New host records for European Acroceridae (Diptera), with discussion of species limits of Acrocera orbiculus (Fabricius) based on DNA-barcoding.

Zootaxa 3780 (1): 135–152 www.mapress.com /zootaxa / Copyright © 2014 Magnolia Press

Article

ISSN 1175-5326 (print edition)

ZOOTAXA

ISSN 1175-5334 (online edition)

http://dx.doi.org/10.11646/zootaxa.3780.1.5 http://zoobank.org/urn:lsid:zoobank.org:pub:86473618-EA0D-40A4-BDE0-452A60233ED8

New host records for European Acroceridae (Diptera), with discussion of species limits of Acrocera orbiculus (Fabricius) based on DNA-barcoding CHRISTIAN KEHLMAIER1 & JORGE MOTA ALMEIDA2 1

c/o Senckenberg Natural History Collections Dresden, Museum of Zoology, Koenigsbruecker Landstrasse 159, 01109 Dresden, Germany. E-mail: [email protected] 2 Rua da Póvoa Dão, Casal Jusão, P-3500-532 Silgueiros, Viseu, Portugal. E-mail: [email protected]

Abstract New European host records for the Acroceridae species Acrocera orbiculus (Fabricius) and Ogcodes reginae Trojan are reported. Acrocera orbiculus was reared from Amaurobius erberi (Keyserling), and O. reginae from Clubiona leucaspis (Simon) and Evarcha jucunda (Lucas). Where possible, DNA-barcodes are presented for reared endoparasitoids and their host specimens. Based on mitochondrial COI, the intraspecific genetic variability of 15 western Palaearctic A. orbiculus is discussed. Maximum likelihood analysis reveals two clades, though they have low statistical support and no distinct barcoding gap. Therefore, we consider all barcoded specimens of A. orbiculus to be a single biological species with a high degree of phenotypic plasticity regarding body size and coloration. Based on molecular and morphological evidence, Paracrocera kaszabi Majer, Paracrocera manevali Séguy and Paracrocera minuscula Séguy are placed in synonymy with A. orbiculus. The male of the Canary Islands endemic Acrocera cabrerae Frey is described for the first time. Key words: small-headed flies, spider flies, Ogcodes reginae, Araneomorphae, new synonymies, intra-specific genetic variation

Introduction Currently, about 530 species of Acroceridae or small-headed flies are placed within three subfamilies comprising 55 genera (Barneche et al. 2013; Schlinger et al. 2013; Winterton & Gillung 2012). Most known Acroceridae larvae develop as endoparasitoids in the opisthosoma of true spiders (Araneae), undergoing a distinct hypermetamorphosis, i.e., each larval instar is morphologically unique and has a distinctive lifestyle (Schlinger 2003). Known exceptions include the Neotropical Sphaerops appendiculata Philippi, developing as an ectoparasitoid on Ariadna maxima (Nicolet) (Segestriidae) (Schlinger 1987), and recent findings by Sferra (1986) and Kerr & Winterton (2008) remarking the presence of first instar larvae on Acari. Synopses of the family’s life history are given by Nartshuk (1997) and Schlinger (2003). The first detailed phylogenetic reconstruction of the family was presented by Winterton et al. (2007), which rendered Acrocerinae paraphyletic with Acrocera Meigen and Sphaerops Philippi situated at the base of the Acroceridae. Since the discovery of the parasitic lifestyle in Acroceridae (Menge 1866), at least 63 species (about 12% of the world fauna) have been recorded from 24 of the more than 100 spider families (Schlinger 1987, 2003; Barneche et al. 2013). At present, no comprehensive index of host-parasite relationships can be found in the literature, but extensive overviews were compiled by Eason et al. (1967) and Schlinger (1987). Acrocera orbiculus (Fabricius), also known as the ‘top-horned hunchback’ (Stubbs & Drake 2001), is a Holarctic species and one of the most frequently collected Acroceridae in the western Palaearctic. Chvála (1980) commented extensively on the taxonomic challenge of A. orbiculus and concluded that Syrphus globulus Panzer is synonymous with A. orbiculus, as originally proposed by Gil Collado (1929—under the name A. globulus) and Schlinger (1965), but that a possible second distinct unnamed species has been addressed as A. globulus by various authors (Sack 1936; Trojan 1956; Weinberg 1966). He listed this taxon as “sp. (globula PANZ.)” in his identification key and differentiates it from A. orbiculus by the somewhat darkened femora and a slightly larger Accepted by N. Evenhuis: 7 Feb. 2014; published: 20 Mar. 2014

135

body size. No subsequent clarification of this issue has been attempted, although Weinberg (1984) briefly commented that the observed variability in body coloration and size might rather be linked to the host of the developing larva. Here, we present three new host relationships for Ogcodes reginae Trojan and A. orbiculus. Whereas adult acrocerid flies could be identified morphologically, their subadult and distorted host spiders could only be identified morphologically to genus level in two of three cases. Species determination was eventually resolved using DNA-barcoding (Hebert et al. 2003). We also comment on the intraspecific genetic variability within 15 western Palaearctic A. orbiculus specimens, based on their DNA-barcodes. Furthermore, we provide the first description of the male of the Canary Islands endemic A. cabrerae Frey.

Material and methods The material was either collected by the authors, fellow arachnologists/entomologists, or originated from larger trapping projects as indicated in the Appendix. The specimens are stored as dry or ethanol preserved material. Collection abbreviations: KBIN HNHM MNHN MNHU MZH NHMW PCCK PCJM SEMC TMNH UMO USNM ZML ZMUC

Koninklijk Belgisch Instituut voor Natuurwetenschappen, Brussels, Belgium. Hungarian National History Museum, Budapest, Hungary. Muséum National d’Histoire Naturell, Paris, France. Museum für Naturkunde Humboldt-Universität, Berlin, Germany. Finnish Museum of Natural History, Helsinki, Finland. Naturhistorisches Museum, Wien, Austria. Personal collection Christian Kehlmaier. Personal collection Jorge Mota Almeida. Snow Entomological Museum, University of Kansas, Lawrence, Kansas, USA. Tianjin Natural History Museum, PR China. University Museum of Natural History, Hope Entomological Collections, Oxford, Great Britain. National Museum of Natural History, Washington D.C., USA. Museum of Zoology, Lund University, Sweden. Zoological Museum, University of Copenhagen, Denmark.

Genomic DNA was extracted using the innuPREP DNA Mini Kit of Analytik Jena AG (Jena, Germany). DNA-Barcodes were generated using the primer pair LCO1490 (5′–GGTCAACAAATCATAAAGATATTGG–3′) and HCO2198 (5′–TAAACTTCAGGGTGACCAAAAAATCA–3′) (Folmer et al. 1994). PCR conditions were an initial 94 °C for 4 min, 35 cycles of 94 °C for 30 s, 50 °C for 30 s, 72 °C for 45 s, final elongation of 72 °C for 10 min. Each PCR was performed with 1–5 μl of DNA extraction in a 20 μl volume (1 μl of each primer at 10 pmol, 1 μl of dNTP-mix at 10 nmol each dNTP, and 1 unit of Taq polymerase (Bioron DFS Taq, Ludwigshafen, Germany), 2 μl PCR buffer 10× incl. MgCl2, ultra pure H2O). Cleaning of PCR and sequencing-PCR products were performed by salt-ethanol precipitation using 4M NH4Ac (PCR) or 3M NaAc (PCRsequencing). For sequencing-PCR the same forward and reverse primers were used in a total reaction volume of 10 μl (2 μl sequencing buffer, 1 μl premix, 1 μl primer at 5pmol concentration, 0.5–6 μl of DNA template, ultra pure H2O) with 25–30 cycles of 96 °C for 10 s, 50 °C for 5 s and 60 °C for 4 min using the ABI PRISM Big Dye Terminator v.3.1 Cycle Sequencing Kit (Applied Biosystems). Sequencing was done on an ABI 3130XL Genetic Analyser. PCR products were visualised on a 1% agarose gel. The resulting spider barcodes were used to corroborate the morphological identifications by comparing them to a set of reference barcodes obtained from GenBank and BOLD (www.barcodinglife.org). To explore the genetic variability within A. orbiculus, uncorrected pairwise genetic distances (p-dist) were computed with MEGA5 (Tamura et al. 2011) using all sites and pairwise deletion for missing data. In order to get a first hypothesis of the phylogenetic relationships between members of Acrocera at hand, and especially within A. orbiculus, a maximum likelihood (ML) analysis was conducted using MEGA5 (Tamura et al. 2011). The resulting gene tree is a scaled phylogram with branch lengths reflecting the amount of genetic change. The best-fitting

136 · Zootaxa 3780 (1) © 2014 Magnolia Press

KEHLMAIER ET AL.

evolutionary model was determined using jModelTest 2.1.2 (Darriba et al. 2012; Guindon & Gascuel 2003) and the Bayesian Information Criterion. Software settings for the ML-reconstruction were: Hasegawa-Kishino-Yano model; rates: gamma distributed with invariant sites; all codon positions and substitutions included. Branch support was assessed with 1000 bootstrap replicates (abbreviated as BT) (Felsenstein 1985). To further assess nodal stability, a Bayesian reconstruction was performed with MrBayes 3.2.1 (Ronquist & Huelsenbeck 2003) for 10 million generations, and the resulting posterior probabilities (abbreviated as PP) were plotted onto the phylogram from the ML-analysis. The COI dataset used was 658 bp long and comprised 23 specimens, including 15 A. orbiculus from Europe (France, Germany, Greece, Italy, Portugal, Spain and United Kingdom (Channel Islands)) and Western Asia (Iran). Character polarity was based on outgroup comparison (Nixon & Carpenter 1993). The Stratiomyidae Hermetia illucens (Linnaeus) and the Acroceridae Ogcodes basalis (Walker), O. canadensis Schlinger, Pterodontia sp., two European A. sanguinea and one A. cabrerae from Canary Islands and Turbopsebius sp. were used as outgroups (sequences partly taken from GenBank) and the tree rooted on H. illucens. GenBank sequence accession numbers are listed in the Appendix.

Results and discussion Host records Ogcodes reginae reared from Clubiona leucaspis (Simon) (Clubionidae) (fig. 1) Locality. France, Département Bouches du Rhône, La Ciotat, 5°37′54.2′′E 43°11′54.8′′N, 22.–30.VI.2011, leg. & reared by Hélène Dumas.

FIGURE 1. Pupa and adult of reared Ogcodes reginae Trojan from a subadult Clubiona leucaspis (Simon). A: Spider remains. B: Adult O. reginae. C: Pupa dorsal view. D: Pupa lateral view. Photos: Hélène Dumas.

Host. Subadult Clubiona leucaspis ♀ (DNA-voucher CK519). The spider remains allowed a genus level identification only. Species identification was achieved by entering our 564 bp long host spider COI sequence into the BOLD identification system (BIS). A search in the database “All Barcode Records on BOLD with a minimum

NEW ACROCERIDAE HOSTS

Zootaxa 3780 (1) © 2014 Magnolia Press ·

137

sequence length of 500 bp” (http://www.boldsystems.org/index.php/IDS_OpenIdEngine) (17.01.2013) retrieved 99.82% similarity with C. leucaspis from Italy (BOLD sample IDs: RMNH.ARA.16237 & RMNH.ARA.16190) and 98.91% similarity with C. leucaspis from Germany (BOLD sample IDs: BC ZSM ARA 00264 & BC ZSM ARA 00265), respectively. The second closest taxon, Clubiona comta C.L. Koch has a similarity of 93.26% only. Parasitoid. Ogcodes reginae ♀ (DNA-voucher CK518). Hélène Dumas spotted the Acroceridae pupa on 22.VI.2011 on a leaf of an Eleagnus Linnaeus plant in her garden, about 1.5 m above the ground. She collected the pupa together with two curled leaves that contained the spider remains. The fly emerged on 30.VI.2011 and was not very active, only walking a few steps in the rearing box. Ogcodes reginae reared from Evarcha jucunda (Lucas) (Salticidae) (fig. 2) Locality. Portugal, Distrito de Castelo Branco (district), Castelo Branco (parish), VIII–IX.2009, leg. Emídio Machado, reared by Ricardo Ramos da Silva. Host. Subadult Evarcha jucunda of unknown sex. The spider remnants were not preserved. The morphological identification is based on a series of photos (two photos reproduced here) and on the distribution of the genus on the Iberian Peninsula. In Portugal only E. jucunda and E. laetabunda (C.L. Koch) are known. Additionally, E. arcuata (Clerck), E. falcata (Clerck) and E. eriki Wunderlich are known from Spain and Canary Islands. Furthermore, Emídio Machado collected adult E. jucunda on other occasions at the same locality (Ramos da Silva in litt.). Parasitoid. Ogcodes reginae ♂ (DNA-voucher CK520). Emídio Machado was photographing and collecting spiders, bringing this subadult Evarcha to Ricardo Ramos da Silva for rearing. The behaviour of the salticid was perfectly normal and it was a great surprise that within a few days, the spider was totally consumed and all that remained was a small maggot. The pupal stage lasted for two weeks before the adult fly emerged on 7.IX.2009.

FIGURE 2. Juvenile Evarcha jucunda (Lucas), host specimen of Ogcodes reginae Trojan. A: Dorsal view. B: Lateral view. Photos: Emídio Machado.

Acrocera orbiculus from Amaurobius erberi (Keyserling) (Amaurobiidae) (fig. 3) Locality. France, Département Var, near Besse-sur-Isole, 43°19′39.60′′N 6°10′48.56′′E, Oct. 2011, leg & reared by Frits Broekhuis. Host. Subadult Amaurobius erberi ♂ (DNA-voucher CK564). Collected between dirt and stones in a garden on 16.X.2011. The spider died on 19.X.2011 with the emergence of the acrocerid larva. The host’s barcode was compared to a set of reference barcodes comprising four of the seven Amaurobius species cited for mainland France, including a sequence of an adult male A. erberi from the same locality (DNA-voucher CK665). The latter was collected on 2.VIII.2012 and moulted twice in captivity before becoming an adult in December 2012. Both A. erberi share an identical barcode, except a single substitution, whereas the next closest species differ by an uncorrected genetic pairwise distances of 5.7% (Amaurobius similis (Blackwall)) and 8.2% (Amaurobius fenestralis (Stroem)). Parasitoid. Acrocera orbiculus ♂ (DNA-voucher CK565). The time from the emergence of the larva from its host (19.X.2011) and the eclosion of the adult fly (1.XI.2011) lasted 15 days and is documented in fig. 3.


KEHLMAIER ET AL.

FIGURE 3. Last instar larva of Acrocera orbiculus (Fabricius) emerging from subadult Amaurobius erberi (Keyserling) and moulting into adult. A–B (16.X.2011): the spider shows no aberrant behaviour, despite a white marking at the dorsoanterior region of the opistosoma where the endoparasitoids will emerge (red arrow). C (19.X.2011, 8 a.m.): last instar larva fully emerged from host spider but is still attached. D (19.X.2011, 1 p.m.): last instar larva still attached to its host ingesting rest of opistosoma’s content, letting opistosoma shrivle. E (19.X.2011, 4 p.m.): last instar larva detached from its host. F (21.X.2011): praepupa of A. orbiculus. G (24.X.2011): pupa of A. orbiculus with prepupal skin and meconium attached to posterior body end. H (25.X.2011): matured pupa of A. orbiculus. I (01.XI.2011): emerged male adult of A. orbiculus. Photos: Frits Broekhuis.

Generally, little information is available on host specificity of Acroceridae. The most detailed host range has been documented for Ogcodes (∼100 species) with about 40 host-parasite relationships known, from at least 15 families of Araneomorphae, mostly belonging to the Lycosidae (Schlinger 1987; Barraclough & Croucamp 1997; de Jong et al. 2000; Cady et al. 1993; Eason et al. 1967; Langer 2005; Larrivée & Borkent 2009; Kehlmaier et al. 2012; this study). In Acrocera, almost 20 host-parasite relationships are known from 7 families of Araneomorphae, mostly Lycosidae and Agelenidae (Cady et al. 1993; Larrivée & Borkent 2009; Nielsen et al. 1999; Schlinger 1987; Toft et al. 2012; this study). Acrocera orbiculus is comparatively frequently encountered for an acrocerid (surely the most common acrocerid taxon in Europe) and has an Holarctic distribution, ranging from North America (Northwest Territories east to Ontario and Pennsylvania and south to California and Arkansas; Schlinger 1965) to the Palaearctic (from Scandinavia to North Africa, from Spain all through Russia and the Near East to China; Nartshuk 2013), possible also extending into the Afrotropics (a doubtful record from Ethiopia is listed in Nartshuk 1988). But despite this, only four rearing records from three spider families (Amaurobiidae, Clubionidae and Lycosidae) have been documented: Amaurobius erberi (this study), Pardosa prativaga (Nielsen et al. 1999; Toft et al. 2012), Lycosa spec. (as A. globulus in Nielsen 1932) and Clubiona spec. (cited in Schlinger 1987; original author unknown, probably Millot 1938). The life-cycle of A. orbiculus is relatively well known. Detailed accounts include swarming, oviposition behaviour and egg morphology (Edwards 1984; Ralley 1988) as well as larval morphology and development of early larval stages (Nielsen et al. 1999; Toft et al. 2012) and emergence from the host to adult eclosion (this study). Acrocerid larvae normally (but not always) leave their hosts before the spider reaches adulthood, and a morphological identification of the host to species level is often not possible. In this respect, DNA-barcoding is a



139

potentially powerful tool for overcoming this taxonomic gap, provided that a set of morphologically identified reference barcodes of the target group is available for comparison. The obtained molecular evidence also acts as a supplementary voucher, ensuring that future nomenclatural changes to host or parasitoid taxonomy, e.g., splitting of species aggregates, will be easy to incorporate, and the use of this technique is strongly advocated in any future work focusing on host parasitoid relationships.

Acrocera orbiculus—a species complex? Both molecular analyses of the COI-dataset yielded similar results, though with differing degrees of resolution. The maximum likelihood analysis reveals two clades within A. orbiculus (fig. 4). Clade A (six specimens/ localities) reaches from Spain to Iran and has good statistical support values (BT: 99 %) (fig. 6, Appendix). Clade B (nine specimens/localities) is confined to mountainous regions in northern Italy, southern France and central Portugal and is weakly supported (BT: 66%). Branch support can be increased if CK684 from Portugal is excluded and assigned to a separate clade C (BT: 81%). The Bayesian analysis (fig. 5) shows six evolutionary lineages within Acrocera placed in a basal polytomy, four of those comprising A. orbiculus. The only Bayesian clade of A. orbiculus with reasonable support (PP: 84) corresponds to clade A from the ML analysis. However, clade B is not supported and broken up into three lineages.

FIGURE 4. Maximum likelihood tree of COI dataset computed with MEGA5; software settings: HKY+G+I model, all positions and substitutions included. Support values of critical nodes are shown (left: bootstrap; right: posterior probabilities). Scale bar indicates 0.1 substitutions per amino acid position. Separate box on right hand side showing maximum intraspecific genetic distances (MAGD) within the individual clades as well as minimum interspecific genetic distance (MIGD) between clade A and B.


KEHLMAIER ET AL.

FIGURE 5. Bayesian topology of COI dataset. Bayesian posterior probabilities are plotted onto the phylogram. Scale bar indicates 0.1 substitutions per amino acid position.

Uncorrected genetic pairwise distances are summarised in table 1. The maximum intraspecific genetic variability of all A. orbiculus lies at 6.5% (CK565 and CK641), which is conspicuously large (see below). Within members of clade A, the maximum genetic distance is 4.0% (CK598 and CK641), and within members of clade B it is 4.4% (CK565 and CK684), respectively. The latter is reduced to 3.1% if CK684 is excluded. The minimum genetic distance between members of both clades lies at 3.6% (CK572 and CK609). Hence, there are at least members of clade A that are genetically closer to members of clade B than to other members of their own clade. When mapping and comparing the genetic variability within clade B (fig. 7), specimens sharing an almost identical barcode, (i.e., maximum genetic distance of 0.6%) and located in geographic proximity, are considered to belong to the same population. Thus, the nine specimens sampled represent five populations that are separated by a 2% or greater p-distance, pointing towards a low degree of gene flow amongst them. From a morphological perspective, no clear differences could be observed between the two clades, other than males and females of clade B tend to have slightly darker leg coloration compared to members of clade A (table 2), the main feature used by Chvála (1980) to distinguish between the two forms. Therefore, it is assumed that clade B corresponds to “sp. (globula PANZ.)” of Chvála (1980), with the exception of specimen CK599 of clade B which is slightly paler than CK641 of clade A. No structural differences were observed in the male genitalia. Nartshuk (1982) highlighted the high variability of A. orbiculus in terms of body size and coloration, by distinguishing ten different colour forms of abdominal tergites 2–4 (4 in males and 6 in females) based on 22 specimens (8♂ 14♀) from the Saint Petersburg area. Our findings include a series of 12 ♀ from the Ore Mountains (south-eastern Germany) and 79 ♀ from the Parc Naturel Régional des Pyrénées Ariégeoises (southern France) (see table 1 for label and deposition data) that vary considerably in body size and abdominal coloration. This high degree of phenotypic plasticity is illustrated in fig. 8 for voucher specimens CK680 (2.5 mm body length), showing small yellow markings on tergite 3 and 4 only, and CK681 (4.2 mm body length), with small yellow markings on tergite 2 and predominantly yellow tergites 3 & 4. Both specimens were collected at the same locality and share an identical DNA-barcode.



141

Table 1. Uncorrected genetic distances of COI dataset.


KEHLMAIER ET AL.

TABLE 2. Variability in leg coloration between males and females of clades A and B. Clade A

Clade B

Coloration of legs Yellow except distitarsi dark brown. [n=3] in males

Yellow except fore and mid coxa on anterior surface and fore femora especially in basal half light brown; distitarsi dark brown. [n=1]

Coloration of legs Yellow except coxae light brown on anterior in females surface; femora yellow to light brown except at base and apex; tibiae yellow to light brown medially; tarsal segments yellow to light brown; distitarsi dark brown. [n=4]

Yellow except coxae light to mid brown on anterior surface; femora light to mid brown except at base and apex; tibiae yellow to mid brown medially; tarsal segments yellow to mid brown; distitarsi dark brown. [n=5]

FIGURE 6. Geographic distribution of DNA barcoded A. orbiculus (empty circle: clade A; empty star: clade B) and type locality (full circle) of 1) Syrphus orbiculus; 2) Paracrocera manevali; 3) Paracrocera minuscula; 4) Acrocera laeta.

Based on the molecular and morphological results presented for A. orbiculus, Chvála’s (1980) assumption of an unnamed taxon “sp. (globula PANZ.)” cannot be supported. Even though the maximum likelihood analysis shows two clades, the low statistical support and the lack of resolution in the Bayesian reconstruction do not support the presence of multiple cryptic species within A. orbiculus. Furthermore, the absence of a distinct “barcoding gap” between the two clades points towards a genetic continuum between clade A and B. On the other hand, such an overlap has repeatedly been observed (e.g. Kehlmaier & Assmann 2008; Smith et al. 2006) to the point that morphologically distinct species can share an identical DNA-barcode (e.g. Skevington et al. 2007). In the case of A. orbiculus, no consistent morphological differences between the two clades were detected in either genital morphology or body coloration. Whereas body size is positively correlated with host size (i.e., food supply) in at least some endoparasitic Diptera like Pipunculidae (Kehlmaier, pers. observ.), body coloration might be influenced by thermal conditions during pupal development, as documented for some Syrphidae (Dušek & Láska 1974, Ottenheim et al. 1995). Also, quantity and quality of food might vary to such a degree that it directly effects the forming of body pigmentation in the cuticle, assuming that the development of pale markings requires more energy than dark markings (see Gilbert 2005 for a summary of this issue). The pattern of abdominal variability according to body size in A. orbiculus has also been observed in the syrphid Pelecocera tricincta Meigen whose larval feeding mode is still unknown (Kehlmaier 2002). In recent years, there has been some dispute as to whether a fixed threshold of genetic divergence of the COI gene can be applied for species delimitation, i.e., Hebert et al. (2003) suggesting 3% for Lepidoptera and Hebert et al. (2004) postulating a ‘10× divergence criterion’. If applied here, a 3% threshold would lead to an unjustifiable/ unnecessary splitting of A. orbiculus, considering that the specimens barcoded have an average p-distance of 4.0%. The ‘10× divergence criterion’ would ultimately lead to the lumping of probably the entire family, as A. orbiculus



143

has a maximum intraspecific genetic variability of 6.5%, resulting in a species threshold of 65%. The development of the observed divergent evolutionary lineages within clade B, being separated by a genetic variability of at least 2%, might be explained by the limited ability of A. orbiculus for active dispersal, resulting in a low exchange of genetic material between populations. Acroceridae are generally regarded as poor flyers, being active only on warm sunny days, and resting on vegetation in morning and evening hours and on colder and cloudy days (Nartshuk 1997). Taking into consideration that the life-span of adult Acroceridae is confined to 3–30 days (Schlinger 1987), most dispersal probably takes place during the larval development within the araneomorph host, which lasts 6–10 months (Schlinger 1987). Adding up the evidence at hand (mtDNA and morphology), it is our understanding that A. orbiculus represents a single biological species with a slight degree of sexual dimorphism and a high degree of phenotypic plasticity regarding body size and coloration, instead of many separate, closely allied taxa that cannot be reliably differentiated on a morphological basis. An expanded sampling covering the entire Holarctic distribution and a more detailed morphological and molecular approach would be desirable to further investigate this question.

FIGURE 7. Genetic variability of A. orbiculus, based on uncorrected p-distances of COI, within and between populations of clade B. Red colour: Maximum genetic distance within populations. Blue: Minimum genetic distances between populations. Numbers correspond to those of the DNA vouchers given in Table 1 and the Appendix.

An annotated list of the Palaearctic members of the subgenus Acrocera (for the subgenus Acrocerina see Nartshuk (1988) and de Jong (2001)) Acrocera bacchulus (Frey) Paracrocera bacchulus Frey, 1936: 45. 1♂, 1♀ syntype. Type deposition: MZH. Type locality: Spain, Canary Islands, Tenerife, Agua Mansa. Remarks. A Canary Islands endemic, described from one male and one female from Tenerife, apparently differing from A. orbiculus by a darker, brownish black pterostigma and darker wing venation. Acrocera laeta Gerstäcker Acrocera laeta Gerstäcker, 1856: 352. ♂ holotype. Type deposition: MNHU. Type locality: Italy, Sardinia. Remarks. Acrocera laeta was described from the male holotype collected on Sardinia (Italy) and has also been


KEHLMAIER ET AL.

recorded from the former USSR (SET, TC (Ge), KZ) (Nartshuk 1988). The species is characterised by entirely orange-yellow tergites (except medially on tergite 1), and might represent a very pale form of A. orbiculus. Acrocera orbiculus (Fabricius) Syrphus orbiculus Fabricius, 1787: 340. No specimen numbers or gender stated. Only one wing left (Zimsen 1964; T. Pape, in litt.). Type deposition: ZMUC. Type locality: Germany, Kiel. Acrocera albipes Meigen, 1804: 148. No specimen numbers or gender stated. Type deposition: unknown; not MNHN (C. Daugeron, in litt.), NHMW (P. Sehnal, in litt.), KBIN (P. Limbourg, in litt.), UMO (A.C. Pont, in litt.). Type locality: not given (probably Central Europe, from coll. Baumhauer). Syn. (with A. globulus): Boie (1838: 236). See also Erichson (1840: 163). Acrocera borealis Zetterstedt, 1838: 573. ♀ lectotype. Type deposition: ZML. Type locality: Sweden, Åsele. Syn.: de Jong et al. (2000: 175). Syrphus globulus Panzer, [1804]: 20. No specimen numbers or gender stated. The figured specimen is most likely a female. Type deposition: unknown; not MNHU (J. Pohl, in litt.). Type locality: Germany, probably around Eichstätt (Bavaria) as the type was collected by Patricius Trost. Syn.: Schlinger (1965: 406). Acrocera hubbardi Cole, 1919: 58. ♀ holotype. Type deposition: USNM (no. 21205). Type locality: USA, Arizona, Santa Rita Mountains. Syn.: Schlinger (1965: 406). Acrocera hungerfordi Sabrosky, 1944: 406. ♀ holotype. Type deposition: SEMC. Type locality: USA, Michigan, Cheboygan Co. Syn.: Sabrosky (1948: 405). Paracrocera kaszabi Majer, 1977: 105. syn. nov. ♀ holotype. Type deposition: HNHM. Type locality: Mongolia, Tosgoni ovoo, 5–10 km from Ulan Baator. Remarks. Majer (1977) described A. kaszabi based on the “male” holotype from Mongolia. His illustration, however, clearly shows a female as already mentioned in de Jong et al. (2000), who suggest that it might be conspecific with A. orbiculus. The abdominal pattern of the holotype also occurs in the DNA-voucher specimen CK680 from south-western France (fig. 8A). Paracrocera manevali Séguy, 1926: 164. syn. nov. ♀ holotype. Type deposition: MNHN. Type locality: France, Département Haute-Loire, Tence. Remarks. According to Séguy (1926), the “male” holotype of A. manevali is characterized by large protruding genitalia. A study of the holotype revealed that it is in fact a female specimen, as already suspected by de Jong et al. (2000). Nartshuk (1982) stated that females with black scutellum and wholly black abdomen belong to A. orbiculus. Paracrocera minuscula Séguy, 1934: 27. syn. nov. ♂ holotype. Type deposition: MNHN. Type locality: Spain, Zaragoza. Remarks. The male holotype of A. minuscula was collected in Spain and, following Séguy (1934), differs from other species by their yellow distitarsi and hyaline lower calypters. Ogcodes pubescens Latreille, 1805: 315. Holotype (no gender stated, but probably an entirely dark female). Type deposition: unknown; not MNHN (C. Daugeron, in litt.). Type locality: France, Département Hauts-de-Seine, Meudon. Syn.: ? (Erichson (1840: 168) suggested that it might be A. orbiculus or A. globulus, but without having seen specimens at hand.) Acrocera tumida Erichson, 1840: 166. ♀ holotype. Type deposition: MNHU. Type locality: not given (probably Germany). Syn.: (Sack 1936: 30). Acrocera paitana (Séguy) Paracrocera paitana Séguy, 1956: 177. ♀ holotype. Type deposition: unknown (not MNHN or TMNH). Type locality: “Chine boréale, Tche-li, Paita” [= PR China, Beijing Municipality, Yanqing County, Longqing Gorge, Paita temple, 13.VIII.1930]. Remarks. Séguy (1956) received the material from Émile Licent, founder of the Tianjin Museum of Natural History (TMNH), formerly Museum Hoang ho-Pai ho or Beijiang Museum. The type locality Longqing Gorge is situated about 80 km northwest of Beijing and 10 km north-northeast of Yanqing at approximately 116°0' 9"E 40°32'37"N. The female holotype could not be found at TMNH or in the main collection of MNHN. Acrocera paitana is closest to A. orbiculus, but a reliable differentiation from the latter based on Séguy’s (1956) diagnosis is not possible. Chances are that it also represents an additional synonym of A. orbiculus. The species is not included in Nartshuk (1988). NEW ACROCERIDAE HOSTS


145

FIGURE 8. Variability in body size and abdominal coloration in female A. orbiculus collected in south-western France. A: DNA-voucher CK680 body length 2.5 mm. B: DNA-voucher CK681 body length 4.2 mm.

FIGURE 9. Male of A. cabrerae Frey. A: Lateral view. B: Dorso-lateral view. Photos: Antonio Camacho.

Description of male Acrocera (Acrocerina) cabrerae Frey (figs 9–10) Acrocera cabrerae was originally described from the female holotype, collected on Tenerife, Canary Islands, Spain. Description of male. Body length 5.5 mm. Head. Eye black, bare; posterior margin of eye not emarginate; ocellar triangle black, bare, elevated, three ocelli present; occiput black, in lateral view 1/3 of eye width, pile brown; palpus absent; proboscis white, very short; antenna with scape not visible, pedicel globular and light brown, otherwise dark brown; flagellum with long terminal arista. Thorax. Scutum black, with dense brownish pile, dorsocentrally with two narrow longitudinal yellow stripes which are broadened in posterior quarter, and with a whitish pile; postpronotal lobe with upper half yellow and lower half black, pile white; postalar callus black except posterior fifth yellow; scutellum black in anterior, yellow in posterior half, pile dark brown in anterior, yellowish in


KEHLMAIER ET AL.

posterior half; sub-scutellum black and glossy, without pile; pleuron black, pile light brown but katepisternum and meron bare and glossy; legs entirely yellowish white except hind coxa darkened anterolaterally at base and last tarsomere black in anterior third, pile white; claws black; empodium pulvilliform; lower calypter brownish infuscated (especially in upper half) with somewhat paler margin; pile along rim whitish; halter white with stem and knob partly brownish; wing length: 4.2 mm; weakly brownish infuscated, venation dark brown; vein R2+3 present; crossvein r-m angled after upper quarter of its length (where M1 would branch off); M2 present on both wings, very short; M3 almost reaching wing margin. Abdomen. Globose, slightly wider than long; tergites 2–4 predominantly black with yellow posterior bands, baring two dorsocentral undulations that reach approximately half way on tergite 2 & 3 and touching anterior margin on tergite 4, pile dense but short, concolourous with tergites; sternites entirely mid to dark brown. Male genitalia: not dissected. Note that the yellow colouration present on thorax (including legs) and abdomen can fade to white in ethanol preserved specimens.

FIGURE 10. Male of A. cabrerae Frey. A: Shape of right antenna. Figured are pedicel and flagellum with apical arista. Scale bar: 0.1 mm. B: Right wing with main veins and cells indicated. Scale bar: 0.5 mm. C: Dorsal view of thorax. Scale bar: 0.5 mm. D: Dorsal view of abdomen with tergites 2–5. Scale bar: 0.5 mm.



147

Acknowledgments It is our pleasure to send a hearty thank you to the following people and institutions for their support and advice: Hélène Dumas (La Ciotat, France) for sharing her rearing record of O. reginae; Frits Broekhuis (Amersfoort, The Netherlands) for sending in his A. orbiculus and for his excellent photographic documentation; Naturdata Portugal (courtesy of Ricardo Ramos da Silva) for passing on details on their finding of O. reginae; Antonio Camacho (Tenerife, Las Canarias, Spain) and Emídio Machado (Laranjeiro, Almada, Portugal) for putting their specimen photos at our disposal; Dr. Thomas Pape (ZMUC) for arranging the loan of material in his custodial care; Jenny Pohl (MNHU) and Dr. Christophe Daugeron (MNHN) for checking the presence of type specimens; Dr. Babak Gharali (Ghazvin, Iran), Matt N. Smith (Winnersh, UK), Dr. Martin Speight (Dublin, Ireland) and Phil Withers (Sainte Euphémie, France) for contributing adult A. orbiculus for study; Mercedes París (Madrid, Spain) for providing rare literature; Ke-Ke Huo (Hanzhong, China) and Shulian Hao (Tianjin, China) for helping to locate the locus typicus of A. paitana; Jéssica Gillung (São Paulo, Brazil) and Chris Borkent (Sacramento, USA) for their helpful comments and suggestions. Part of the material originates from the “Diptera Stelviana” project (courtesy of Dr. Joachim Ziegler at MNHU) and the Terrestrial Fauna component of the ATBI Mercantour, Parc National du Mercantour / UMR7205 MNHN Paris (courtesy of Dr. Christophe Daugeron at MNHN). The first author is grateful for the financial support received from the SYNTHESYS Project http://www.synthesys.info/ financed by European Community Research Infrastructure Action under the FP7 ‘Capacities’ programme to carry out collection work at ZMUC in Copenhagen.

Literature Barneche, J.A., Gillung, J.P. & González, A. (2013) Description and host interactions of a new species of Exetasis Walker (Diptera: Acroceridae), with a key to species of the genus. Zootaxa, 3664 (4), 525–536. http://dx.doi.org/10.11646/zootaxa.3664.4.6 Barraclough, D.A. & Croucamp, W. (1997) A new South African species of Ogcodes Latreille (Diptera: Acroceridae) reared from a sac spider of the genus Cheiracanthium Koch (Miturgidae). Annals of the Natal Museum, 38, 55–60. Boie, F. (1838) Zur Verwandlungsgeschichte inländischer Zweiflügler. Naturhistorisk Tidsskrift, 2, 234–248. Cady, A., Leech, R., Sorkin, L., Stratton, G. & Caldwell, M. (1993) Acrocerid (Insecta: Diptera) life histories, behaviours, host spiders (Arachnida: Araneida), and distribution records. The Canadian Entomologist, 125, 931–944. http://dx.doi.org/10.4039/ent125931-5 Chvála, M. (1980) Acroceridae (Diptera) of Czechoslovakia. Acta Universitatis Carolinae, Biologica, 1977, 253–267. Cole, F.R. (1919) The dipterous family Cyrtidae in North America. Transactions of the American Entomological Society, 45, 1– 79. Coquillett, D.W. (1910) The Type-species of the North American genera of Diptera. Proceedings of the United States National Museum, 37, 499–647. http://dx.doi.org/10.5479/si.00963801.37-1719.499 Darriba, D., Taboada, G.L., Doallo, R. & Posada, D. (2012) jModelTest 2: more models, new heuristics and parallel computing. Nature Methods, 9 (8), 772. http://dx.doi.org/10.1038/nmeth.2109 de Jong, H. (2001) Acrocera sanguinea and A. trigramma in copula (Acroceridae). Studia dipterologica, 8, 187–188. de Jong, H., Noordam, A.P. & Zeegers, T. (2000) The Acroceridae (Diptera) of The Netherlands. Entomologische Berichten, 60, 171–179. Dušek, J. & Láska, P. (1974) Influence of temperature during pupal development on the colour of syrphid adults (Syrphidae, Diptera). Folia facultatis scientarum naturalium universitatis Purkynianae Brunensis, 15, 77–81. Eason, F.R., Peck, W.B. & Whitcomb, W.H. (1967) Notes on spider parasites, including a reference list. Journal of the Kansas Entomological Society, 40, 422–434. Edwards, M. (1984) A further observation of swarming behaviour in Acrocera orbicula (F.) (Dipt., Acroceridae). The Entomologist’s Monthly Magazine, 120, 236. Erichson, W.F. (1840) Entomographien. Heft 1. F.H. Morin, Berlin, 183 pp. Fabricius, J.C. (1787) Mantissa insectorvm sistens eorvm species nvper detectas adiectis characteribvs genericis, differentiis specificis, emendationibvs, observationibvs. Tom. II. Proft, Hafniae, 382 pp. Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution, 39, 783–791. http://dx.doi.org/10.2307/2408678 Folmer, O., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, R. (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3, 294–299.


KEHLMAIER ET AL.

Frey, R. (1936) Die Dipterenfauna der Kanarischen Inseln und ihre Probleme. Commentationes Biologicae, 6 (1), 1–237. Gerstäcker, A. (1856) Zur Kenntnis der Henopier. Entomologische Zeitung zu Stettin, 17(11–12), 339–361. Gilbert, F. (2005) The evolution of imperfect mimicry in hoverflies. Available from: http://eprints.nottingham.ac.uk/96/1/ ImperfectMimicry.pdf (accessed 25 February 2014) Gil Collado, J. (1929) Círtidos españioles y marroquies del Museo de Madrid (Dipt. Cyrt.). Memorias de la Real Sociedad Española de Historia Natural, 15, 539–552. Guindon, S. & Gascuel, O. (2003) A simple, fast and accurate method to estimate large phylogenies by maximum-likelihood. Systematic Biology, 52, 696–704. Hebert, P.D.N., Cywinska, A., Ball, S.L. & deWaard, J.R. (2003) Biological identifications through DNA barcodes. Proceedings of the Royal Society B: Biological Sciences, 270 (1512), 313–321. http://dx.doi.org/10.1098/rspb.2002.2218 Hebert, P.D.N., Stoeckle, M.Y., Zemlak, T.S. & Francis, C.M. (2004) Identification of birds through DNA barcodes. PLoS Biology, 2, 1657–1663. http://dx.doi.org/10.1371/journal.pbio.0020312 Kehlmaier, C. (2002) Hoverflies (Diptera: Syrphidae) from northern Spain, with notes on Pelecocera tricincta Meigen, 1822. Volucella, 6, 139–153. Kehlmaier, C. & Assmann, T. (2008) The European species of Chalarus Walker, 1834 revisited (Diptera: Pipunculidae). Zootaxa, 1936, 1–39. Kehlmaier, C., Michalko, R. & Korenko, S. (2012) Ogcodes fumatus (Diptera: Acroceridae) reared from Philodromus cespitum (Araneae: Philodromidae), and first evidence of Wolbachia alphaproteobacteria in Acroceridae. Annales Zoologici (Warszawa), 62 (2), 281–286. http://dx.doi.org/10.3161/000345412x652819 Kerr, P.H. & Winterton, S.L. (2008) Do parasitic flies attack mites? Evidence in Baltic amber. Biological Journal of the Linnean Society, 93, 9–13. Langer, G. (2005) Ein seltener Parasitoid der Wolfspinne Pardosa alacris (Araneae: Lycosidae): Ogcodes gibbosus (Diptera: Acroceridae). Arachnologische Mitteilungen, 29, 45–48. http://dx.doi.org/10.5431/aramit2907 Larrivée, M. & Borkent, C.J. (2009) New spider host associations for three acrocerid fly species (Diptera, Acroceridae). Journal of Arachnology, 37, 241–242. http://dx.doi.org/10.1636/t08-62.1 Latreille, P.A. (1805) Histoire naturelle, générale et particulière des crustacés et des insectes. Tome 14. F. Dufart, Paris, 432 pp. Majer, J. (1977) Data to the Acroceridae (Diptera) Fauna of Mongolia. Folia Entomologica Hungarica Rovartani Közlemények (Series Nova), 30 (1), 105–107. Meigen, J.W. (1804) Klassifikazion und Beschreibung der europäischen zweiflügeligen Insekten (Diptera Linn.). Erster Band. Reichard, Braunschweig, Abt. I, viii + 1–152 pp. Abt. II, vi + 153–314 pp. Menge, A. (1866) Preussische Spinnen. 1. Abtheilung. Schriften der Naturforschenden Gesellschaft in Danzig (Neue Folge), 1 (3–4), 51–152 + 28 plates. Millot, J. (1938) Le développement et la biologie larvaire des Oncodides (= Cyrtidés), Diptères parasites d’araignées. Bulletin de la Société zoologique de France, 63, 162–181 + 183–197. Nartshuk, E.P. (1982) Review of Acrocerid flies (Diptera, Acroceridae) of the fauna of USSR with descriptions a new genus and new species. Entomologicheskoe Obozrenie, 61 (2), 404–417. [in Russian; English translation in Entomological Review, 61 (2), 155–169] Nartshuk, E.P. (1988) Acroceridae. In: Soós, Á. & Papp, L. (Eds.), Catalogue of Palaearctic Diptera. Vol. 5. Akadémiai Kiadó/ Elsevier, Budapest & Amsterdam, pp. 186–196. Nartshuk, E.P. (1997) 2.32. Family Acroceridae. In: Papp, L. & Darvas, B. (Eds.), Manual of Palaearctic Diptera. Vol. 2. Science Herald, Budapest, pp. 469–485. Nartshuk, E.P. (2000) On synonymy of Acrocera Meigen and Paracrocera Mik (Diptera: Acroceridae). Zoosystematica Rossica, 8 (2) [1999], 300. Nartshuk, E.P. (2013) Fauna Europaea: Acroceridae. In: Pape, T. & Beuk, P. (Eds.) Fauna Europaea: Diptera: Brachycera. Fauna Europaea version 2.6. Available from: http://www.faunaeur.org (accessed 25 February 2014) Nielsen, E. (1932) The biology of spiders, with special reference to the Danish fauna. Levin & Munksgaard, Copenhagen, part I: 248 pp, part II: 723 pp. Nielsen, B.O., Funch, P. & Toft, S. (1999) Self-injection of a Dipteran parasitoid into a Spider. Naturwissenschaften, 86, 530– 532. http://dx.doi.org/10.1007/s001140050668 Nixon, K.C. & Carpenter, J.M. (1993) On outgroups. Cladistics, 9, 413–426. http://dx.doi.org/10.1111/j.1096-0031.1993.tb00234.x Ottenheim, M.M., Waller, G.E. & Holloway, G.J. (1995) The influence of the development rates of immature stages of Eristalis arbustorum (Diptera; Syrphidae) on adult abdominal colour pattern. Physiological Entomology, 20, 343–348. http://dx.doi.org/10.1111/j.1365-3032.1995.tb00825.x Panzer, G.W.F. (1803) Fauna insectorum Germanicae initia, oder Deutschlands Insecten, Heft 86. Felsecker, Nürnberg, 24 pp.



149

Posada, D. (2008) JMODELTEST: phylogenetic model averaging. Molecular Biology and Evolution, 25, 1253–1256. http://dx.doi.org/10.1093/molbev/msn083 Ralley, W.E. (1988) Oviposition behavior and the egg of Acrocera orbicula (Fab.) (Diptera: Acroceridae). The Canadian Entomologist, 120, 95–96. http://dx.doi.org/10.4039/ent12095-1 Ronquist, F. & Huelsenbeck, J.P. (2003) MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19, 1572–1574. http://dx.doi.org/10.1093/bioinformatics/btg180 Sabrosky, C.W. (1944) Revision of the American Spider Parasites of the Genera Ogcodes and Acrocera (Diptera, Acroceridae). American Midland Naturalist, 31 (2), 385–413. http://dx.doi.org/10.2307/2421075 Sack, P. (1936) 21. Cyrtidae (Acroceridae). In: Lindner, E. (Ed.), Die Fliegen der paläarktischen Region, Band IV/1. E. Schweizerbart’sche Verlagsbuchhandlung, Stuttgart, 36 pp. + 3 plates. Schlinger, E.I. (1965) Acroceridae. In: Stone, A., Sabrosky, C.W., Wirth, W.W., Foote, R.H. & Coulson, J.R., (Eds.), A Catalog of the Diptera of America north of Mexico. United States Department of Agriculture, Agriculture Handbook 276, 403–407. Schlinger, E.I. (1987) The biology of Acroceridae (Diptera): true endoparasitoids of spiders. In: Nentwig, W. (Ed.), Ecophysiology of Spiders. Springer-Verlag, Berlin, pp. 319–327. Schlinger, E.I. (2003) Acroceridae, spider-fly endoparasitoids. In: Goodman, M. & Benstead, J.P. (Eds.), The Natural History of Madagascar. University of Chicago Press, Chicago. pp. 734–740. Schlinger, E.I., Gillung, J.P. & Borkent, C.J. (2013) New spider flies from the Neotropical Region (Diptera, Acroceridae) with a key to New World genera. ZooKeys, 270, 59–93. http://dx.doi.org/10.3897/zookeys.270.4476 Séguy, E. (1926) Diptères (Brachycères). Faune de France, 13, 308 pp. Séguy, E. (1934) Diptères d'Espagne. Étude systématique basée principalement sur les collections formées par le R. P. Longin Navás, S. J. Memorias de la Academia de Ciencias exactas, Físico-Químicas y Naturales de Zaragoza, 3, 1–54. Séguy, E (1956) Dipteres nouveaux ou peu connus d'Extreme-Orient. Revue française d'entomologie, 23, 174–178. Sferra, N.J. (1986) The first record of Pterodontia flavipes Gray (Diptera: Acroceridae) larvae in the mites Podothrombium (Acari: Trombidiidae) and Abrolophus (Acari: Erythraeidae). Entomological News, 97, 121–123. Skevington, J.H., Kehlmaier, C. & Ståhls, G. (2007) Molecular barcoding: Mixed results for Pipunculidae (Diptera). Zootaxa, 1423, 1–26. Smith, M.A., Woodley, N.E., Janzen, D.H., Hallwachs, W. & Hebert, P.D.N. (2006) DNA barcodes reveal cryptic hostspecificity within the presumed polyphagous members of a genus of parasitoid flies (Diptera: Tachinidae). Proceedings of the National Academy of Sciences, 103, 3657–3662. http://dx.doi.org/10.1073/pnas.0511318103 Stubbs, A. & Drake, M. (2001) British soldierflies and their allies. The British Entomological and Natural History Society, Reading, 512 pp. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & Kumar, S. (2011) MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution, 28, 2731–2739. http://dx.doi.org/10.1093/molbev/msr121 Toft, S., Nielsen, B.O. & Funch, P. (2012) Parasitoid suppression and life-history modifications in a wolf spider following infection by larvae of an acrocerid fly. The Journal of Arachnology, 40, 13–17. http://dx.doi.org/10.1636/p11-28.1 Trojan, P. (1956) Oncodes reginae sp. n. and notes on the European species of the family Cyrtidae (Diptera). Annales Zoologici (Warszawa), 16 (8), 73–79. Weinberg, M. (1966) Contribution to the knowledge of the Cyrtidae (Diptera) of Rumania. Travaux du Muséum National d’Histoire Naturelle “Grigore Antipa”, 5, 141–145. Weinberg, M. (1984) New data on the presence and distribution of the Acroceridae (Diptera) in Romania. Travaux du Muséum National d’Histoire Naturelle “Grigore Antipa”, 26, 185–192. Winterton, S.L. & Gillung, J.P. (2012) A new species of spider fly in the genus Sabroskya Schlinger from Malawi, with a key to Acrocerinae world genera (Diptera, Acroceridae). ZooKeys, 171, 1–15. http://dx.doi.org/10.3897/zookeys.171.2137 Winterton, S.L., Wiegmann, B.M. & Schlinger, E.I. (2007) Phylogeny and Bayesian divergence time estimations of smallheaded flies (Diptera: Acroceridae) using multiple molecular markers. Molecular Phylogenetics and Evolution, 43, 808– 832. http://dx.doi.org/10.1016/j.ympev.2006.08.015 Zetterstedt, J.W. (1838) Dipterologis Scandinaviae. Sect. 3. Diptera. Insecta Lapponica. Lipsiae [Leipzig], pp. 477–868. Zimsen, E. (1964) The type material of J. C. Fabricius. Munksgaard, Copenhagen, 656 pp.


KEHLMAIER ET AL.

APPENDIX. Specimen data and GenBank accession numbers. DNA voucher

Specimen data

GenBank accession no.

Acrocera (Acrocera) orbiculus (Fabricius, 1787) CK219

♀, 13.–25.VII.2005, Italy, South Tyrol, Parco Nazionale dello Stelvio, Schuett near Weisser Knott,

HF955399

SW of Trafoi, 10°29'31.2''E 46°32'04.9''N, 2030 m, leg. C. Lange & J. Ziegler, coll. PCCK

CK230

♀, 1.VII.2006, Germany, Saxony, Dresden, Dresdner Heide, Prießnitztal, 13°46'E 51°05'N, 160m,

HF955400

leg. C. Kehlmaier, coll. PCCK

CK565

♂, X.2011, France, Département Var, near Besse-sur-Isole, 6°10'48.56"E 43°19'39.60"N, leg. F.

HF955401

Broekhuis, coll. PCCK

CK568

♀, 20.–26.IX.2010, France, Département Alpes-Maritimes, Biot, Le Bois Fleuri, 7°3'13''E

HF955402

43°38'19''N, leg. M.C.D. Speight, coll. PCCK

CK572

♀, 2.VIII.1999, France, Département Hautes-Alpes, La Meije, alpage et roches, 1400-2400m,

HF955403

6°18'31"E 45°0'17.1"N, leg. P. Withers, coll. PCCK

CK598

♂, 2.–16.VIII.2011, France, Département Lozère, Parc National des Cévennes, Réserve Biologique HF955404 Intégrale des Marquairès, 3°35'30''E 44°10'48''N, leg. M. Speight, coll. PCCK

CK599

♀, 27.VI.2011, France, Département Pyrenées-Orientales, Banyuls-sur-Mer, Mediterranean

HF955405

Botanical Garden (of the Laboratoire Arago), 3°6'26.3"E 42°40'27.7"N, leg. M.C.D. Speight, coll. PCCK

CK609

♂, 5.VI.–11.VIII.2009, Iran, Ghazvin province, Ghazvin city, Zarabad village, Plant Medicinal

HF955406

research Station, 50°24'E 36°28'N, 1520m, leg. B. Gharali, coll. PCCK

CK634

♀, 19.X.2008, Greece, Corfu, Moraitika, 19°55'27.6''E 39°29'26.6''N, 60m, leg. C. Lange & J.

HF955407

Ziegler, coll. MNHU

CK641

♀, 9.VII.1988, Spain, Jaén, 6km S Quesada, 1180m, 3°5'26.959"W 39°22'5.804"N, leg. V.

HF955408

Michelsen, coll. ZMUC

CK655

♂, 7.VIII.2012, Great Britain, Channel Islands, Jersey, St. Brelade, Les Blanches Banques,

HF955409

2°13'5.24''E 49°11'59.66''N, leg. & coll. M.N. Smith

CK663

♀, 24.VII.–13.VIII.2009, France, Département Alpes-Maritimes, Saint-Martin-Vésubie, Le Boréon, HF955410 7°17'13"E 44°6'54"N, 1540 m, ATBI PNM/PNAM/M09-BOR1400T4-M1, leg. Molto, coll. MNHN

CK680

♀, VIII.2008, France, Départemenet Arìege, Soulan, Brus, Parc Naturel Régional des Pyrénées

HF955411

Ariégeoises, 1°17'01''E 42°54'53''N, leg. N. Komé, coll. PCCK

CK681

♀, VIII.2008, France, Départemenet Arìege, Soulan, Brus, Parc Naturel Régional des Pyrénées

HF955412

Ariégeoises, 1°17'01''E 42°54'53''N, leg. N. Komé, coll. PCCK

CK684

♂, VIII.2009, Portugal, Castelo Branco (district), Serra de Estrela, Nave de Santo António, 1500m, HF955413 7°33'43''W 40°18'16''N, leg. J. Mota Almeida, coll. PCCK

n/a

77♀, VIII.2008, France, Départemenet Arìege, Soulan, Brus, Parc Naturel Régional des Pyrénées Ariégeoises, 1°17'01''E 42°54'53''N, leg. N. Komé, coll. J. Almeida (65♀) & PCCK (12♀)

—

n/a

9♀, 1.VI.–30.VII.2002, Germany, Saxony, Weißeritzkreis, NSG Georgenfelder Hochmoor, 13°44'31"E 50°43'45"N, 864 m, leg. C. Kehlmaier, coll. PCCK.

—

n/a

3♀, 5.–30.VII.2002, Germany, Saxony, Weißeritzkreis, NSG Geisingberg, 13"46'10"E 50°46'20"N, — 740 m, leg. C. Kehlmaier, coll. PCCK.

CK218

♂, 13.–25.VII.2005, Italy, South Tyrol, Parco Nazionale dello Stelvio, Sulden valley near Schmelz, HF955414

Acrocera (Acrocerina) sanguinea Meigen, 1804 SW of Prad, 10°34'56.6''E 46°36'42.1''N, 940m, leg. C. Lange & J. Ziegler, coll. PCCK

CK664

♀, 24.VII.–13.VIII.2009, France, Département Alpes-Maritimes, Saint-Martin-Vésubie, Le Boréon, HF955415 7°17'13"E 44°6'54"N, 1540 m, ATBI PNM/PNAM/M09-BOR1400T4-M1, leg. Molto, coll. PCCK

Acrocera (Acrocerina) cabrerae Frey, 1936 CK522

♂, 6.VI.2011, Spain, Canary Islands, La Palma, Los Llanos, 17°53'47.23"W 28°39'53.11"N, 550 m, HF955416 leg. A. Camacho, coll. PCJM

......continued on the next page



151

APPENDIX. (Continued) DNA voucher

Specimen data

GenBank accession no.

Ogcodes reginae Trojan, 1956 CK518

♀, 22.VI.2011, France, Département Bouches du Rhône, La Ciotat, 5°37'54.2''E 43°11'54.8''N, leg.

HF955417

H. Dumas, coll. PCCK

CK520

♂, 7.IX.2009, Portugal, Castelo Branco (district), Castelo Branco (parish), 7°30'28''W 39°48'38''N,

HF955418

leg. E. Machado, coll. PCJM

Amaurobius erberi (Keyserling, 1863) CK564

♂, subadult, 16.X.2011, France, Département Var, near Besse-sur-Isole, 6°10'48.56"E

HF955419

43°19'39.60"N, leg. F. Broekhuis, coll. PCCK

CK665

♂, 2.VIII.2012, France, Département Var, near Besse-sur-Isole, 6°10'48.56"E 43°19'39.60"N, leg. F. HF955420 Broekhuis, coll. PCCK

Clubiona leucaspis (Simon, 1932) CK519

♀, subadult, 22.VI.2011, France, Département Bouches du Rhône, La Ciotat, 5°37'54.2''E

HF955421

43°11'54.8''N, leg. H. Dumas, coll. PCCK


KEHLMAIER ET AL.

Fanniidae (Diptera): new synonym, new records and an updated key to males of European species of Fannia.

Three new species of European Platypalpus (Diptera, Hybotidae).

Studies in Hawaiian Diptera III: New Distributional Records for Canacidae and a New Endemic Species of Procanace.

New species and records of frog-biting midges from southern Brazil (Diptera: Corethrellidae).

New species and records of Metriocnemus van der Wulp s. str. from China (Diptera, Chironomidae).

New species and host records of New World, mostly Neotropical, opiine Braconidae (Hymenoptera) reared from flower-infesting, stem-galling, and stem-mining Tephritidae (Diptera).

New records of Trichoceridae (Diptera) from the island of Mallorca .

Muscle attachment site (MAS) patterns for species determination in European species of Lucilia (Diptera: Calliphoridae).

Lacanobia oleracea nucleopolyhedrovirus (LaolNPV): A new European species of alphabaculovirus with a narrow host range.

New records of Muscidae (Diptera) from Mediterranean countries.

New records of Limoniidae and Pediciidae (Diptera) from Croatia.

Additions to the Encyrtidae and Mymaridae (Chalcidoidea) of India with new distribution and host records for some species.

New records of Sylvicola (Diptera: Anisopodidae) from Romania.

A new species and new records of Molophilus Curtis, 1833 (Diptera: Limoniidae) from the Western Palaearctic Region.

A new species of Docosia Winnertz from Central Europe, with DNA barcoding based on four gene markers (Diptera, Mycetophilidae).

Notes on Nilothauma Kieffer from Oriental China, with descriptions of three new species (Diptera, Chironomidae).

Five new records of bee flies (Bombyliidae, Diptera) from Saudi Arabia with zoogeographical remarks.

Half of the European fruit fly species barcoded (Diptera, Tephritidae); a feasibility test for molecular identification.

New flux based dose-response relationships for ozone for European forest tree species.

Discussion of a justification for NIOSH recommended biological limits.

Sylvatic host associations of Triatominae and implications for Chagas disease reservoirs: a review and new host records based on archival specimens.

Notes on the Neotropical Zethus Fabricius, 1804 (Hymenoptera, Vespidae, Eumeninae) with the description of two new species from Brazil.

Melastrongygaster, a new genus of the tribe Strongygastrini (Diptera: Tachinidae), with five new species from Asia.

The genus Epidapus Haliday (Diptera, Sciaridae) in New Caledonia, with the description of four new species.