New Bacillus thuringiensis toxin combinations for biological control of lepidopteran larvae.

ARTICLE IN PRESS

G Model BIOMAC 4109 1–7

International Journal of Biological Macromolecules xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac

New Bacillus thuringiensis toxin combinations for biological control of lepidopteran larvae

1

2

3 4 5 6

Q1

Jihen Elleuch a , Raida Zribi Zghal a,∗ , Mohamed Jemaa a , Hichem Azzouz a , Slim Tounsi a , Samir Jaoua b a b

Biopesticides Team [L.P.I.P.], Centre of Biotechnology of Sfax, University of Sfax, P.O. Box 1177, 3018 Sfax, Tunisia Department of Biological & Environmental Sciences, College of Arts and Sciences, Qatar University, P.O. Box 2713, Doha, Qatar

7

8

a r t i c l e

i n f o

a b s t r a c t

9 10 11 12 13

Article history: Received 7 November 2013 Received in revised form 10 January 2014 Accepted 13 January 2014 Available online xxx

14

18

Keywords: Gene expression Cyt1A98 protein Larvicidal activity

19

1. Introduction

15 16 17

20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38

Cyt1Aa from Bacillus thuringiensis israelensis is known by its synergistical activity with B. thuringiensis and Bacillus sphaericus toxins. It is able to improve dipteran specific toxins activity and can prevent or overcome larval resistance to those proteins. The objective of the current study was to investigate the possible improvement of larvicidal activity of B. thuringiensis kurstaki expressing heterogeneous proteins Cyt1A and P20. cyt1A98 and p20 genes encoding the cytolytic protein (Cyt1A98) and the accessory protein (P20), respectively, were introduced individually and in combination into B. thuringiensis kurstaki strain BNS3. Immunoblot analysis evidenced the expression of these genes in the recombinant strains and hinted that P20 acts as molecular chaperone protecting Cyt1A98 from proteolytic attack in BNS3. The toxicities of recombinant strains were studied and revealed that BNS3pHTp20 exhibited higher activity than that of the negative control (BNS3pHTBlue) toward Ephestia kuehniella, but not toward Spodoptera littoralis. When expressed in combination with P20, Cyt1A98 enhanced BNS3 activity against E. kuehniella and S. littoralis. Thus, Cyt1Aa protein could enhance lepidopteran Cry insecticidal activity and would prevent larval resistance to the most commercialized B. thuringiensis kurstaki toxins. © 2014 Published by Elsevier B.V.

Lepidopteran larvae found worldwide, attack different cultivated and wild plants and cause serious economic losses. Particularly, the Egyptian cotton leafworm Spodoptera littoralis attack more than 60 different types of plants such as cotton, clover, maize, wheat, rice, and barley [1,2]. Also the Mediterranean flour moth, Ephestia kuehniella (Lepidoptera: Pyralidae) is one of the major pests which destroy stored grain products in industrial flour mills [3]. These insects have developed resistance to a wide variety of highly toxic chemical insecticides due to routine use in spraying programs. Therefore, potential alternatives are needed. The entomopathogenic bacterium Bacillus thuringiensis kurstaki is widely used in commercial formulations for controlling various agricultural against lepidopteran pests [4] and their cry genes are intensively expressed in transgenic plants especially cotton and maize. These factors bring up some cases of resistance. Tabashnik et al. [5] have reported the resistance of diamondback moth, Plutella xylostella, to B. thuringiensis kurstaki in the field. However, Cry1Ac toxin from B. thuringiensis kurstaki combined with Cyt1Aa protein from B. thuringiensis israelensis could overcome the onset

∗ Corresponding author. Tel.: +216 74 874446; fax: +216 74 874446. E-mail address: raida [email protected] (R.Z. Zghal).

resistance of this lepidopteran insect [6]. Cyt1Aa protein is the major component (45–50%) of B. thuringiensis israelensis crystals [7]. It is endowed with a low insecticidal activity, but, it interacts synergistically with B. thuringiensis dipteran-specific toxins [7–10] and with mosquito larvicidal toxins from B. sphaericus and avoids the resistance of dipteran to those proteins [11–13]. Moreover, Cyt1Aa reduces the resistance of Chrysomela scripta larvae to Cry3A protein [14]. Co-expressed with a combination of Cry1Ac and/or Cry1Ca in Escherichia coli, Cyt1A enhances their activity against Helicovera armigera but not against Pectinophora gossypiella and S. littoralis [15]. The ability of Cyt1Aa to synergize with many toxins is probably due to the multiple mode of action of this protein [16]. In fact, it has cytolytic activity without requiring specific receptors; it interacts directly with membrane lipids [17]. For efficient expression, Cyt1Aa needs the 20-kDa helper protein [18,19]. The latter, found in B. thuringiensis israelensis, is encoded as the third ORF of the cry11A operon. Many reports suggested that this helper protein increases the expression levels probably by post-translational mechanism stabilization [20,21]. The p20 gene expressed into wild strains of kurstaki subsp. does not increase Cry2A production, but it doubles Cry1A protoxin production [22]. In addition, it was demonstrated that P20 enhances the Cry1Ac and Cry3A crystal size and the toxicity of Cry1Ac against H. armigera but not Cry3A toxicity against Leptinotarsa decemlineata [23,24].

0141-8130/$ – see front matter © 2014 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.ijbiomac.2014.01.029

Please cite this article in press as: J. Elleuch, et al., Int. J. Biol. Macromol. (2014), http://dx.doi.org/10.1016/j.ijbiomac.2014.01.029

39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63


ARTICLE IN PRESS J. Elleuch et al. / International Journal of Biological Macromolecules xxx (2014) xxx–xxx

2 Table 1 Plasmids and strains used in this study. Plasmids and strains Plasmids pMOSBlue pBleuscript II SK (+/−) pHTcry1Ia pMOScyt1Aa pMOSp20 pHTp20 pMOScyt1AaC pMOScyt1AaH pBScyt1Aa pBSp20-cyt1Aa pHTcyt1Aa pHTp20-cyt1Aa Strains MOSBlue cells

BNS3

H14 BUPM98 BUPM97 HD1CryB BNS3Cry− BNS3pHTBlue BNS3pHTp20 BNS3pHTcyt1Aa BNS3pHTp20-cyt1Aa HD1CryBpHTp20-cyt1Aa

Description

Shuttle vector, derivative of pHT3101 Derivative of pMOSBlue containing cyt1Aa Derivative of pMOSBlue containing p20 Derivative of pHTBlue containing p20 Derivative of pMOSBlue containing cyt1Aa amplified using D33 an D24 primers Derivative of pMOSBlue containing cyt1Aa amplified using D31 an D24 primers Derivative of pBluescript vector containing cyt1Aa Derivative of pBluescript vector containing p20 and cyt1Aa Derivative of pHTBlue containing cyt1Aa Derivative of pHTBlue containing p20 and cyt1Aa E. coli (endA1 hsdR17 (rk12 -m+ k12 ) supE44thi-1 recA1 gyrA96 relA1 lac [F’ proA+ B+ lacIq ZM15: Tn10 (TcR )]) Bacillus thuringiensis kurstaki serotype H3a, H3b and H3c harboring cry1Aa, cry1Ac, cry2Aa and cry1Ia-type genes B. thuringiensis israelensis B. thuringiensis israelensis B. thuringiensis israelensis Plasmid-cured B. thuringiensis kurstaki Plasmid-cured BNS3 strain BNS3 containing pHTBlue plasmid BNS3 containing pHTp20 plasmid BNS3 containing pHTcyt1Aa plasmid BNS3 containing pHTp20-cyt1Aa plasmid HD1CryB containing pHTp20-cyt1Aa plasmid

71

In order to find a combination of various B. thuringiensis deltaendotoxins which interact synergistically and overcome or prevent insects from developing resistance, BNS3 strain, devoid of Cyt1A and P20 proteins, was engineered to co-express those proteins individually and in combination. The obtained strains were tested in vivo against E. kuehniella and S. littoralis larvae in order to determine the effect of P20 and Cyt1A98 proteins on larvicidal activity of B. thuringiensis kurstaki toxins against those lepidopteran larvae.

72

2. Materials and methods

73

2.1. Bacterial strains, plasmids and culture conditions

64 65 66 67 68 69 70

74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93

References

BUPM97 and BUPM98 are B. thuringiensis subsp. israelensis strains, isolated from a Tunisian soil sample, in the laboratory [25,26], by the method of Jaoua et al. [27]. BNS3 strain is B. thuringiensis kurstaki serotype H3a, H3b and H3c and has an insecticidal activity against larvae of several Lepidoptera [28–31]. HD1CryB (an acrystalliferous strain of B. thuringiensis kurstaki) and H14 (a crystalliferous strain of B. thuringiensis israelensis) were obtained from the Bacillus Stock Centre at Ohio State University (Columbus, OH, U.S.A.) (Table 1). Plasmid pMOSBlue (Amersham, Biosciences, France) and pBleuscript II SK (+/−) (Stratagene, La Jolla, CA, U.S.A.) were used as cloning vectors. The following plasmids were hosted in E. coli strain named MOSBlue cells (Table 1). The E. coli–B. thuringiensis pHTcry1Ia shuttle vector [30], a derivative of pHT3101 (Table 1), was used for gene cloning and expression in B. thuringiensis. Luria-Bertani medium [32] was used for growth of E. coli and B. thuringiensis. T3 medium was used for sporulation and delta-endotoxin production by B. thuringiensis strains [33]. In bioassays, B. thuringiensis strains were grown in a liquid medium as described by Zouari et al. [34]. Luria-Bertani and T3 media were

Amersham, Biosciences, France Stratagene, La Jolla, CA, U.S.A. [30] [26] This work This work This work This work This work This work This work This work Amersham, Paris, France

[27–31]

Bacillus Stock Centre (U.S.A.) [26] [25] Bacillus Stock Centre (U.S.A.) [28] [30] This work This work This work This work

supplemented with 60 ␮g ampicillin/ml and 50 ␮g erythromycin/ml for transformed E. coli and B. thuringiensis strains, respectively. 2.2. Construction of recombinant plasmids The oligonucleotides used in the present study were synthesized by the “Centre de Génétique Moléculaire, CNRS, GENSET, Orsay, France”. All PCR products were generated using a high-fidelity pfu DNA polymerase (Amersham) and sequenced (data not shown) using a taq Dye Deoxy terminator cycle Sequencing kit and a 3,700 ABI Prism DNA sequencer (Applied Biosystems, Foster City, CA, U.S.A.) according to the manufacturer’s instructions. Primers D29 and D30 (Table 2) used for amplification of p20 gene contained restriction sites of ClaI and HindIII, respectively. DNA extracted from BUPM97 strain has served as template. The blunt-end PCR product (0.6 kb) corresponding to p20 open reading frame was purified from agarose gel with MiniElute Gel Extraction Kit (Qiagen S. A. France) and cloned in pMOSBlue vector generating pMOSp20. The pHTcry1Ia vector was digested by EcoRI restriction enzyme to obtain 2 fragments (1 kb and 9.6 kb). The 9.6 kb fragment was purified and treated with Klenow to obtain a 9.6 kb blunt-end Table 2 List of primers designed and used in this study. Primers

Descriptiona

D29-d D30-r D33-d D24-r D31-d

5 AATTATAATCGATATTTAG3 5 AAGGTTAAAGCTTCCGATTA3 5 ACTTATCGATAGGAGTTGTT3 5 TAAATAGAGCTCCTAAGATT3 5 TTCTAATAAGCTTAAGGAGT3

d, direct primer; r reverse primer. a The enzyme restriction sites are bold-faced.


94 95 96

97

98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113



3

Fig. 1. Cloning of cyt1A98 and p20 genes individually or in combination into E. coli–B. thuringiensis shuttle vector pHTcry1Ia. Open boxes contain the replication origins of, respectively, B. thuringiensis (ori Bt) and E. coli (ori Ec). Filled arrows indicate the direction of transcription of the erythromycin resistance gene (Em), ampicillin resistance gene (Ap), cry1Ia gene, cyt1A98 gene, p20 gene and the orientation of the double promoters BtI and BtII.

114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134

fragment which was then digested by ClaI restriction enzyme to obtain 2 fragments of 1.4 kb and 8.2 kb. The last fragment (8.2 kb) was ligated with the ClaI-SmaI restriction fragment corresponding to the ORF of the p20 gene from pMOSp20 to obtain pHTp20 (Fig. 1). The primer D33 (containing a ClaI restriction site) and D24 (Table 2) were used for amplification of cyt1A98 gene using pMOScyt1A98 DNA plasmid (Table 1) as template. The blunt-end PCR product (0.75 kb) designed cyt1A98C was purified from agarose gel with MiniElute Gel Extraction Kit (Qiagen S. A. France) and cloned in pMOSBlue vector generating pMOScyt1A98C. The ClaIEcoRI restriction fragment corresponding to cyt1A98 gene obtained from pMOScyt1A98C was cloned into pHTcry1Ia vector digested with the same enzymes (Fig. 1). The recombinant plasmid was called pHTcyt1A98. The oligonucleotide D31 (containing a HindIII restriction site) and D24 (Table 2) were used for amplification of cyt1A98 gene using pMOScyt1A98 (Table 1) as template. The blunt-end PCR products (0.75 kb) designed cyt1A98H was purified and cloned in pMOSBlue vector generating pMOScyt1A98H. The HindIII-EcoRI restriction fragment containing the ORF of cyt1A98 obtained from pMOScyt1A98H was cloned in pBleuscript II SK (+/−) in the

same restriction sites and the recombinant plasmid was called pBScyt1A98. The ClaI-HindIII restriction fragment containing p20 coding sequence obtained from pMOSp20 was inserted in pBScyt1A98 upstream cyt1A98 to obtain a pBSp20-cyt1A98. The ClaI-EcoRI fragment obtained from pBSp20-cyt1A98 containing the ORFs of p20 and cyt1A98 was cloned into pHTcry1Ia vector to obtain pHTp20cyt1A98 as described in Fig. 1. 2.3. Transformation of B. thuringiensis The transformation of BNS3 and/or HD1CryB strains by obtained recombinant vectors was accomplished according to the protocol as reported by Tounsi et al. [35]. The generated strains were called BNS3pHTp20, BNS3pHTcyt1A98, BNS3pHTp20-cyt1A98 and HD1CryBpHTp20-cyt1A98 (Table 1). 2.4. SDS-PAGE and immunoblot analysis B. thuringiensis strains were grown in T3 medium until sporulation. Spores and crystals were harvested by centrifugation, washed


135 136 137 138 139 140 141 142

143

144 145 146 147 148

149

150 151



4

159

three times with NaCl (1 M) and three times with cold bi-distilled water, respectively. Then spore–crystal mixtures were solubilized in NaOH (50 mM). Their concentrations were determined by the method of Bradford [36] using Bio-Rad reagent (Bio-Rad Protein assay, Cat. 500-0006). Samples were analyzed by SDS-PAGE [37] and separated proteins were electro-transferred from the gel onto nitrocellulose membrane and exposed to specific anti-Cyt1Aa and anti-P20 antibodies [32].

160

2.5. Preparation of Cry proteins for bioassays

152 153 154 155 156 157 158

161 162 163 164 165 166 167 168 169 170 171 172 173 174 175

176

177 178 179 180 181 182 183 184 185 186 187

BNS3 and HD1CryB transformants were grown in liquid medium as described by Zouari et al. [34] supplemented with 50 ␮g erythromycin until complete sporulation. Spore–crystal mixtures were collected by centrifugation, washed twice with NaCl (1 M) and twice with bi-distilled water and lyophilized. After solubilization with NaOH (50 mM), the concentrations of the delta-endotoxins in the lyophilized spore–crystal mixtures were determined as described above [36]. The acrystalliferous strain BNS3Cry− obtained by plasmid curing from the wild strain BNS3 [28], was used as negative control, in order to take into account, in delta-endotoxin determinations, the possibly contaminating dissolved proteins from spore coat and cell debris [34]. For larvicidal activity evaluation of Cyt1A98: BNS3pHTBlue toxins (1:1 wt/wt) mixture, Cyt1A98 protein was produced from HD1CryBpHTp20cyt1A98. 2.6. Bioassays 2.6.1. Bioassays performed with the Mediterranean flour moth E. kuehniella Bioassays were carried out with third instar of E. kuehniella larvae. Lyophilized spore–crystal mixtures of each strain prepared as described above were diluted in flour at the desired deltaendotoxins concentration as described by Tounsi et al. [35]. Seven concentrations were assayed per strain with 10 larvae per concentration. Each test was replicated three times. Larvae mortality was recorded after four days of incubation under controlled temperature of 28 ◦ C and analyzed with WIN DL32 program (version 2.0, CIRAD, IRD).

200

2.6.2. Bioassays performed with the Egyptian cotton leafworm S. littoralis Spore–crystal mixtures produced by different BNS3 recombinant strains were assayed against second S. littoralis instar larvae. Seven to eight concentrations were tested per strain with 10 larvae per concentration using a cube of 1 g of the artificial semi-solid diet [38] impregnated with 120 ␮l of spore–crystal mixtures (20 ␮l per cube face) at the appropriate concentration. Each test was done in triplicate. The level of mortality was recorded after four days of incubation at 23 ◦ C, a light-to-dark period of 18 to six hours and relative humidity of 65%. The 50% lethal concentration (LC50 ) was calculated with WIN DL32 program (version 2.0, CIRAD, IRD).

201

2.7. Statistical analysis

188 189 190 191 192 193 194 195 196 197 198 199

202 203 204 205 206 207 208 209

Each experiment was replicated three times, along with the appropriate controls. Data obtained from bioassays were statistically analyzed by SPSS software (version 17.0) using one-way analysis of variance (ANOVA) and the Duncan’s multiple range tests to determine the significance between means, at 95% confidence interval. Data were expressed as mean values ± standard deviation. Means were separated by using the Duncan multiple range tests at the 5% level.

3. Results 3.1. Expression of cyt1A98 and p20, individually and simultaneously, in B. thuringiensis kurstaki p20 and cyt1A98 genes were cloned individually and in combination into the shuttle vector pHTcry1Ia under the control of the sporulation dependent BtI-BtII promoter [39] and upstream the cry1Ia transcription terminator (Fig. 1). The obtained plasmids were transferred into the B. thuringiensis strains (BNS3 and/or HD1CryB) by electroporation. The obtained recombinant strains were called BNS3pHTp20, BNS3pHTcyt1A98, BNS3pHTp20-cyt1A98 and HD1CryBpHTp20cyt1A98. Spore–crystal mixtures of BNS3pHTp20 and BNS3pHTp20cyt1A98 were analyzed by Western blot using anti-P20-antibody. Autoradiogram showed an expected band of 20 kDa demonstrating that P20 was expressed from both constructs in BNS3 (lanes 4 and 5, Fig. 2a). Cyt1A98 expression was further checked by immunoblot analysis. When 10 ␮g of crystal proteins mixtures were used, only BNS3pHTp20-cyt1A98 and HD1CryBpHTp20-cyt1A98 showed the presence of an expected band of 27 kDa, demonstrating that Cyt1A was expressed (lanes 3 and 6, Fig. 2b). With BNS3pHTcyt1A98, a band of 24 kDa, corresponding to a processed form of Cyt1A protein was detected when 75 ␮g was used (lane 5, Fig. 2c). This indicated that the absence of P20 was at least one of the reasons for poor expression and instability of Cyt1A98 in B. thuringiensis kurstaki. 3.2. Study of the toxicities of the recombinant strains against E. kuehniella Lyophilized spore–crystal mixtures of the obtained recombinant strains were tested for their insecticidal activities against E. kuehniella larvae. The LC50 s of BNS3pHTp20 and BNS3pHTBlue, harboring cry1Aa-type gene [28], cry1Ac-type gene [28], cry2Aa-type gene [30] and cry1Ia-type gene [29,30], (used as a negative control) were 110.9 and 157.9 ␮g of toxin per g of flour, respectively (Table 3) showing that the expression of p20 in BNS3 led to an improvement (IF = 1.42) of the toxicity against the tested larvae. BNS3pHTp20-cyt1A98 showed a similar toxicity to that exhibited by BNS3pHTp20 (Table 3). Whereas, BNS3pHTcyt1A98 did not show any toxicity improvement compared to that of the control BNS3pHTBlue (as seen in Table 3). This was probably due to the weak expression level and the low protein stability of Cyt1A98 [20,21,40]. This construct did not allow us to study the effect of Cyt1A98 with BNS3 toxins on E. kuehniella larvae. So, we studied a combination of BNS3 toxins with Cyt1A98 protein produced by HD1CryBpHTp20-cyt1A98 on this insect. Cyt1A98 protein was not individually active, whereas 75 ␮g of Cyt1A98 protein combined with 75 ␮g BNS3pHTBlue delta-endotoxins showed higher mortality than 150 ␮g of BNS3pHTBlue delta-endotoxins (Fig. 3). These results suggested that when used in combination, Cyt1A98 enhances the insecticidal activity of BNS3 toxins. 3.3. Study of the toxicity of the recombinant strains against S. littoralis Larvicidal activity of BNS3 recombinants strains (expressing p20 and/or cyt1A98 genes) was studied against the second instar of the Egyptian cotton leafworm S. littoralis larvae (Table 3). LC50 s of BNS3pHTp20 and BNS3pHTcyt1A98 were similar to that of the control BNS3pHTBlue. This result demonstrated that P20 and Cyt1A98 expressed individually in B. thuringiensis kurstaki do not affect its toxicity levels toward S. littoralis. However, a moderate and significant (at p = 0.05 upon Duncan multiple range test) improvement (IF = 1.24) of BNS3 larvicidal activity was observed when both p20


210

211 212

213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234

235 236

237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258

259 260

261 262 263 264 265 266 267 268 269



5

Fig. 2. Immunoblot analysis of B. thuringiensis transformants expressing different combination of cyt1A98 and p20 genes from B. thuringiensis israelensis using anti-P20 (A).and anti-Cyt1A (B and C) antibodies. (a) 10 ␮g of spore–crystal suspension were used. Lane 1: H14, Lane 2: molecular weight markers (97, 66, 45, 30, 20.1, 14.4 kDa), Lane 3: BNS3pHTBlue, Lane 4: BNS3pHTp20-cyt1A98, Lane 5: BNS3pHTp20. (b) 10 ␮g of spore–crystal suspension were analyzed by sodium dodecyl sulfate polycrylamide gel electrophoresis then electrotransferred and hybridized with anti-Cyt1A antibodies. Lane 1: H14, Lane 2: molecular weight markers (97, 66, 45, 30, 20.1, 14.4 kDa), Lane 3: BNS3pHTp20cyt1A98, Lane 4: BNS3pHTBlue, Lane 5: BNS3pHTcyt1A98, Lane 6: HD1CryBpHTp20-cyt1A98, Lane 7: HD1CryBpHTBlue. (c) Lane 1: BNS3pHTBlue (5 ␮g), Lane 2: H14 (5 ␮g), Lane 3: BNS3pHTp20cyt1A98 (5 ␮g), Lane 4: molecular weight markers (97, 66, 45, 30, 20.1, 14.4 kDa), Lane 5: BNS3pHTcyt1A98 (75 ␮g).

273

and cyt1A98 were co-expressed with B. thuringiensis kurstaki Cry toxins. This demonstrated that, when expressed in the presence of P20, Cyt1A98 can enhance BNS3 delta-endotoxins toxicity against S. littoralis.

274

4. Discussion

270 271 272

275 276 277 278 279 280 281 282 283 284 285

In this work we investigated whether the expression of P20 and Cyt1A of B. thuringiensis israelensis into B. thuringiensis kurstaki could enhance its insecticidal activity against lepidopteran larvae. For such purpose we transferred cyt1A98 and p20 genes, individually and in combination, to B. thuringiensis kurstaki strains BNS3 and HD1CryB. The expression of both proteins (P20 and Cyt1A98) in BNS3 and/or HD1CryB recombinant strains crystal was studied by immunoblot using specific antibodies. When expressed in combination with P20, Cyt1A was detected as a band of 27 kDa using only 10 ␮g of crystal proteins mixtures. However, when expressed individually and using 75 ␮g of crystal proteins mixtures, it was

detected as a band of 24 kDa, corresponding to a processed form of Cyt1A protein (lane 5, Fig. 2c). The presence of a processed form of Cyt1A98 (24 kDa) and its weak expression in BNS3pHTcyt1A98 indicate that this protein was not stable enough to maintain its native form when it was expressed alone in B. thuringiensis kurstaki. This instability is due to a post-translational processing where endogenous proteases produced by B. thuringiensis may degrade the expressed product. This led to the conclusion that P20 was necessary for an efficient expression of Cyt1A [20,21,40]. Therefore, our result confirm the hypothesis (reported by Park et al. [41] that the 20 kDa protein acts as a molecular chaperone in vivo, assisting folding and protecting Cyt1A protein from proteolytic attack during and shortly after synthesis in B. thuringiensis kurstaki. Against E. kuehniella, the expression of p20 in BNS3 allowed significant improvement of the toxicity level (IF = 1.42). Shao et al. [23] and Ge et al. [42] showed that P20 can interact with Cry1Ac and Cry2Aa, respectively, and enhance their production. Consequently, the enhancement of the toxicity of BNS3pHTp20 may be due to an

Table 3 Toxicity of BNS3 recombinant strains against E. kuehniella and S. littoralis larvae. LC50 a

Insects

Strains

Toxicity improvement factor (IF)b

Ephestia kuehniella

BNS3pHTBlue BNS3pHTp20 BNS3pHTcyt1A98 BNS3pHTp20-cyt1A98

157.9a 110.9b 156.6a 106.6b

± ± ± ±

18.1c 17.6 9.6 15.6

– 1.42 1.00 1.48

Spodoptera littoralis

BNS3pHTBlue BNS3pHTp20 BNS3pHTcyt1A98 BNS3pHTp20-cyt1A98

351.12cd 375.42c 334.76d 281.52e

± ± ± ±

26.2 39.17 25.9 18.9

– – – 1.24

Letters (a–e) indicate significant difference among means at p = 0.05 upon Duncan multiple range test. a LC50 , 50% lethal concentration in ␮g per g of flour (for E. kuehniella) or g of artificial semi-solid diet (for S. littoralis) after 96 h. b IF, toxicity improvement factors of the recombinant strains were determined relatively by the strain BNS3pHTBlue used as a control. c 95% fiducial limits.


286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303

G Model BIOMAC 4109 1–7 6


Fig. 3. Mortality rate of E. kuehniella larvae using BNS3pHTBlue spore–crystal mixtures alone and in combination with Cyt1A98 from HD1CryBpHTcyt1A98. Error bars represent standard deviation of three replications. Different letters indicate significant difference among means at p = 0.05 upon Duncan multiple range test.

304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324

increase in the proportion of Cry1Ac and Cry2Aa into the crystal of BNS3pHTp20, under the action of P20. Indeed, Tounsi et al. [43] showed that the over-expression of Cry1Ac and Cry2Aa in BNS3 led to an enhancement of the proportion of these two Cry proteins into BNS3 crystal resulting in an improvement of the toxicity of this strain against E. kuhniella. The ability of Cyt1A98 toxin to act with Cry toxins of B. thuringiensis kurstaki and to enhance their activity was demonstrated by testing combinations of BNS3pHTBlue crystal proteins with Cyt1A98 protein against E. kuehniella. However, the expression of Cyt1A98 alone in BNS3 does not enhance its toxicity against tested lepidopteran larvae which could be explained by the poor expression and instability of Cyt1A98 in BNS3pHTcyt1A98. Moreover, BNS3 harboring pHTp20-cyt1A98, that expresses Cyt1A98 protein, was 1.48-fold more toxic than BNS3pHTBlue against E. kuehniella larvae, when LC50 s were compared. This observed enhancement is not only due to the impact of p20 gene expression on B. thuringiensis kurstaki crystal composition but also to Cyt1A98 presence in tested spore–crystal mixture (Table 3). Against S. littoralis, spore–crystal mixture of BNS3pHTp20 showed a similar insecticidal activity to that of BNS3pHTBlue,

mainly because Cry1A toxins are unable to permeabilize brush border membrane of S. littoralis larvae [44]. Thus, the 20-kDa helper protein ability to enhance Cry proteins toxicity varied depending on toxins and susceptible larvae. Nevertheless, BNS3pHTp20-cyt1A98 shows a moderate improvement against S. littoralis. Park et al. [7] and Bideshi et al. [45] reported that Cyt1Aa enhances the mosquitocidal activity of B. thuringiensis kurstaki HD1 against dipteran larvae by intermolecular interaction between Cyt1Aa and Cry2Aa. In this paper, we showed that Cyt1A98 toxin acts synergistically with Cry toxins of B. thuringiensis kurstaki or changes the composition of its crystal and enhances their activity against lepidopderan larvae, E. kuehniella and S. littoralis. Consequently, we can conclude that Cyt1Aa, which serves as a receptor for mosquitocidal Cry toxins and enhances subsequently their activity [7], could play a same function for lepidopteran-specific Cry toxins. However, previous report had shown an antagonist effect between Cyt1A1 and Cry1Ac1 against Trichoplusia ni [46]. This finding could be due to factors related to a differential affinity of the microvillar proteins to Cry toxins and Cyt1A lipophilic protein. This work is part of agricultural biotechnology progress. B. thuringiensis toxins has been extensively used as bioinsecticides to control lots of crop


325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345



346 347 348 349 350 351 352 353 354 355 356

357

358 359 360 361 362 363 364

365

366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386

pests due to their high specificity toward target pest, their safety to other organisms including useful insects, autochthonous bacteria and their complete biodegradability [16]. Following the generation of recombinant B. thuringiensis strains, some studies evaluated their environmental and ecological effects and considered them as safe for many reasons [47]: (i), these recombinant strains expressed B. thuringiensis genes which are naturally harbored in the commercialized bioinsecticides based on B. thuringiensis wild strains; (ii) after being sprayed, B. thuringiensis spores does not affect the bacterial biodiversity since 95.8% of these spores disappear after 135 days after application [48]. Acknowledgements The authors wish to thank Pr. Faïza Fakhfakh, Director of Human Molecular Genetics Laboratory, Faculty of Medicine of Sfax – Tunisia, for providing DNA sequencing. This work was supported by research grants from the Tunisian Ministry of Higher Education and Scientific Research. They wish to extend their thanks to Mr. Jamil JAOUA, Founder and former Head of the English Unit at Faculty of Science of Sfax – Tunisia, for having edited their paper. References [1] S. Pineda, M.I. Schneider, G. Smagghe, A.M. Martinez, P. Del Estal, E. Vinuela, J. Valle, F. Budia, J. Econ. Entomol. 100 (2007) 773–780. [2] A.E.M. Abd El Mageed, S.M. Shalaby, Plant Protect. Sci. 47 (2011) 166–175. [3] T.B. Raoul, N.T.S. Léonard, J. Agric. Sci. Technol. 3 (2013) 724–731. [4] J.L. Jurat-Fuentes, T.A. Jackson, in: F.E. Vega, H.K. Kaya (Eds.), Insect 370 Pathology: Bacterial Entomopathogens, Academic Press, Amsterdam, 2012, pp. 265–349. [5] B.E. Tabashnik, N.L. Cushing, N. Finson, M.W. Johnson, J. Econ. Entomol. 83 (1990) 1671–1676. [6] A.H. Sayyed, N. Crickmore, D.J. Wright, Appl. Environ. Microb. 67 (2001) 5859–5861. [7] H.W. Park, B.C. Pino, S. Kozervanich-Chong, E.A. Hafkenscheid, R.M. Oliverio, B.A. Federici, D.K. Bideshi, J. Microbiol. Biotechnol. 23 (2013) 88–91. [8] M.C. Wirth, G.P. Georghiou, B.A. Federici, Proc. Natl. Acad. Sci. U.S.A. 94 (1997) 10536–10540. [9] M.C. Wirth, W.E. Walton, A. Delécluse, J. Invertebr. Pathol. 82 (2003) 133–135. [10] P.E. Cantón, E.Z. Reyes, I.R. De Escudero, A. Bravo, M. Soberón, Peptides 32 (2011) 595–600. [11] M.C. Wirth, H.W. Park, W.E. Walton, B.A. Federici, Appl. Environ. Microb. 71 (2005) 185–189. [12] B. Zhang, M. Liu, Z. Yuan, Biosci. Biotechnol. Biochem. 70 (2006) 2199–2204. [13] K. Chenniappan, N. Ayyadurai, Parasitol. Res. 110 (2012) 381–388.

7

[14] B.A. Federici, L.S. Bauer, Appl. Environ. Microb. 64 (1998) 4368–4371. [15] V. Khasdan, M. Sapojnik, A. Zaritsky, A.R. Horowitz, S. Boussiba, M. Rippa, R. Manasherob, E. Ben-Dov, Arch. Microbiol. 188 (2007) 643–653. ˜ [16] M. Soberón, L. Pardo, C. Munóz-Garay, J. Sánchez, I. Gómez, H. Porta, A. Bravo, Pore Formation by Cry Toxins, Proteins Membrane Binding and Pore Formation, Springer, New York, 2010, pp. 127–142. [17] J.A. López-Diaz, P.E. Cantón, S.S. Gill, M. Soberón, A. Bravo, Environ. Microbiol. 15 (2013) 3030–3039. [18] D. Wu, B.A. Federici, J. Bacteriol. 175 (1993) 5276–5280. [19] V. Sazhenskiy, A. Zaritsky, M. Itsko, Appl. Environ. Microb. 76 (2010) 3409–3411. [20] L.F. Adams, J.E. Visick, H.R. Whiteley, J. Bacteriol. 171 (1989) 521–530. [21] J.E. Visick, H.R. Whiteley, J. Bacteriol. 173 (1991) 1748–1756. [22] Z. Shao, Z. Yu, Curr. Microbiol. 48 (2003) 321–326. [23] Z. Shao, Z. Liu, Z. Yu, Appl. Environ. Microb. 67 (2001) 5362–5369. [24] M. Diaz-Mendoza, D.K. Bideshi, F. Ortego, G.P. Farinos, B.A. Federici, Lett. Appl. Microbiol. 54 (2011) 88–95. [25] R.Z. Zghal, S. Jaoua, Mol. Biotechnol. 33 (2006) 191–198. [26] R.Z. Zghal, H. Trigui, M. Ben Ali, S. Jaoua, Mol. Biotechnol. 38 (2008) 121–127. [27] S. Jaoua, N. Zouari, S. Tounsi, R. Ellouz, FEMS Microbiol. Lett. 145 (1996) 349–354. [28] S. Tounsi, A. J’Mal, N. Zouari, S. Jaoua, Biotechnol. Lett. 21 (1999) 771–775. [29] S. Tounsi, S. Jaoua, FEMS Microbiol. Lett. 208 (2002) 215–218. [30] S. Tounsi, N. Zouari, S. Jaoua, J. Appl. Microbiol. 95 (2003) 23–28. [31] D. Ghribi, N. Zouari, S. Jaoua, J. Appl. Microbiol. 97 (2004) 338–346. [32] J. Sambrook, E.F. Frish, T. Maniatis, Molecular Cloning: A Laboratory Manual, second ed., Cold Spring Harbor Laboratory Press, NY, 1989. [33] R.S. Travers, P.A.W. Martin, C.F. Reichelderfer, Appl. Environ. Microb. 53 (1987) 1263–1266. [34] N. Zouari, A. Dhouib, R. Ellouz, S. Jaoua, Appl. Biochem. Biotechnol. 69 (1998) 41–52. [35] S. Tounsi, M. Dammak, A. Rebaî, S. Jaoua, Biol. Control 35 (2005) 27–31. [36] M.M. Bradford, Anal. Biochem. 72 (1976) 248–254. [37] U.K. Laemmli, Nature 227 (1970) 680–685. [38] S. Poitout, R. Bues, Ann. Zool. Ecol. Anim. 2 (1970) 79–91. [39] M. Sedlak, T. Walter, A. Aronson, J. Bacteriol. 182 (2000) 734–741. [40] K.M. McLean, H.R. Whiteley, J. Bacteriol. 169 (1987) 1017–1023. [41] H.W. Park, D.K. Bideshi, B.A. Federici, Curr. Microbiol. 55 (2007) 119–124. [42] B. Ge, D. Bideshi, W.J. Moar, B.A. Federici, FEMS Microbiol. Lett. 165 (1998) 35–41. [43] S. Tounsi, M. Dammak, N. Zouari, A. Rebaî, S. Jaoua, Biol. Control 37 (2006) 243–246. [44] B. Escriche, N. de Decker, J. van Rie, S. Jansens, E. van Kerkhove, Appl. Environ. Microb. 64 (1998) 1563–1565. [45] D.K. Bideshi, G. Waldrop, M.T. Fernandez-Luna, M. Diaz-Mendoza, M.C. Wirth, J.J. Johnson, H.W. Park, B.A. Federici, J. Microbiol. Biotechnol. 23 (2013) 1107–1115. [46] M.C. Del Rincón Castro, J. Barajas-Huerta, J. Ibarra, Appl. Environ. Microb. 65 (1999) 2049–2053. [47] D. Peng, S. Chen, L. Ruan, L. Li, Z. Yu, M. Sun, Food Chem. Toxicol. 45 (2007) 1179–1185. [48] V. Guidi, N. Patocchi, P. Luthy, M. Tonolla, Appl. Environ. Microbiol. 77 (2011) 3663–3668.


387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439

tolerance of two lepidopteran larvae to Bacillus thuringiensis Cry1Aa toxin.

Effect of midgut proteolytic activity on susceptibility of lepidopteran larvae to Bacillus thuringiensis subsp. Kurstaki.

Nitric oxide participates in the toxicity of Bacillus thuringiensis Cry1Ab toxin to kill Manduca sexta larvae.

Expression of the mosquitocidal toxins of Bacillus sphaericus and Bacillus thuringiensis subsp. israelensis by recombinant Caulobacter crescentus, a vehicle for biological control of aquatic insect larvae.

Biological control of mosquitoes and other biting flies by Bacillus sphaericus and Bacillus thuringiensis.

A screening of five Bacillus thuringiensis Vip3A proteins for their activity against lepidopteran pests.

A new serotype of Bacillus thuringiensis from Colombia toxic to mosquito larvae.

Knockdown of the MAPK p38 pathway increases the susceptibility of Chilo suppressalis larvae to Bacillus thuringiensis Cry1Ca toxin.

Different Effects of Bacillus thuringiensis Toxin Cry1Ab on Midgut Cell Transmembrane Potential of Mythimna separata and Agrotis ipsilon Larvae.

Comparison of development of Bacillus thuringiensis subsp. israelensis and Bacillus sphaericus in mosquito larvae.

Transcriptional cellular responses in midgut tissue of Aedes aegypti larvae following intoxication with Cry11Aa toxin from Bacillus thuringiensis.

Location of the dipteran specificity region in a lepidopteran-dipteran crystal protein from Bacillus thuringiensis.

Bacillus thuringiensis Vip3Aa Toxin Resistance in Heliothis virescens (Lepidoptera: Noctuidae).

Transgenic tomato line expressing modified Bacillus thuringiensis cry1Ab gene showing complete resistance to two lepidopteran pests.

A broad-spectrum cytolytic toxin from Bacillus thuringiensis var. kyushuensis.

Biological Control Potential of Bacillus amyloliquefaciens KB3 Isolated from the Feces of Allomyrina dichotoma Larvae.

Field Trial of Relative Efficacy of Abate and Bacillus thuringiensis Against Simulium himalayense Larvae (Diptera simulidae).

The construction of Bacillus thuringiensis strains expressing novel entomocidal delta-endotoxin combinations.

Digestion of Bacillus thuringiensis var. israelensis spores by larvae of Aedes aegypti.

Two new isolates of Bacillus thuringiensis pathogenic to Spodoptera litura.

Insecticidal Effects of Hemocoelic Delivery of Bacillus thuringiensis Cry Toxins in Achaea janata Larvae.

Two specific membrane-bound aminopeptidase N isoforms from Aedes aegypti larvae serve as functional receptors for the Bacillus thuringiensis Cry4Ba toxin implicating counterpart specificity.

Molecular docking and site-directed mutagenesis of a Bacillus thuringiensis chitinase to improve chitinolytic, synergistic lepidopteran-larvicidal and nematicidal activities.

Nucleotide sequence of a coleopteran-active toxin gene from a new isolate of Bacillus thuringiensis subsp. tolworthi.