NF-κB, CRE and YY1 elements are key functional regulators of CMV promoter-driven transient gene expression in CHO cells.

www.biotechnology-journal.com

Page 1

Biotechnology Journal

Accepted Article

Research Article

NF-κB, CRE and YY1 elements are key functional regulators of CMV promoter driven-transient gene expression in CHO cells

Adam J. Brown1, Bernie Sweeney2, David O. Mainwaring2, David C. James1

1

Department of Chemical and Biological Engineering, University of Sheffield, Sheffield,

England 2

Protein Expression and Purification Group, UCB, Slough, England

Correspondence: Prof. David C. James, Department of Chemical and Biological Engineering, University of Sheffield, Mappin St., Sheffield, S1 3JD telephone: +44-(0)114-222-7505, Email: [email protected] Keywords: Transient gene expression, Chinese hamster ovary cells, transcriptional regulation, CMV promoter, biopharmaceutical production. Abbreviations: C/EBP = CCAAT-enhancer binding protein; CArG = CC(A/T)6GG element;

CHO = Chinese hamster ovary; CMV = cytomegalovirus; CRE = cyclic adenosine monophosphate regulatory element; CBTFs = CRE-binding TFs; CREB = CRE-binding protein; CRM = cis-regulatory module; Gfi = Growth factor independence; GFP = Green fluorescent protein; MSX = msx homeobox; NF1 = nuclear factor 1; NFκB = nuclear factor kappa B; RARE = retinoic acid regulatory element; SEAP = Secreted alkaline phosphatase; TGE = transient gene expression; TF = transcription factor; TFRE = transcription factor regulatory element; TSS = transcriptional start site; YY1 = Yin yang 1.

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1002/biot.201400744. Submitted: Revised: Accepted:

23-Oct-2014 11-Dec-2014 21-Jan-2015

This article is protected by copyright. All rights reserved.


Page 2


Abstract

Accepted Article

Transient gene expression (TGE) in CHO cells is utilized to produce material for use in early stage drug development. These systems typically utilize the CMV promoter to drive recombinant gene transcription. In this study, we have mechanistically dissected CMVmediated TGE in CHO cells in order to identify the key regulators of this process. An in silico analysis of the promoter composition of transcription factor regulatory elements

(TFREs) and the CHO cell repertoire of transcription factors identified eight TFREs as likely effectors of CMV activity. We determined the regulatory function of these elements by preventing their cognate transcription factors from binding at the CMV promoter. This was achieved by both scrambling promoter binding site sequences and using decoy molecules to sequester intracellular transcription factors. We determined that the vast majority of CMV activity is mediated by just two discrete TFREs, showing that simultaneous inhibition of NFκB and CRE-mediated transactivation reduced CMV-driven transient SEAP production by

over 75%. Further, we identified a mechanism by which CMV-mediated TGE is negatively regulated in CHO cells, showing that inhibition of YY1-mediated transrepression increased SEAP production 1.5-fold. This work enables optimization and control of CMV-mediated TGE in CHO cells, in order to improve transient protein production yields.


Page 3


1. Introduction

Accepted Article

Transient gene expression (TGE) in Chinese hamster ovary (CHO) cells is utilized to produce material for early-stage testing of potential drug candidates (e.g. toxicology and product quality evaluation studies) [1]. Despite recent improvements in TGE yields, achieved via cell engineering, process development and optimization of transfection conditions, further advances are required to meet increasing demands for more material in shorter timescales [26]. Optimization of gene expression control technology offers a potentially attractive solution to achieve this. The vast majority of current CHO cell TGE systems utilize the human cytomegalovirus immediate early 1 (hCMV-IE1) promoter to drive recombinant gene transcription. However, little is known about how it functions mechanistically in the CHO cell and therefore strategies to precisely control or improve its transcriptional activity in order to maximize TGE yields are not available. In its natural context hCMV-IE1 promoter (hereafter referred to as the CMV

promoter) activity is the primary determinant of cell permissiveness to productive human cytomegalovirus infection [7]. In order to enable a broad host cell range the promoter has accordingly evolved to contain binding sites (transcription factor regulatory elements (TFREs)) for several ubiquitously expressed transcription factors (TFs) [8]. Owing to this promiscuous activity, the CMV promoter has become the dominant choice for driving recombinant gene expression in mammalian cells. However, CMVs transcriptional activity is highly context-dependent and cell type-specific regulation is seen both in animal models in vivo [9, 10, 11] and panels of cell lines in vitro [12, 13]. Promoter activity in any given host is a function of the promoters TFRE composition and the cells repertoire of TFs and transcriptional co-regulators [14]. CMV activity in CHO cells is therefore regulated by a system-specific combination of interactions between CMV-constituent TFREs and available endogenous factors. With respect to the former, multiple discrete TFREs have differentially


Page 4


been identified as positive, neutral or negative regulators of CMV activity in other host cell

Accepted Article

types [7]. With respect to the latter, we have recently identified a number of CHO-active TFREs, indicating the presence of their cognate TFs in CHO cells [15]. Moreover, the current revolution in CHOmics is beginning to decode the CHO cell proteome, and with it, the available TF repertoire [16]. However, no previous studies have investigated how the CMV promoter specifically interacts with the CHO cell factory machinery to control recombinant gene transcription. Accordingly, without this mechanistic information, CMV-mediated TGE in CHO cells cannot currently be optimized. In this study, we identify the key regulators of CMV promoter-driven TGE in CHO

cells by mechanistically dissecting this process. We analysed, in silico, the CMV promoters TFRE composition and CHO cells TF complement to identify likely effectors of CMV activity. We then determined the regulatory function of discrete TF-TFRE interactions by both sequestering intracellular TFs and scrambling their cognate binding sites within the promoter. We demonstrate that CMV-driven transient protein production in CHO cells can vary over 7-fold as a function of the transactivation and transrepression mediated through just three discrete TFREs.


Page 5


2. Materials and methods

Accepted Article

In silico analysis of CMV promoter activity regulation The CMV promoter sequence (genbank accession number M60321.1, nucleotides 595 – 1194) was analysed for the presence of discrete TFREs using the Transcription Element Search System (TESS: http://www.cbil. upenn.edu/cgi-bin/tess/tess) and the Transcription

Affinity Prediction tool (TRAP: http://trap.molgen.mpg.de/cgi-bin/trap_form.cgi) according to the methods previously described by Schug [17] and Manke et al. [18]. Publicly available CHO cell proteomics data [19] were then surveyed for the presence of cognate TFs for each identified TFRE.

Vector construction Previously described [20] promoterless secreted alkaline phosphatase (SEAP) and turbo green fluorescent protein (GFP) reporter-vectors (subcloned from pSEAP2control (Clontech, Oxford, UK)) were utilized in this study. To create a CMV core promoter reporter plasmid, (-34

a to

synthetic +50

oligonucleotide

relative

to

containing the

the

transcriptional

CMV start

core

sequence site;

5’-

AGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTAGATACGCCA

TCCACGCTGTTTTGACCTCCATAGAAGAC-3’) was synthesized (Sigma, Poole, UK)

and cloned into the XhoI and EcoRI sites uptream of the GFP gene. Note that this sequence contains two nucleotide substitutions (underlined in the above sequence) compared to the wild-type sequence (M60321.1) that do not impact on CMV core promoter activity (data not shown). All restriction enzymes were obtained from Promega (Southampton, UK). Discrete regions of the CMV promoter sequence were PCR amplified with Phusion high fidelity polymerase (New England Biolabs, Hitchin, UK) and inserted into either i) the KpnI and XhoI sites upstream of the CMV core promoter or ii) the XhoI and EcoRI sites directly


Page 6


upstream of the GFP gene. Primer sequences are listed in supporting information, Table S1.

Accepted Article

Synthetic CMV promoter constructs with NFκB, CRE or YY1 binding sites scrambled (to AATCGCAAGT, CTACTGTG and TGTC respectively) were synthesized by GeneArt (Life Technologies, Paisley, UK) and cloned upstream of the SEAP gene in the promoterless SEAP reporter-vector. The sequence of all plasmid constructs was confirmed by DNA sequencing.

Cell culture and transfection CHO-S and CHO-K1 cells were cultured in CD-CHO medium (Life Technologies) supplemented with 8 mM and 6mM L-glutamine (Sigma) respectively. Cells were routinely cultured at 37°C in 5% (v/v) CO2 in vented Erlenmeyer flasks (Corning, UK), shaking at 140

rpm and subcultured every 3-4 days at a seeding density of 2 x 105 cells/ml. Cell

concentration and viability were determined by an automated Trypan Blue exclusion assay using a Vi-Cell cell viability analyser (Beckman-Coulter, High Wycombe, UK). Two hours prior to transfection, 2 x 105 cells from a mid-exponential phase culture were seeded into individual wells of a 24 well plate (Nunc, Stafford, UK). Cells were transfected with DNAlipid complexes comprising DNA and Lipofectamine (Life Technologies), prepared

according to the manufacturer’s instructions. Transfected cells were incubated for 24 h prior to protein expression analysis. To eliminate potential promoter-promoter interference, individual transfections did not include a co-transfected reporter vector to compare transfection efficiencies.

However, each 24 well plate included a set of three external

reporters (CMV-GFP, SV40-GFP and CMV core-GFP) to confirm reproducible transfection performance. All transfections were carried out in triplicate and experiments were repeated three times.


Page 7


Construction of transcription factor decoys

Accepted Article

Transcription factor block-decoys were constructed as described previously [20]. Briefly, TFRE-specific block molecules containing a single copy of a discrete TF binding site were created by annealing two complementary, single stranded 5’ phosphorylated DNA oligonucleotides (Sigma) in STE buffer (100 mM NaCl, 50 mM Tris-HCl, 1 mM EDTA, pH 7.8, Sigma) . TFRE-block oligonucleotide sequences are listed in supporting information, Table S2. TFRE-blocks (12 µg) were then ligated with 5 units of high concentration T4 DNA

ligase (Life Technologies) at room temperature for 3 h to form TFRE-specific block-decoys containing ~ 10 – 20 copies of the target TF binding site. Chimeric decoys (targeting more than one TFRE) were constructed by ligating distinct TFRE-specific blocks in eqimolar ratios.

Quantification of reporter expression SEAP protein expression was quantified using the Sensolyte pNPP SEAP colorimetric reporter gene assay kit (Cambridge Biosciences, Cambridge, UK) according to the manufacturer’s instructions. GFP protein expression was quantified using a Flouroskan Ascent FL Flourometer (Excitation filter: 485 nm, Emission filter: 520 nm). Background fluorescence/absorbance was determined in cells transfected with a promoterless vector.


Page 8


3. Results

Accepted Article

CMV promoter extension sequences do not augment CMV promoter-mediated TGE The CMV promoter is defined as the sequence spanning from -560 to +50 bp relative to the transcriptional start site (TSS) of the immediate early 1 gene within the viral genome. However, extensions of this sequence are sometimes used to optimize CMV promotermediated stable gene expression in CHO cells (Fig. 1). In order to determine the function of these elements in CMV-driven TGE, we constructed GFP reporter plasmids containing the CMV promoter in association with the typically utilized 5’ (-1145 to -560) and 3’ (+50 +945) extension sequences. Assay conditions were optimized such that CMV promoter-GFP reporter activity was in the centre of the linear assay range with respect to plasmid copy number (DNA load) and measured GFP output (data not shown). Measurement of GFP production after transient transfection of CHO-S cells with each

CMV-reporter plasmid is shown in Figure 1. These data show that extension elements did not significantly augment CMV promoter-driven transient GFP production. Further, they did not exhibit observable transcriptional activity when tested in isolation (without the CMV promoter but in association with a minimal CMV core (-34 to +50 relative to the TSS)). The 5’ and 3’ CMV promoter extensions function as boundary/insulator and translation-enhancing elements respectively [21, 8, 22]. With respect to the former, local chromatin environment is unlikely to affect promoter activity in TGE. With respect to the latter, we inferred that translation rate was not a critical parameter affecting productivity under these process conditions. We therefore did not include these extension sequences in further analyses of CMV promoter-mediated TGE. However, we note that Mariati et al found 3’ extension sequences did enhance TGE in CHO-K1 cells [23], and therefore this element may be beneficial in systems where translation rates are a key limiting factor.


Page 9


In silico identification of likely regulators of CMV promoter activity

Accepted Article

In order to identify potential regulators of CMV promoter-driven TGE in CHO cells we analysed, in silico, i) the promoter’s TFRE (transcription factor (TF) binding site) composition, ii) CMV promoter regulation in other cell hosts and iii) CHO cells TF repertoire. Using online TF search tools (Transcription Element Search System (TESS) and Transcription Affinity Prediction tool (TRAP)) 12 discrete TFREs were identified in the CMV promoter at copy numbers ranging from 1 – 8 (Fig. 2). These elements include the 10 sites that have previously been shown to regulate CMV activity in other cell types (Table 1). In a recent screen of TFRE activity we determined that six of these elements (NFκB, CRE, C/EBP, GC-box, EF41 and RARE) could utilize available TF activity within CHO-S cells to independently mediate recombinant gene expression (Table 1) [15]. In contrast, six of the CMV-constituent TFREs were inactive in this screen, suggesting that their cognate TFs are not expressed in CHO cells. In order to confirm this we surveyed a recently published CHO cell proteomics dataset for potential cognate binding partners for each of the 12 TFREs [19]. As shown in Table 1, cognate TFs were identified for 7 of the 12 elements (including NF1 and YY1 but excluding E4F1), correlating closely with our previous findings. We note that TFs are particularly challenging to detect by proteomics and that unknown TFs may bind to TFREs [19, 24]. However, four of the CMV-constituent TFREs for which cognate TFs could not be identified were also inactive in the functional screen and present at relatively low copy numbers (< 3) in the promoter (CArG, ERF, Gfi1 and MSX). We therefore inferred that CHO cell-specific regulation of CMV promoter activity was a function of TF interactions with the following 8 TFREs: C/EBP, CRE, EF41, GC-box, NF1, NFκB, RARE, and YY1.


Page 10


CMV-constituent TFREs function to repress promoter activity in CHO-S cells

Accepted Article

In order to evaluate the function of the eight TFREs identified in silico, we first determined the transcriptional activity of discrete CMV promoter structural elements with varying TFRE compositions. The CMV promoter contains two structurally distinct, synergistically functioning components of equal size, the proximal and distal promoters (Fig. 3) [8]. Further, multiple cis-regulatory modules (CRMs, clusters of TF binding sites) are distributed throughout the sequence. We individually inserted the proximal and distal promoters and six

110 bp CRMs upstream of the CMV core in GFP reporter vectors. Measurement of GFP production after transient transfection of CHO-S cells with each reporter plasmid is shown in Figure 3. The proximal promoter exhibited a 1.6-fold increase in GFP production over that deriving from the distal promoter. Moreover, CRMs from within the proximal promoter sequence were significantly more active than those from the distal. These data therefore suggest that positive regulators of CMV promoter activity are more abundant in the proximal promoter sequence. NFκB, NF1 and C/EBP sites are all relatively enriched in the proximal promoter, compared to the distal, occurring at ratios of 3:1, 2:1 and 1:0 respectively. The remaining TFREs are either evenly distributed across both elements (CRE, GC-box) or relatively abundant in the distal promoter (RARE, EF41, YY1). Comparison of the TFRE composition and relative activity of CMV-CRMs provided

further indications of individual TFRE functions. For example, CRMs 5 and 6 exhibited the highest transcriptional activity and shared similar compositions, where 5/6 of their constituent TF binding sites were NFκB, CRE or GC-box elements. This analysis indicated that one or more these TFREs were positive regulators of CMV-mediated TGE, in line with our previous study that identified all three elements as positive effectors of CHO cell specific synthetic promoter activities [15]. However, CRMs 3 and 4 both contained multiple copies of these TFREs but did not exhibit observable activity. Therefore, we inferred that additional TFREs


Page 11


within these CRMs functioned to negatively regulate transcription by binding TFs that either

Accepted Article

recruited co-repressors or prevented the binding of activators. Both sequences contained RARE, YY1 and NF1 sites (in addition to CRE, NFκB and GC-box sites), suggesting that

one or more of these elements functioned to repress promoter activity.

CMV promoter-mediated TGE is regulated by NFκB, YY1 and CRE-binding TFs In order to specifically determine the functional contribution of each discrete TFRE in CMVmediated TGE we constructed TF decoys targeting each element. These short synthetic oligodeoxynucleotides compete for cognate intracellular TFs in a TFRE-specific manner and prevent their binding at target promoters [25]. We have previously shown that when using a novel method of decoy formation specifically developed for gene regulation studies in CHO cells, decoy concentrations of ≥ 2 µg/ml are sufficient to inhibit > 90% of expression from targeted TFREs [20]. To maximize the concentration of decoys that could be co-transfected we constructed a CMV promoter-SEAP reporter vector to enable more sensitive detection of CMV-driven TGE (i.e. to reduce the reporter-plasmid DNA load). Preliminary experiments showed that CMV-SEAP reporter activity was in the linear assay range with respect to plasmid copy number and measured SEAP output when CHO-S cells were co-transfected with 4 µg/ml decoy and 1 µg/ml CMV-SEAP reporter (data not shown). Measurement of SEAP production after transient co-transfection of CHO-S cells with

CMV-SEAP-reporter and each TFRE-specific decoy is shown in Figure 4. These data show that the NFκB and CRE decoys reduced CMV-driven SEAP expression to 51% and 62% respectively. In contrast, CMV activity was increased to 149% by the YY1 decoy. SEAP production was not significantly affected by the other five TFRE-specific decoys (RARE, NF1, GC-box, C/EBP, E4F1), suggesting that these sites are functionally inactive in CHO cells. In order to determine the effect of inhibiting NFκB and CRE simultaneously we


Page 12


constructed a chimeric decoy targeting both TFREs. To maintain equivalent TFRE copy

Accepted Article

numbers, single-target decoy controls were constructed containing consensus and scrambled TFRE sequences (e.g. NFκB-specific decoy contained an NFκB-consensus and a CREscrambled sequence). Anticipating that chimeric decoys would require a greater concentration of decoy to be transfected to achieve a specific reduction in TFRE-mediated expression (as the number of copies of each TFRE is halved per decoy molecule) we increased decoy DNA load per transfection. Preliminary experiments showed that a decoy concentration of 6 µg/ml was the maximal decoy load that could be co-transfected whilst still maintaining quantitation in the linear range from the CMV-SEAP reporter plasmid (transfected at 1 µg/ml) (data not shown), and accordingly these assay conditions were used. As shown in Figure 4B, the chimeric decoy reduced CMV-driven SEAP production to

23%, where decoys targeting NFκB or CRE individually caused reductions to 54% and 66% respectively. These data reveal that CMV promoter-mediated TGE in CHO cells is

predominantly regulated by NFκB/CRE and YY1-element binding TFs that function to activate and repress expression respectively. We assume that the relative extent to which each TFRE-specific decoy inhibited its target element was a function of decoy specific differences in both the relative intracellular abundance of TFs and TF-TFRE binding kinetics. However, given that i) high concentrations of other TFRE-specific decoys had no effect on CMV activity and ii) the NFκB:CRE chimeric decoy inhibited > 75% of SEAP production, we consider the remaining CMV-constituent TFREs to be largely inactive in CHO cells.

CMV promoter activity is predominantly mediated via NFκB and CRE sites In order to both confirm and further elucidate the functional activity of NFκB, YY1 and CRE TFREs as regulators of CMV-mediated TGE in CHO cells, we created synthetic CMV promoter variants with these TFRE sequences scrambled. As YY1 binding sites are difficult


Page 13


to identify in silico (due to their short 4 bp core consensus sequence [26]) we assumed that

Accepted Article

our survey of CMV-constituent TFREs (Fig. 2) may have missed potential YY1 motifs. Utilising the regulatory sequence analysis (RSA) oligo-analysis tool [27] we determined that CMV contains 16 copies of the core YY1 binding site, which is the most abundant 4 bp sequence within the promoter. Accordingly, in order to determine the functional contribution of YY1 sites to CMV-driven TGE, we synthesized a CMV construct with all 16 putative YY1 elements ‘knocked-out’ (scrambled to TGTC). Similarly, NFκB (all 4 NFκB sites scrambled

to AATCGCAAGT), CRE (all 8 CRE sites scrambled to CTACTGTG), and NFκB+CRE (all NFκB and CRE sites scrambled) knockout (KO) CMV promoters were synthesized and all constructs were inserted into SEAP reporter vectors. We hypothesized that CMV promoter activity may be differentially regulated in

different CHO hosts due to potential variations in their TF repertoires. In order to evaluate this, we determined the activity of the synthetic CMV constructs in two commonly utilized cell hosts. Figure 5 shows transient SEAP production from each TFRE-KO-CMV promoter in CHO-S and CHO-K1 cells. Relative promoter activities were approximately the same in both cell lines, disproving our hypothesis. As expected, removal of NFκB binding sites reduced CMV promoter activity to < 50% compared to the wild-type CMV control (WTCMV, no TFREs scrambled). In contrast, scrambling of CRE binding site sequences did not significantly affect CMV-driven SEAP production. However, when NFκB and CRE elements were simultaneously removed SEAP production was reduced to < 15% of that deriving from WTCMV. This result is in line with our finding that a TF decoy targeting both TFREs reduced CMV-mediated SEAP production to 23% (Fig. 4). Taken together, Figures 4 and 5 revealed that CMV activity is primarily regulated via NFκB elements by a mechanism that requires both NFκB and CBTFs but not CRE sites. Further, they identified that if/when NFκB-mediated transactivation is impaired, CMV activity is predominantly regulated by


Page 14


CBTFs binding directly to CRE sites within the promoter. Lastly, given that the NFκB+CRE-

Accepted Article

KO-CMV promoter drove observable SEAP production, they show that additional as yet unidentified TFREs play a relatively minor role in positively regulating CMV activity. From these data we concluded that CMV promoter-mediated TGE in CHO cells is primarily a function of the intracellular levels of active NFκB and CBTFs (and their co-activators). Surprisingly, removal of YY1 binding sites reduced CMV promoter-driven SEAP

production to < 45% compared to WTCMV control. However, due to TFRE overlap, scrambling of YY1 elements also disrupted 4 NFκB/CRE binding sites in the YY1-KO-CMV

construct. Taken together with Figure 4, these data suggest that YY1 negatively regulates CMV promoter activity by preventing transcriptional activators from binding to these NFκB and CRE sites. We therefore concluded that CMV-driven TGE may be optimized by disrupting YY1-mediated transrepression, but that this cannot be achieved by simply scrambling YY1 binding sites.


Page 15


4. Discussion

Accepted Article

In this study we have determined the mechanistic regulation of CMV promoter-mediated TGE in CHO cells. CMV-driven transient SEAP production was decreased by ~ 50% when either i) NFκB or CRE-binding TFs (CBTFs) were prevented from binding at the CMV promoter or ii) NFκB sites were removed from the promoter sequence. Whilst removal of CRE sites in isolation did not significantly affect TGE, SEAP production was almost entirely dependent on CRE elements when NFκB-mediated transactivation was disrupted. Inhibition of transactivation mediated by both elements simultaneously reduced SEAP production to < 20 %. These data clearly illustrate that CMV promoter activity in CHO cell TGE systems is predominantly mediated through NFκB and CRE sites. This finding is in line with previous studies showing that CRE and NFκB elements are the key positive regulators of CMV promoter-driven TGE in human cell lines [28 - 30]. Further, it correlates with our recent work demonstrating that both elements are highly active in CHO cells [15]. Our data suggest that NFκB and CBTFs function cooperatively to mediate

transactivation via NFκB binding sites. NFκB has been shown to interact with multiple CBTFs, including CRE-binding protein (CREB), c-fos and c-jun [31 - 33]. It has been demonstrated that CREB can function via these interactions to increase NFκB-mediated transactivation [34, 35]. Indeed, previous studies have found that NFκB and CREB synergistically transactivate the CMV promoter in human cell lines by forming TF complexes [36, 29]. Here, our findings indicate that CBTFs regulate CMV-mediated TGE via indirect mechanisms (i.e. increasing NFκB activity) when conditions are optimal, and via direct mechanisms (i.e. by binding at CRE sites) when NFκB-mediated transactivation is impaired. This is in line with previous studies showing that CBTF-mediated regulation of CMV promoter activity can be either CRE-specific or CRE-independent, depending on the host cell type [37, 38, 39, 36, 30]. Further, similar to this study, it has been demonstrated that CBTFs


Page 16


can switch between direct and indirect mechanisms to regulate CMV activity when host cell

Accepted Article

physiology changes or TFREs are removed from the promoter [40]. We have also identified a mechanism by which CMV-mediated TGE is negatively

regulated in CHO cells. When YY1 was prevented from binding to the CMV promoter transient SEAP production increased 1.5 fold, indicating that YY1 functions to repress CMV activity. YY1 has been shown to negatively regulate CMV activity in other cell types and mediates transrepression by recruiting co-repressor complexes and/or competing with activators for promoter binding sites [41 - 43]. With respect to the latter, YY1 sites overlap with, and are in close proximity to, multiple NFκB and CRE sites within the CMV promoter. When these overlapping sites were scrambled, such that neither YY1 nor NFκB/CBTFs could bind to them, transient SEAP production was reduced to < 45% compared to that deriving from the wild-type CMV promoter. Taken together, these data suggest that CMV promoter activity was 45%, 100%, or 150% depending on whether activators were unable to, competing to, or free to bind at these sites respectively. We therefore inferred that YY1 represses CMV-mediated TGE by competing with NFκB and CBTFs for overlapping binding sites.

We conclude that CMV promoter-mediated TGE in CHO cells may vary across a 7-

fold range during production processes as a function of fluctuations in intracellular abundances of YY1, NFκB and CBTFs (i.e. promoter activity may vary between ~ 20% - ~ 150%). Transient protein production yields may therefore be improved by specifically controlling NFκB-, CBTF- and YY1-mediated regulation of CMV promoter activity. The NFκB family consists of five members (RelA, RelB, c-Rel, p50 and p52) that form heterodimeric and homodimeric complexes [44]. The most widely studied CBTF is CREB, which binds to CRE as either homodimers or heterodimers with other members of the CREBATF superfamily [45]. Given that NFκB family members and CREB are common oncogenes


Page 17


promoting uncontrolled proliferation and suppressed apoptosis, we would anticipate that they

Accepted Article

are already abundant in CHO cells to transactivate CMV. We have previously shown that transcriptional activity of synthetic promoters in CHO cells is correlated with increasing copies of NFkB sites [15]. It is therefore likely that increasing the copy numbers of NFkB and/or CRE sites within the CMV promoter will enhance transcriptional output. Similarly,

YY1-mediated transrepression of the CMV promoter could be removed by designing synthetic CMV constructs with inactive YY1 sites but containing a full, or enhanced, complement of NFκB and CRE sites. This could be achieved by introducing single base changes into YY1 sites, as opposed to the scrambling technique applied in this study which simultaneously disrupted overlapping NFκB/CRE sites. Specifically engineering these three

TFREs should provide optimal solutions for maximizing CMV-promoter mediated TGE in CHO cells. In conclusion, this is the first study to determine the mechanistic interactions

underpinning CMV promoter activity in the most important mammalian host cell type for biopharmaceutical manufacturing. Up until now, the means by which the CMV promoter is functional within the CHO host cell background has not been well understood, and this lack of knowledge has prevented precise control or improvement of its transcriptional activity. We have now identified the key functional regulators of CMV activity in CHO cells, and we expect that this information can be used in the rational design of novel synthetic CMV promoter variants in order to optimize TGE in CHO cells.


Page 18


Acknowledgements

Accepted Article

This work was supported by UCB and the Engineering and Physical Sciences Research Council.

The authors declare no financial or commercial conflict of interest.

5. References [1] Daramola, O., Stevenson, J., Dean, G., Hatton, D., et al., A high‐yielding CHO transient

system: Coexpression of genes encoding EBNA‐1 and GS enhances transient protein expression. Biotechnol. Prog. 2013, 30, 132-141. [2] Mozley, O. L., Thompson, B. C., Fernandez‐Martell, A., James, D. C., A mechanistic dissection of polyethylenimine mediated transfection of CHO cells to enhance the efficiency of recombinant DNA utilization. Biotechnol. Prog. 2014. DOI: 10.1002/btpr.1932 [3] Zustiak, M. P., Jose, L., Xie, Y., Zhu, J., Betenbaugh, M. J., Enhanced transient recombinant protein production in CHO cells through the co‐transfection of the product gene

with Bcl‐xL. Biotechnol. J. 2014, 9, 1164-1174 [4] Cain, K., Peters, S., Hailu, H., Sweeney, B., et al., A CHO cell line engineered to express XBP1 and ERO1‐Lα has increased levels of transient protein expression. Biotechnol. Prog. 2013, 29, 697-706. [5] Rajendra, Y., Kiseljak, D., Baldi, L., Hacker, D. L., Wurm, F. M., A simple high-yielding process for transient gene expression in CHO cells. J. Biotechnol. 2011, 153, 22-26. [6] Wulhfard, S., Tissot, S., Bouchet, S., Cevey, J., et al., Mild hypothermia improves transient gene expression yields several fold in Chinese hamster ovary cells. Biotechnol. Prog. 2008, 24, 458-465.


Page 19


[7] Meier, J. L., Stinski, M. F., Major immediate-early enhancer and its gene products. In:

Accepted Article

Reddehase, M. (Ed.), Cytomegaloviruses: from molecular pathogenesis to intervention 2013. Caister Academic Press, Norfolk, pp 152-173. [8] Stinski, M. F., Isomura, H., Role of the cytomegalovirus major immediate early enhancer in acute infection and reactivation from latency. Med. Microbiol. Immunol. 2008, 197, 223-

231.

[9] Mella-Alvarado, V., Gautier, A., Le Gac, F., Lareyre, J.-J., Tissue and cell-specific transcriptional activity of the human cytomegalovirus immediate early gene promoter (UL123) in zebrafish. Gene Expr. Patterns 2013, 13, 91-103. [10] Vasey, D., Lillico, S., Sang, H., King, T., Whitelaw, C., CMV enhancer–promoter is preferentially active in exocrine cells in vivo. Transgenic Res. 2009, 18, 309-314. [11] McGrew, M. J., Sherman, A., Ellard, F. M., Lillico, S. G., et al., Efficient production of

germline transgenic chickens using lentiviral vectors. EMBO Rep. 2004, 5, 728-733.

[12] Qin, J. Y., Zhang, L., Clift, K. L., Hulur, I., et al., Systematic Comparison of Constitutive Promoters and the Doxycycline-Inducible Promoter. PloS One 2010, 5, e10611. [13] Schlabach, M. R., Hu, J. K., Li, M., Elledge, S. J., Synthetic design of strong promoters.

Proc. Natl. Acad. Sci. U. S. A. 2010, 107, 2538.

[14] Coulon, A., Chow, C. C., Singer, R. H., Larson, D. R., Eukaryotic transcriptional dynamics: from single molecules to cell populations. Nat. Rev. Genet. 2013, 14, 572-584. [15] Brown, A. J., Sweeney, B., Mainwaring, D. O., James, D. C., Synthetic promoters for CHO cell engineering. Biotechnol. Bioeng. 2014, 111, 1638-1647. [16] Datta, P., Linhardt, R. J., Sharfstein, S. T., An'omics approach towards CHO cell engineering. Biotechnol. Bioeng. 2013, 110, 1255-1271.

[17] Schug, J., Using TESS to predict transcription factor binding sites in DNA sequence. Curr. Protoc. Bioinform. 2008, 21, 2.6.1-2.6.15


Page 20


[18] Manke, T., Roider, H. G., Vingron, M., Statistical modeling of transcription factor

Accepted Article

binding affinities predicts regulatory interactions. PLoS Comput. Biol. 2008, 4, e1000039. [19] Baycin-Hizal, D., Tabb, D. L., Chaerkady, R., Chen, L., et al., Proteomic analysis of Chinese hamster ovary cells. J. Proteome Res. 2012, 11, 5265-5276. [20] Brown, A. J., Mainwaring, D. O., Sweeney, B., James, D. C., Block decoys: Transcription-factor decoys designed for in vitro gene regulation studies. Anal. Biochem. 2013, 443, 205-210. [21] Skoko, N., Baralle, M., Tisminetzky, S., Buratti, E., InTRONs in Biotech. Mol.

Biotechnol. 2011, 48, 290-297. [22] Lashmit, P. E., Lundquist, C. A., Meier, J. L., Stinski, M. F., Cellular repressor inhibits human cytomegalovirus transcription from the UL127 promoter. J. Virol. 2004, 78, 5113-

5123.

[23] Mariati, N. Y., Chao SH, Yap MG, Yang Y., Evaluating regulatory elements of human cytomegalovirus major immediate early gene for enhancing transgene expression levels in CHO K1 and HEK293 cells. J. Biotechnol. 2010, 147, 160-163. [24] Hargrove, J. L., Schmidt, F. H., The role of mRNA and protein stability in gene expression. FASEB J. 1989, 3, 2360-2370. [25] Bielinska, A., Shivdasani, R. A., Zhang, L., Nabel, G. J., Regulation of gene expression with double-stranded phosphorothioate oligonucleotides. Science 1990, 250, 997-1000. [26] Golebiowski, F. M., Górecki, A., Bonarek, P., Rapala‐Kozik, M., et al., An investigation of the affinities, specificity and kinetics involved in the interaction between the Yin Yang 1 transcription factor and DNA. FEBS J. 2012, 279, 3147-3158.

[27] van Helden, J., André, B., Collado-Vides, J., Extracting regulatory sites from the upstream region of yeast genes by computational analysis of oligonucleotide frequencies. J.

Mol. Biol. 1998, 281, 827-842.


Page 21


[28] DeMeritt, I. B., Milford, L. E., Yurochko, A. D., Activation of the NF-κB pathway in

Accepted Article

human cytomegalovirus-infected cells is necessary for efficient transactivation of the major immediate-early promoter. J. Virol. 2004, 78, 4498-4507. [29] He, B., Weber, G. F., Synergistic activation of the CMV promoter by NF-κB P50 and PKG. Biochem. Biophys. Res. Commun. 2004, 321, 13-20. [30] Hunninghake, G., Monick, M., Liu, B., Stinski, M., The promoter-regulatory region of the major immediate-early gene of human cytomegalovirus responds to T-lymphocyte stimulation and contains functional cyclic AMP-response elements. J. Virol. 1989, 63, 3026-

3033.

[31] McKay, L. I., Cidlowski, J. A., CBP (CREB binding protein) integrates NF-κB (nuclear factor-κB) and glucocorticoid receptor physical interactions and antagonism. Mol. Endocrinol. 2000, 14, 1222-1234. [32] Walker, W. H., Fucci, L., Habener, J., Expression of the gene encoding transcription factor cyclic adenosine 3', 5'-monophosphate (cAMP) response element-binding protein

(CREB): regulation by follicle-stimulating hormone-induced cAMP signaling in primary rat Sertoli cells. Endocrinology 1995, 136, 3534-3545. [33] Stein, B., Cogswell, P., Baldwin, A., Functional and physical associations between NFkappa B and C/EBP family members: a Rel domain-bZIP interaction. Mol. Cell. Biol. 1993,

13, 3964-3974. [34] Haack, K. K., Mitra, A. K., Zucker, I. H., NF-κB and CREB Are Required for Angiotensin II Type 1 Receptor Upregulation in Neurons. PloS One 2013, 8, e78695. [35] Spooren, A., Kooijman, R., Lintermans, B., Van Craenenbroeck, K., et al., Cooperation of NFκB and CREB to induce synergistic IL-6 expression in astrocytes. Cell. Signalling 2010, 22, 871-881.


Page 22


[36] Lashmit, P., Wang, S., Li, H., Isomura, H., Stinski, M. F., The CREB site in the

Accepted Article

proximal enhancer is critical for cooperative interaction with the other transcription factor binding sites to enhance transcription of the major intermediate-early genes in human cytomegalovirus-infected cells. J. Virol. 2009, 83, 8893-8904. [37] Chia, Y. L., Ng, C. H., Lashmit, P., Chu, K. L., et al., Inhibition of human cytomegalovirus replication by overexpression of CREB1. Antiviral Res. 2014, 102, 11-22. [38] Rodova, M., Jayini, R., Singasani, R., Chipps, E., Islam, R., CMV-promoter is repressed by p53 and activated by JNK pathway. Plasmid. 2013, 69, 223-230 [39] Liu, X., Yuan, J., Wu, A. W., McGonagill, P. W., et al., Phorbol Ester-Induced Human Cytomegalovirus Major Immediate-Early (MIE) Enhancer Activation through PKC-Delta, CREB, and NF-κB Desilences MIE Gene Expression in Quiescently Infected Human Pluripotent NTera2 Cells. J. Virol. 2010, 84, 8495-8508. [40] Keller, M., Wheeler, D., Cooper, E., Meier, J., Role of the human cytomegalovirus major immediate-early promoter's 19-base-pair-repeat cyclic AMP-response element in acutely infected cells. J. Virol. 2003, 77, 6666-6675.

[41] Gordon, S., Akopyan, G., Garban, H., Bonavida, B., Transcription factor YY1: structure, function, and therapeutic implications in cancer biology. Oncogene 2006, 25, 1125-1142. [42] Pizzorno, M. C., Nuclear cathepsin B-like protease cleaves transcription factor YY1 in differentiated cells. Biochim. Biophys. Acta 2001, 1536, 31-42. [43] Liu, R., Baillie, J., Sissons, J. P., Sinclair, J. H., The transcription factor YY1 binds to negative regulatory elements in the human cytomegalovirus major immediate early enhancer/promoter and mediates repression in nonpermissive cells. Nucleic Acids Res. 1994,

22, 2453-2459. [44] Hayden, M. S., Ghosh, S., NF-κB, the first quarter-century: remarkable progress and outstanding questions. Genes Dev. 2012, 26, 203-234.


Page 23


[45] Sakamoto, K. M., Frank, D. A., CREB in the pathophysiology of cancer: implications

Accepted Article

for targeting transcription factors for cancer therapy. Clin. Cancer Res. 2009, 15, 2583-2587. [46] Isomura, H., Stinski, M. F., Kudoh, A., Daikoku, T., et al., Two Sp1/Sp3 binding sites in the major immediate-early proximal enhancer of human cytomegalovirus have a significant role in viral replication. J. Virol. 2005, 79, 9597-9607. [47] Ghazal, P., DeMattei, C., Giulietti, E., Kliewer, S. A., et al., Retinoic acid receptors initiate induction of the cytomegalovirus enhancer in embryonal cells. Proc. Natl. Acad. Sci. U. S. A. 1992, 89, 7630-7634. [48] Prösch, S., Heine, A.-K., Volk, H.-D., Krüger, D. H., CCAAT/enhancer-binding proteins α and β negatively influence the capacity of tumor necrosis factor α to up-regulate the human cytomegalovirus IE1/2 enhancer/promoter by nuclear factor κB during monocyte

differentiation. Biol. Chem. 2001, 276, 40712-40720. [49] Wright, E., Bain, M., Teague, L., Murphy, J., Sinclair, J., Ets-2 repressor factor recruits

histone deacetylase to silence human cytomegalovirus immediate-early gene expression in non-permissive cells. J. Gen. Virol. 2005, 86, 535-544.

[50] Caposio, P., Luganini, A., Bronzini, M., Landolfo, S., Gribaudo, G., The Elk-1 and

serum response factor binding sites in the major immediate-early promoter of human cytomegalovirus are required for efficient viral replication in quiescent cells and compensate for inactivation of the NF-κB sites in proliferating cells. J. Virol. 2010, 84, 4481-4493. [51] Zweidler-McKay, P. A., Grimes, H. L., Flubacher, M. M., Tsichlis, P. N., Gfi-1 encodes a nuclear zinc finger protein that binds DNA and functions as a transcriptional repressor. Mol.

Cell. Biol. 1996, 16, 4024-4034.


Page 24


Table 1: In silico analysis of CMV promoter activity regulation in CHO cells. The CMV

Accepted Article

promoter was surveyed for the presence of discrete transcription factor regulatory elements (TFREs) using Transcription Element Search System (TESS) and Transcription Affinity Prediction (TRAP) algorithms. The potential regulatory function of identified TFREs was determined by an in silico analysis of data from previous studies. TFREs were considered likely effectors of CMV-mediated TGE in CHO cells (underlined) if they either i) had previously been shown to be active in CHO cells, or ii) had both previously been identified as a regulator of CMV activity in other cell types and been shown to have potential cognate binding partners present within the CHO cell TF repertoire.

Transcription Copy

Active in CHO

Cognate TFs

Known regulator

factor

number in

cell TFRE

present in CHO

of CMV activity in

regulatory

CMV

functional

cell proteome

other cell types?

element

promoter

screen [15]?

[19]? (example)

(example)

CRE

7

9

9 (CREB1)

9 [36]

GC-box

7

9

9 (SP3)

9 [46]

NFκB

4

9

9 (RELA)

9 [39]

RARE

3

9

9 (RXRβ)

9 [47]

C/EBP

1

9

9 (C/EBPζ)

9 [48]

E4F1

2

9

X

X

YY1

6

X

9 (YY1)

9 [42]

NF1

3

X

9 (NF1B)

9 [36]

ERF

3

X

X

9 [49]

CArG

1

X

X

9 [50]

Gfi1

1

X

X

9 [51]

MSX

2

X

X

X


Page 25


Accepted Article

Figure Legends

Figure 1: Extension sequences do not augment CMV promoter-mediated transient gene expression. The CMV promoter was inserted into GFP reporter vectors in association with

varying extension sequences from within the viral genome (the structural elements contained within these extensions are shown; numbers refer to nucleotide positions relative to the transcriptional start site). The 5’ and 3’ CMV promoter extension sequences were also cloned into GFP reporters in isolation, upstream and downstream of a minimal CMV core promoter respectively. CHO-S cells (2 x 105) in 24-well plates were transfected with 300ng of GFP reporter vectors and GFP expression was quantified 24 h post-transfection. Data are expressed as a percentage of the production exhibited by the CMV promoter alone (P). Bars represent the mean + SD of three independent experiments each performed in triplicate. P = promoter; 5’E = 5’ extension; 3’E = 3’ extension.

Accepted Article

www.biottechnology-jou urnal.com

Page 26

Biotechnolog gy Journal

Figure 2: A map of transcrription facttor binding g sites with hin the CM MV promotter. The

CMV ppromoter was w surveyeed for the ppresence off discrete transcription t n factor regulatory elementts (transcripption factor binding sites) using g Transcrip ption Elemeent Search System (TESS)) and Transscription Affinity A Preddiction (TR RAP) algorrithms, usinng stringentt search parametters to miniimise false positives. N Numbers reefer to nucleeotide posittions relativ ve to the transcriiptional starrt site.

Accepted Article


Page 27


Figure 3: Relatiive transcrriptional aactivity ex xhibited by y discrete CMV prromoter

structu ural elemen nts. A) The CMV prom moter contaiins discrete structural eelements, in ncluding the disstal and prroximal pro omoters annd multiplee cis-regulaatory moduules (CRM Ms). The transcriiption factoor regulatory y element (TFRE) co omposition of these ellements is depicted d (only T TFREs identtified in silicco as likelyy regulators of CMV acctivity are shhown, see Table T 1). B) Eachh element was w cloned d upstream of a minim mal CMV core promotter in GFP reporter plasmidds and trannsfected intto CHO-S cells. GFP P expression was quaantified 24 h posttransfecction. Data are expressed as a peercentage of o the produ uction exhib ibited by th he CMV promoteer alone (C CMV). Barrs representt the mean + SD of th hree indepeendent expeeriments each peerformed in triplicate.

Page 28


Accepted Article


Figure 4: CMV promoter-m p mediated TG GE is regulated by NFκB, YY1 and CRE-binding

A) CHO-S cells c (2 x 105) were coo-transfecteed with 500 0 ng of CM MV promoteer-SEAP TFs. A reporterr plasmid annd 2 µg of transcriptio t on factor (TF F) decoys taargeting diffferent transscription factor rregulatory elements e (TF FREs). B) C CHO-S cellls (2 x 105) were co-traansfected with w 3 µg of chim meric TF decoys d (targ geting moree than one TFRE) an nd 500 ng of CMV-p promoter reporterr plasmid. Control C scraambled decooys contain ned scrambled TFRE seequences. Chimeric C decoys targeting NFκB N or CR RE alone coontained co onsensus an nd scrambleed TFRE seequences


Page 29


(e.g. NFκB-specific decoy contained an NFκB-consensus and a CRE-scrambled sequence).

Accepted Article

SEAP expression was quantified 24 h post-transfection. Each bar shows SEAP expression in decoy treated cells relative to expression with the same concentration of either A) decoys containing a random 8 bp sequence with no known homology to TFRE sequences (8mer control) or B) scrambled decoy control. In A and B each bar represents the mean + SD of three independent experiments performed in triplicate.

Figure 5: A synthetic CMV promoter devoid of NFκB and CRE sites drives minimal transient protein production. Synthetic CMV promoters with varying TFREs knocked out (i.e. sequences scrambled) were synthesized and cloned into SEAP reporter vectors. The relative activity of each synthetic CMV promoter construct was determined in CHO-S and CHO-K1 cells. Cells (2 x 105) were transfected with 300 ng of SEAP-reporter vectors, and

SEAP production was quantified 24 h post-transfection. Data are expressed as a percentage of the activity of the wild-type CMV promoter in each cell line. Bars represent the mean + SD of three independent experiments each performed in triplicate.

MicroRNA: key gene expression regulators.

Toward stable gene expression in CHO cells.

MicroRNAs are key regulators of brown adipogenesis.

Effect of Peptone Feeding on Transient Gene Expression Process in CHO DG44.

Master regulators of posttranscriptional gene expression are subject to regulation.

Yy1 gene dosage effect and bi-allelic expression of Peg3.

Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

Insertion of core CpG island element into human CMV promoter for enhancing recombinant protein expression stability in CHO cells.

Functional expression of human 5-HT1A receptors and differential coupling to second messengers in CHO cells.

Abstract 144: cd4+ cells are key regulators of pathologic changes in lymphedema.

BET proteins are a key component of immunoglobulin gene expression.

Dendritic Cells as Vaccines: Key Regulators of Tolerance and Immunity.

Negative control of the helix-loop-helix family of myogenic regulators in the NFB mutant.

piRNAs, master regulators of gene expression.

Retrotransposons as regulators of gene expression.

Hypoxia-inducible factors: key regulators of myeloid cells during inflammation.

mRNA modifications: Dynamic regulators of gene expression?

Sp1 sites in the noncoding control region of BK polyomavirus are key regulators of bidirectional viral early and late gene expression.

Stress induced gene expression drives transient DNA methylation changes at adjacent repetitive elements.

Photo-activatable Cre recombinase regulates gene expression in vivo.

Retina-specific gene excision by targeted expression of Cre recombinase.

Regulatory elements in the introns of the human HPRT gene are necessary for its expression in embryonic stem cells.

Expression-based GWAS identifies variants, gene interactions and key regulators affecting intramuscular fatty acid content and composition in porcine meat.

Identification and Functional Characterization of Cis-Regulatory Elements Controlling Expression of the Porcine ADRB2 Gene.