition, recombinant L. casei, containing pRSNPed for nisin-induced expression of pediocin, could inhibit the growth of Listeria monocytogenes following induction in ZMB1 medium (data not shown); while the other two hosts were unable to produce enough pediocin to inhibit listeria growth. This result may explain why the C-12 peptide was initially observed only in culture supernatants from recombinant L. casei (Fig. 5a). In complex medium, all LAB hosts containing pRSNPed could inhibit listeria growth in the presence of nisin (Renye and Somkuti 2010), suggesting that growth conditions in ZMB1 must be optimized in order to allow for nisin-induced gene expression in several LAB hosts.

Biotechnol Lett

Fig. 5 SDS-PAGE analysis of a cell-free supernatant from L. casei, and b chloroform extract of cell-free supernatant from L. lactis. The parent culture with nisin (P), and the recombinant strains containing pRSPC12, with (?N) and without (-N) nisin

are shown. The bottom arrow indicates the band corresponding to the C-12 peptide (*1.4 kDa) and the top band corresponds to the PapA0 /C-12 fusion peptide (*3.4 kDa). Lane M SeeBlue Plus2 Pre-Stained Standard (Invitrogen)

The C-12 antihypertensive peptide has been primarily obtained through enzymatic hydrolysis (Maruyama et al. 1985) of bovine casein with its availability limited by the amount of aS1-casein present in the starting material. To increase the availability of this beneficial peptide recombinant DNA technologies have been developed to allow for its production in E. coli (Lv et al. 2003) and S. thermophilus (Renye and Somkuti 2010); however, both of these production systems were limited to intracellular peptide expression and required lysis of the host cell in order to purify the mature peptide. In addition, the E. coli systems have relied on the use of fusion peptides to protect against degradation by intracellular peptidases (Lv et al. 2003; Liu et al. 2007) and, to our knowledge, the use of secretory systems developed for Bacillus or Pichia hosts have not been evaluated for the production of these bioactive peptides. Although these systems could eliminate costs for enzymatically removing the protein tag, they would still be limited to in vitro fermentation procedures as they would not have ‘‘food-grade’’ status. The production system described here differs from other systems in that the fusion peptide is processed by the pediocin machinery and the mature peptide is subsequently secreted from the host cell, thus protecting it from intracellular peptidases. The production system utilizes ‘‘food-grade’’ dairy cultures and the FDA approved inducer molecule nisin. The amount of nisin used in this study was based on previous results with this system that showed 50 ng nisin ml-1 was the able to induce recombinant gene expression in S. thermophilus (Renye and Somkuti 2010). In the same study, 10 ng nisin ml-1 was shown to induce recombinant gene expression in L. lactis, suggesting it may

be a preferred production host with this system. In either case, the concentration of nisin required for inducing gene expression does not exceed the maximum level allowed for good manufacturing practice (250 ng nisin ml-1) (FDA 2014). Since the level of inducer is within the limits permitted for food use, this system offers the unique possibility for in situ production of bioactive peptides directly within fermented dairy products. For this to occur, the expression system would have to be tested and optimized for production of the antihypertensive peptide in dairy or other food matrices, as this study has shown that the growth medium (TYL or ZMB1) can affect the how the NICE system functions in LAB hosts. In addition, modifications to the nisA promoter and inclusion of nisI, encoding a nisin immunity protein, within the NICE plasmid have been reported to increase nisin-induced gene expression (Kim and Mills 2006), and may allow for better production within food environments. Although further optimization of the system may be required for commercialization, this report demonstrates the potential benefits for using a ‘‘food-grade’’ system for the production of bioactive food ingredients. Acknowledgments We thank BA Buttaro (Temple University) and GM Dunny (University of Minnesota) for providing the vector pMSP3535, and DH Steinberg for technical assistance.

References Boelsma E, Kloek J (2009) Lactotripeptides and antihypertensive effects: a critical review. Br J Nutr 101:776–786 Bryan EM, Bae T, Kleerebezem M, Dunny GM (2000) Improved vectors for nisin-controlled expression in grampositive bacteria. Plasmid 44:183–190

123

Biotechnol Lett Burianek LL, Yousef AE (2000) Solvent extraction of bacteriocins from liquid cultures. Lett Appl Microbiol 31:193–197 Coderre PE, Somkuti GA (1999) Cloning and expression of the pediocin operon in Streptococcus thermophilus and other lactic fermentation bacteria. Curr Microbiol 39:295–301 FDA (2014) Nisin preparation: affirmation of GRAS status as a direct human food ingredient. 21 CFR 184.1538 Fitzgerald RJ, Meisel H (2000) Milk protein-derived peptide inhibitors of angiotensin-I-converting enzyme. Br J Nutr 84(Suppl 1):S33–S37 Foltz M, Meynen EE, Bianco V, van Platerink C, Koning TMMG, Kloek J (2007) Angiotensin converting enzyme inhibitory peptides from a lactotripeptide-enriched milk beverage are absorbed intact into the circulation. J Nutr 137:953–958 Fu RY, Chen J, Li Y (2005) Heterologous leaky production of transglutaminase in Lactococcus lactis significantly enhances the growth performance of the host. Appl Environ Microbiol 71:8911–8919 Hazebrouck S, Pothelune L, Azevedo V, Corthier G, Wal JM, Langella P (2007) Efficient production and secretion of bovine beta-lactoglobulin by Lactobacillus casei. Microb Cell Fact 6:12 Kim JH, Mills DA (2006) Improvement of a nisin-inducible expression vector for use in lactic acid bacteria. Plasmid 58:275–283 Liu D, Sun H, Zhang L, Li S, Qin Z (2007) High-level expression of milk-derived antihypertensive peptide in Escherichia coli and its bioactivity. J Agric Food Chem 55:5109–5112 Lv GS, Huo GC, Fu XY (2003) Expression of milk-derived antihypertensive peptide in Escherichia coli. J Dairy Sci 86:1927–1931 Maruyama S, Nakagomi K, Tomizuka N, Suzuki H (1985) Angiotensin I-converting enzyme inhibitor derived from an

123

enzymatic hydrolysate of casein. II Isolation and bradykinin-potentiating activity on the uterus and the ileum of rats. Agric Biol Chem 49:1405–1409 Meisel H (2004) Multifunctional peptides encrypted in milk proteins. Biofactors 21:55–61 Nakamura Y, Yamamoto N, Sakai K, Okubo A, Yamazaki S, Takano T (1995) Purification and characterization of angiotensin I-converting enzyme inhibitors from sour milk. J Dairy Sci 78:777–783 Renye JA, Somkuti GA (2008) Cloning of milk-derived bioactive peptides in Streptococcus thermophilus. Biotechnol Lett 30:723–730 Renye JA, Somkuti GA (2010) Nisin-induced expression of pediocin in dairy lactic acid bacteria. J Appl Microbiol 108:2142–2151 Savijoki K, Ingmer H, Varmanen P (2006) Proteolytic systems of lactic acid bacteria. Appl Microbiol Biotechnol 71:394–406 Somkuti GA, Steinberg DH (1988) Genetic transformation of Streptococcus thermophilus by electroporation. Biochimie 70:579–585 Stougaard P, Molin S (1981) Vertical dye-buoyant density gradients for rapid analysis and preparation of plasmid DNA. Anal Biochem 118:191–193 Sturrock ED, Natesh R, van Rooyen JM, Acharya KR (2004) Structure of angiotensin I-converting enzyme. Cell Mol Life Sci 61:2677–2686 Zhang G, Mills DA, Block DE (2009) Development of chemically defined media supporting high-cell-density growth of lactococci, enterococci, and streptococci. Appl Environ Microbiol 75:1080–1087