Neutralization of Mitochondrial Superoxide by Superoxide Dismutase 2 Promotes Bacterial Clearance and Regulates Phagocyte Numbers in Zebrafish E. M. Peterman,a C. Sullivan,a,b M. F. Goody,a I. Rodriguez-Nunez,c J. A. Yoder,c C. H. Kima,b

Mitochondria are known primarily as the location of the electron transport chain and energy production in cells. More recently, mitochondria have been shown to be signaling centers for apoptosis and inflammation. Reactive oxygen species (ROS) generated as by-products of the electron transport chain within mitochondria significantly impact cellular signaling pathways. Because of the toxic nature of ROS, mitochondria possess an antioxidant enzyme, superoxide dismutase 2 (SOD2), to neutralize ROS. If mitochondrial antioxidant enzymes are overwhelmed during severe infections, mitochondrial dysfunction can occur and lead to multiorgan failure or death. Pseudomonas aeruginosa is an opportunistic pathogen that can infect immunocompromised patients. Infochemicals and exotoxins associated with P. aeruginosa are capable of causing mitochondrial dysfunction. In this work, we describe the roles of SOD2 and mitochondrial ROS regulation in the zebrafish innate immune response to P. aeruginosa infection. sod2 is upregulated in mammalian macrophages and neutrophils in response to lipopolysaccharide in vitro, and sod2 knockdown in zebrafish results in an increased bacterial burden. Further investigation revealed that phagocyte numbers are compromised in Sod2-deficient zebrafish. Addition of the mitochondrion-targeted ROS-scavenging chemical MitoTEMPO rescues neutrophil numbers and reduces the bacterial burden in Sod2-deficient zebrafish. Our work highlights the importance of mitochondrial ROS regulation by SOD2 in the context of innate immunity and supports the use of mitochondrion-targeted ROS scavengers as potential adjuvant therapies during severe infections.

T

he roles that mitochondria play in antiviral signaling, via mitochondrial antiviral-signaling protein and promotion of inflammation and apoptosis, are well established (1–3); however, their importance in innate immunity is only now becoming clear. While mitochondria can promote inflammation via NF-␬B signaling and NLRP3 inflammasome formation, inflammation can lead to mitochondrial dysfunction, which can compound the severity of exaggerated inflammatory conditions such as sepsis (4– 10). As the site of the electron transport chain within cells, mitochondria are a major source of reactive oxygen species (ROS) (mainly superoxide anions). ROS play diverse roles in cellular and organismal health, especially in innate immunity and inflammation. While the use of ROS to clear infections is beneficial to the host, inappropriate ROS production or lack of ROS neutralization can damage host DNA, proteins, and cell membranes. ROS-induced cellular damage can contribute to the undesired side effects of infectious and inflammatory diseases. Mechanisms are in place in hosts, and even some pathogens, to chemically convert ROS into less toxic compounds; however, overproduction of ROS can overwhelm host antioxidants. Thus, a better understanding of the impact of mitochondria, ROS, and mechanisms for neutralization of ROS on innate immunity could lead to improved treatments for infectious diseases and inflammatory disorders. The cellular mechanisms to neutralize ROS include the glutathione system, catalases, and the superoxide dismutase (SOD) family of enzymes. As superoxide producers, mitochondria are equipped with nuclear-encoded, mitochondrially localized SODs (SOD2, MnSOD) that convert superoxide into hydrogen peroxide. The deleterious effects of mitochondrial superoxide are demonstrated by mutations in SOD2 being implicated in idiopathic cardiomyopathy, age-related macular degeneration, aberrant

430

iai.asm.org

brain morphology, motor neuron disease, vascular complications of diabetes, and cancer, whereas overexpression of SOD2 increases the Drosophila life span (11, 69–72). Despite the importance of SOD2 and the regulation of ROS for health, surprisingly little is known about the role of SOD2 in immunity. Numerous studies have implicated SOD2 in the immune response, but few have defined functional roles for SOD2 in immunity. SOD2 is upregulated in response to lipopolysaccharide (LPS), poly(I·C), beta-glucan, and numerous pathogens in multiple cell types and organisms (12–17). Functionally, SOD2 was found to be necessary for the phorbol myristate acetate-induced respiratory burst response and cell survival upon poly(I·C) exposure in vitro (16, 17). In a mouse model with SOD2 deleted specifically from thymocytes, the animals did not mount an effective adaptive immune response to influenza virus infection because of disrupted T-cell

Received 25 June 2014 Returned for modification 24 July 2014 Accepted 5 November 2014 Accepted manuscript posted online 10 November 2014 Citation Peterman EM, Sullivan C, Goody MF, Rodriguez-Nunez I, Yoder JA, Kim CH. 2015. Neutralization of mitochondrial superoxide by superoxide dismutase 2 promotes bacterial clearance and regulates phagocyte numbers in zebrafish. Infect Immun 83:430 – 440. doi:10.1128/IAI.02245-14. Editor: B. A. McCormick Address correspondence to C. H. Kim, [email protected]. This is Maine Agricultural and Forest Experiment Station publication 3378. Supplemental material for this article may be found at http://dx.doi.org/10.1128 /IAI.02245-14. Copyright © 2015, American Society for Microbiology. All Rights Reserved. doi:10.1128/IAI.02245-14

Infection and Immunity

January 2015 Volume 83 Number 1

Downloaded from http://iai.asm.org/ on March 23, 2015 by UNIVERSITY OF MEMPHIS

Department of Molecular and Biomedical Sciences, University of Maine, Orono, Maine, USAa; Graduate School of Biomedical Sciences and Engineering, University of Maine, Orono, Maine, USAb; Department of Molecular Biomedical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, North Carolina, USAc

Sod2 Function Promotes Innate Immunity In Vivo

MATERIALS AND METHODS Zebrafish husbandry. Zebrafish were maintained at 28°C on a 16-h light/ 8-h dark cycle at the University of Maine Zebrafish Facility. Zebrafish were maintained according to standards established by the University of Maine Institutional Animal Care and Use Committee. Embryos were obtained from natural spawning of adult AB or Tg(mpx:GFP) (29) zebrafish. Embryos were grown in egg water (20 g/liter Instant Ocean Salts). Egg water was changed daily. MitoTEMPO was initially dissolved in nuclease-free water, and exposures were performed by diluting the 10 mM stock in egg water for a final concentration of 10 ␮M. Embryos were exposed from the one-cell stage and were dechorionated at 24 h postfertilization (hpf). Morpholino oligonucleotide injections. A translation-blocking morpholino oligonucleotide was designed to target sod2 mRNA (Gene Tools). The sequence is 5=-GAACATATCCGACTCTGCACAGCAT-3=. The Gene Tools standard control morpholino oligonucleotide was used as a control. Morpholino oligonucleotides were prepared in Danieau’s buffer [58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM Ca(NO3)2, 5 mM HEPES (pH 7.6), 0.5% phenol red (Sigma-Aldrich), nuclease-free water]. Zebrafish embryos were injected in the yolk at the one- to four-cell stage with either 12 ng of sod2 or control morpholino oligonucleotide in a volume of 3 nl. Bacterial injections. P. aeruginosa(p67T1), which constitutively expresses the fluorescent protein dTomato, was incubated overnight in LB broth containing ampicillin at a concentration of 750 ␮g/ml (30). Cultures were spun at 2,450 ⫻ g for 5 min at 4°C. The pellets were resuspended in sterile 1⫻ phosphate-buffered saline (PBS), and this washing procedure was repeated two additional times. To calculate the number of CFU injected per fish, the optical density at 600 nm was measured and adjusted to 4 ⫻ 109 CFU/ml. P. aeruginosa bacteria were prepared in a 0.2% phenol red injection solution. Embryos were infected at either 28 or 48 hpf. Zebrafish embryos were manually dechorionated and anesthetized in a tricaine solution (Western Chemical, Ferndale, WA) at a concentration of 4 mg/ml. Fish were mock infected with PBS containing 0.5% phenol red. Fish were injected via the cardinal vein with 1.5 nl of solution. The different experimental conditions were rotated frequently during the zebrafish infections (every 5 to 10 embryos) to ensure that the zebrafish were infected as equally as possible under all of the experimental conditions. In order to determine the titer of the inoculum, 1.5 nl was injected into PBS and plated onto LB agar both before and after injection of the zebrafish. The inoculum used in each experiment is defined as the average number

January 2015 Volume 83 Number 1

of CFU on the “before” and “after” LB plates. The standard deviation of the inoculum from these plates was less than or equal to 40% of the mean. Bacterial burden assay. Fish were washed in 4 mg/ml tricaine solution and homogenized with a Bullet Blender (Next Advance) at speed 8 for 2 min. Single fish were homogenized in 200 ␮l of PBS in 1.7-ml centrifuge tubes along with two 4.2-mm metal beads. Homogenates were diluted in PBS and plated onto cetrimide agar to isolate P. aeruginosa colonies. Respiratory burst assay. The respiratory burst assay was performed according to Hermann et al. and Goody et al. (31, 32). FACS analysis of green fluorescent protein-positive (GFPⴙ) cells. Fluorescence-activated cell sorter (FACS) analysis was performed with a BD LSRII (BD Biosciences). Tg(mpx:EGFP) fish were mechanically dissociated at 2 or 3 dpf through 40-␮m filters into 2 ml of sterile PBS. Five fish per replicate and at least four replicates were used in each experiment. The PBS solution was centrifuged at 100 ⫻ g for 5 min at 4°C. Dissociated cells were resuspended in PBS and washed once. Sytox Red (Invitrogen) was used for dead-cell staining. Capture of images. Embryos were imaged with the Olympus Fluoview 1000 software package on an Olympus IX-81 inverted microscope. Fish were mounted in 1% agar, and maximum-projection images were obtained with a 4⫻ objective. In situ hybridization (ISH) images were captured as previously described by Goody et al. (33), with minor modifications. Embryos at all stages were whole mounted by clearing their yolks in methanol for 15 min, followed by 1:2 benzyl alcohol-benzyl benzoate for 15 min, side oriented in Permount, and then imaged. Cell culture and LPS exposure. RAW264.7 cells (generously provided by Robert Wheeler, University of Maine) were maintained at 37°C at 5% CO2 with 1⫻ Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (FBS), 2 mM GlutaMAX, 100 U/ml penicillin, and 100 ␮g/ml streptomycin. HL-60 cells were maintained at 37°C at 5% CO2 with 1⫻ Iscove’s modified Dulbecco’s medium supplemented with 20% FBS, 2 mM GlutaMAX, 100 U/ml penicillin, and 100 ␮g/ml streptomycin. For HL-60 differentiation, cells were maintained in a 1.3% dimethyl sulfoxide solution for 7 to 8 days. The percentage of differentiated HL-60 (dHL-60) cells was determined via flow cytometry with an anti-CD11bfluorescein isothiocyanate (FITC) antibody. Only samples with ⬎50% FITC⫹ cells were used for data analysis. For LPS exposures, the same conditions were used for both RAW264.7 and dHL-60 cells. Cells were exposed to LPS at a final concentration of 100 ng/ml for 3, 6, or 24 h. Cells were collected and subjected to RNA extraction. RNA extraction and quantitative PCR. RNA was extracted via the TRIzol method or in accordance with the protocol of the Promega SV Total RNA Isolation kit (Promega). Reverse transcriptase reactions were performed with iScript reverse transcriptase (Bio-Rad) according to the manufacturer’s instructions. Quantitative PCR was performed with SsoFast EvaGreen Supermix (Bio-Rad) in accordance with the manufacturer’s instructions. At least three biological replicates per time point were used. CT values were normalized with glyceraldehyde 3-phosphate dehydrogenase, and changes relative to unexposed samples were calculated. Primer sequences for quantitative PCR were obtained from PrimerDepot. ISH. The sequences of the primers used for sod2 ISH probe synthesis were 5= AGAGCGGAAGATTGAGGATTG 3= (forward) and 5= TACAGT GCACAGTTCTGTATGG 3= (reverse). The sequences of the primers used for mpeg1 ISH probe synthesis were: 5= ACCCAACGCTTCTTGTCTAAT 3= (forward) and 5= GAGAGCAGTGTTGAGATTG 3= (reverse). A T3 promoter sequence was added to the 5= end of each reverse primer. ISH was performed as previously described (34). Zebrafish were treated with phenylthiourea (PTU) at a final concentration of 20 ␮g/ml. Egg water and PTU solution was changed daily. Detection of sod2 in zebrafish tissues. Tissues were dissected from five zebrafish (EkkWill Waterlife Resources), and total RNA was purified with TRIzol reagent (Life Technologies). Lymphoid and myeloid cell populations were isolated from pooled kidneys of five zebrafish as described previously (35). In brief, kidneys from adult zebrafish were dissected and

Infection and Immunity

iai.asm.org

431

Downloaded from http://iai.asm.org/ on March 23, 2015 by UNIVERSITY OF MEMPHIS

development (18), illustrating SOD2 function in immunity in vivo. Despite these indications that SOD2 functions in immunity, the role of SOD2 in the innate immune response to infection in vivo has yet to be investigated. The zebrafish (Danio rerio) is a validated model organism for studies of development, genetics, and regeneration, as well as toxicology and immunology research. The zebrafish model is well suited for the study of Sod2 in innate immunity because the immune system is conserved between zebrafish and humans (19– 23), the zebrafish ortholog of sod2 has been identified and characterized (24), and zebrafish embryos can be infected with a range of human pathogens (25–28). Using the zebrafish model of systemic Pseudomonas aeruginosa infection, we find that Sod2 knockdown renders embryos more susceptible to infection (increased mortality and bacterial burden) as a result of decreased macrophage and neutrophil numbers. A mitochondrial superoxide-scavenging compound rescues neutrophils, increasing their number, and enhances bacterial clearance in Sod2-deficient embryos. Together, these results indicate that Sod2 promotes innate immune function by protecting phagocytes from the negative effects of mitochondrial superoxide.

Peterman et al.

exposure in RAW264.7 macrophages at 3, 6, and 24 h postexposure (hpe). (B) Quantitative PCR measurements of sod2 in response to LPS exposure in dHL-60 neutrophil-like cells. Error bars represent standard errors of the means. Significance was determined with an unpaired t test (***, P ⬍ 0.001; **, P ⬍ 0.01). Data shown are representative of two individual experiments.

homogenized with a 40-␮m nylon mesh filter in ice-cold PBS plus 5% FBS. Propidium iodide was added to a concentration of 1 ␮g/ml. Myeloid and lymphoid cells were isolated from this single-cell suspension by sorting based on propidium iodide exclusion, forward scatter, and side scatter with a BD FACS Aria II SORP flow cytometer (Becton Dickinson). Cell populations were sorted twice to optimize cell purity. Total RNA from the sorted cells was isolated by RNeasy Micro kit (Qiagen). cDNAs were obtained by using total RNA (2 ␮g for tissues, 0.05 ␮g for lymphoid and myeloid cells), oligo(dT) primers and SuperScript III reverse transcriptase (Life Technologies). The expression of sod2 was assessed by PCR with sod2 primer pairs and TITANIUM Taq DNA polymerase (Clontech). The sequences of the sod2 primers used were 5= CTG GGGCTGGCTGGGCTTTG 3= (forward) and 5= GCAGCTTGGAAACG CTCGCT 3= (reverse). The primers span an exon-exon junction to ensure amplification of cDNA. The cycling parameters included an initial 1-min denaturation at 95°C, followed by 35 (tissues) or 45 (cells) cycles of a 30-s denaturation step at 95°C, a 30-s primer-annealing step at 60°C, and a 30-s extension step at 68°C. A final 3-min extension at 68°C was performed. Amplicons were observed by agarose gel electrophoresis. ␤-Actin primers (36) were used as a standard reference, while myeloperoxidase primer pairs (36) and T-cell receptor alpha primer pairs (TCRa) (37) provided positive controls for myeloid and lymphoid cells, respectively.

RESULTS

Sod2 is upregulated in response to LPS in mammalian macrophages and neutrophils. Previous studies have reported increased sod2 expression in response to infectious stimuli with various exposure time points and model systems. We confirmed the differential expression of sod2 in response to LPS under our own specific conditions to determine whether SOD2 has a role in the innate immune response. We first examined whether sod2 expression is differentially regulated in response to an inflammatory stimulus in mammalian phagocytes in vitro. dHL-60 (human neutrophil-like) and RAW264.7 (murine macrophage) cells were exposed to LPS. LPS is an outer cell membrane component found in many bacteria and, as an endotoxin, is known to stimulate a proinflammatory response in immune cells via Toll-like receptor 4 and caspase 11. RNA was collected at 3, 6, and 24 h after LPS exposure, and sod2 expression was analyzed via quantitative PCR. sod2 was found to be significantly upregulated in response to LPS in both mammalian immune cell types at all of the time points assayed (Fig. 1A and B). These data suggest that

432

iai.asm.org

SOD2 is upregulated as part of the innate immune response to bacterial infection. Sod2 is expressed in zebrafish myeloid and hematopoietic tissues. To investigate the role of Sod2 in innate immunity in vivo, we employed the embryonic zebrafish model system. sod2 is known to be expressed in the heart, lung, liver, and blood tissues of humans and in the liver, optic tectum, retina, kidney, and pectoral fin of zebrafish (38–41). While sod2 is expressed in human blood and immune cell lineages, there has been no such characterization of sod2 expression in the corresponding zebrafish tissues. Wholemount ISH for detection of sod2 mRNA was conducted with zebrafish embryos (Fig. 2A to D). ISH revealed sod2 expression in the caudal hematopoietic tissue of 24-hpf embryos (Fig. 2B, arrowhead). Previously, this area has been described as a major site of hematopoiesis in developing zebrafish embryos (21, 42, 43). PCR amplification of cDNA showed that sod2 transcripts were present in many tissues of adult zebrafish (Fig. 2E). Most notably, sod2 was detected in myeloid cells (Fig. 2F). We did not detect any significant difference in sod2 expression in P. aeruginosa-infected embryos from that in controls; however, RNA was isolated from whole embryos and differential expression of sod2 in small populations of cells could have been masked by the heterogeneity of the sample (data not shown). While sod2 expression is detected in many cell and tissue types in developing and adult zebrafish, the expression of sod2 in hematopoietic and myeloid tissues suggests a potential function for Sod2 in the zebrafish innate immune response. Susceptibility to bacterial infection increases upon loss of Sod2. We hypothesized a role for sod2 in the innate immune response to bacterial infection because of its upregulation in response to LPS and expression in hematopoietic and myeloid cells in zebrafish. To elucidate the roles of Sod2 in innate immunity in vivo, a reverse genetics approach was taken. Zebrafish embryos were injected at the one-cell stage with translation-blocking antisense oligonucleotides targeting the translation start site of sod2 mRNA or standard control morpholino oligonucleotides. The efficacy and specificity of sod2 morpholino oligonucleotides are demonstrated in Fig. S1 in the supplemental material. Mortality curves and bacterial clearance assays were performed with control and sod2 morphant zebrafish infected with P. aeruginosa(p67T1).

Infection and Immunity

January 2015 Volume 83 Number 1

Downloaded from http://iai.asm.org/ on March 23, 2015 by UNIVERSITY OF MEMPHIS

FIG 1 sod2 is upregulated in mammalian phagocytes in response to bacterial stimuli. (A) Quantitative PCR measurements of sod2 expression in response to LPS

Sod2 Function Promotes Innate Immunity In Vivo

P. aeruginosa was injected into the cardinal vein at 28 hpf (solely macrophages in circulation) or 48 hpf (both macrophages and neutrophils in circulation) to cause a systemic infection as described previously by Clatworthy et al. (25). There was no difference in cumulative mortality between uninfected sod2 morphants and uninfected control morphants (Fig. 3A and E), indicating that Sod2 knockdown alone does not result in death. However, there was a statistically significant increase in cumulative mortality between P. aeruginosa-infected sod2 morphants and infected control morphants (Fig. 3A and E, P ⬍ 0.0005 and P ⬍ 0.05). The inocula for the representative mortality curves at 28 and 48 hpf were 420 and 760 CFU, respectively. We next sought to determine if increased mortality upon systemic bacterial infection in sod2 morphants correlated with enhanced bacterial burden. Uninfected morphants showed no growth of P. aeruginosa (data not shown). sod2 morphants displayed more fluorescent P. aeruginosa upon observation via confocal microscopy (Fig. 3C, D=, G, and H=). Bacterial burden assays revealed that infected sod2 morphants averaged significantly more CFU per embryo at 48 and 68 hpf (Fig. 3B, P ⬍ 0.0001, and F, P ⬍ 0.05). The inoculum for the representative bacterial burdens at 28 and 48 hpf were 3,700 and 620 CFU, respectively. Together, these data demonstrate that sod2 morphants are more susceptible to bacterial infection, as shown by both enhanced mortality and decreased bacterial clearance. Thus, Sod2 is necessary for normal innate immune function in vivo. Sod2 enhances phagocyte numbers. Although the previous results indicate a role for Sod2 in the clearance of a bacterial in-

January 2015 Volume 83 Number 1

fection, it is not clear why loss of Sod2 results in an impaired innate immune response. As sod2 is expressed at sites of zebrafish hematopoiesis and in zebrafish myeloid cells, it is possible that Sod2 regulates phagocyte populations. Phagocyte populations were monitored throughout development via either ISH for macrophage populations or utilization of the Tg(mpx:EGFP) transgenic line for neutrophil populations (29). ISH for mpeg1 expression revealed that, at 28 hpf, the number of macrophages in the yolk circulation valley did not appear different between control and sod2 morphants (Fig. 4A and B). At 48 hpf, the number of macrophages was visibly lower in the caudal hematopoietic tissue of sod2 morphants than in that of controls (Fig. 4C and D). At 72 hpf, macrophages were observed primarily in the head and heart regions of control morphant zebrafish (Fig. 4E). The number of macrophages in sod2 morphants appeared to remain lower than that in controls at 72 hpf (Fig. 4F). For the examination of neutrophils, Tg(mpx:EGFP) zebrafish were injected with either sod2 or control morpholino oligonucleotides and imaged at 48 or 72 hpf via confocal microscopy. The numbers of neutrophils in control and sod2 morphants appeared equal at 48 hpf, but there was a visible reduction in the number of neutrophils at 72 hpf in sod2 morphants compared to that in controls (Fig. 4G to J). Additionally, the spatial localization of neutrophils was dispersed in sod2 morphants (arrowheads Fig. 4 I, J). Next, we quantified the difference in neutrophil numbers by flow cytometry. Flow cytometric analysis revealed that there was no significant difference in the numbers of GFP⫹ cells in control and sod2 morphants at 48 hpf (Fig. 4K); whereas at 72 hpf, sod2 morphants displayed signifi-

Infection and Immunity

iai.asm.org

433

Downloaded from http://iai.asm.org/ on March 23, 2015 by UNIVERSITY OF MEMPHIS

FIG 2 sod2 is expressed in zebrafish hematopoietic and myeloid tissues. (A to D) Spatiotemporal expression of sod2 in PTU-treated zebrafish, whole mounted, anterior left, dorsal top. (A) sod2 mRNA is maternally expressed. (B) sod2 is expressed in the posterior blood island (arrowhead in inset) at 24 hpf. (C) At 48 hpf, sod2 is expressed in the brain, ear, and posterior pronephric duct (the arrowhead in the top inset denotes expression in the ear, and the arrowhead in the bottom inset denotes expression in the pronephric duct). (D) sod2 expression is detected in the brain and pectoral fin at 72 hpf (arrowhead in inset points to pectoral fin expression). (E, F) PCR amplification of a 222-bp fragment of sod2 from cDNA of various adult zebrafish tissues. PCR amplification reveals that sod2 is highly expressed in each of these cell types, including myeloid cells (a positive control for sorted myeloid cells is mpx, and a positive control for sorted lymphoid cells is TCRa). ␤-Actin expression was used as an endogenous control.

Peterman et al.

Downloaded from http://iai.asm.org/ on March 23, 2015 by UNIVERSITY OF MEMPHIS

434

iai.asm.org

Infection and Immunity

January 2015 Volume 83 Number 1

Sod2 Function Promotes Innate Immunity In Vivo

of MitoTEMPO on P. aeruginosa because 10 ␮M MitoTEMPO did not have any effect on the growth of P. aeruginosa in vitro (data not shown). Our results indicate that the regulation of mitochondrial superoxide by Sod2 is both necessary and sufficient for normal phagocyte populations and thus the innate immune response to bacterial infection in vivo. DISCUSSION

The hypothesis that SOD2 has a role in modulation of the innate immune response to bacterial infection in vivo was tested. After knockdown of Sod2, zebrafish displayed an increased mortality rate upon infection with P. aeruginosa and a decrease in the ability to clear the infection. Given the expression of sod2 in zebrafish myeloid cells, we examined the possibility that Sod2 regulates myeloid cell populations. We found that sod2 morphants developed phagocyte populations normally but were unable to either increase or maintain their phagocyte populations over developmental time. It was found that addition of a mitochondrion-specific superoxide scavenger could rescue the diminished neutrophil populations in sod2 morphants, which translated into an improved respiratory burst potential and better clearance of bacteria. We conclude that Sod2, via regulation of mitochondrial superoxide, plays a critical role in the regulation of phagocyte numbers and innate immunity in zebrafish. Role for Sod2 in myeloid cell number. Mitochondrial superoxide regulation is fundamental to the maintenance of cell homeostasis. Lack of regulation can result in damage to mitochondrial DNA and mitochondrial proteins, leading to a feed-forward loop of increasing oxidative stress (2, 8, 45, 46). When the mechanisms of mitochondrial ROS regulation are not in place or are overwhelmed, mitochondrial oxidative stress will have effects on cellular processes beyond the mitochondria. In the zebrafish model, we found that knockdown of Sod2 led to increased susceptibility to bacterial infection because of the presence of fewer phagocytes. The loss of Sod2 could have impacted phagocyte populations via either cell-intrinsic or cell-extrinsic effects on hematopoiesis or apoptosis. It is possible that the loss of Sod2 and subsequent loss of regulation of mitochondrial superoxide could cause developmental defects in hematopoiesis, such as disrupted specification, differentiation, homing, engraftment, or maintenance of hematopoietic stem cells (HSCs). HSCs differentiate into lymphoid and myeloid populations and maintain the HSC pool under normal and infection conditions. We observed that the numbers of GFP⫹ neutrophils in sod2 morphants were similar at 48 and 72 hpf; whereas numbers of GFP⫹ neutrophils had dramatically increased in control morphants between 48 and 72 hpf. This suggests that while the initial wave of neutrophils in sod2 morphants develops normally,

FIG 3 Sod2 is involved in clearance of P. aeruginosa by the zebrafish innate immune system. (A, B) Sod2 knockdown decreases survival (A) and increases bacterial burdens (B) in zebrafish infected with P. aeruginosa at 28 hpf. (C to D=) P. aeruginosa-infected embryos fixed at 48 hpf, whole mounted, anterior left, dorsal top. (C, C=) Fluorescence (C) or merged fluorescence and bright-field (C=) images of a control infected embryo. (D, D=) Fluorescence (D) and merged fluorescence and bright-field (D=) images of a sod2 morphant-infected embryo. (E, F) Sod2 knockdown decreases survival (E) and increases bacterial burdens (F) in zebrafish infected with P. aeruginosa at 48 hpf. (G, H=) P. aeruginosa-infected embryos fixed at 68 hpf, whole mounted, anterior left, dorsal top. (G, G=) Fluorescence (G) and merged fluorescence and bright-field (G=) images of a control infected embryo. (H, H=) Fluorescence (H) and merged fluorescence and bright-field (H=) images of a sod2 morphant infected embryo. Data are representative of three individual experiments. Error bars represent standard errors of the means. For mortality plots, statistical significance was determined with a log-rank test (***, P ⬍ 0.001; n ⫽ 22, 14, 43, and 38 embryos for control morpholino oligonucleotides (MOs) PBS, sod2 MOs PBS, control MOs P. aeruginosa (PA), and sod2 MOs PA, respectively; **, P ⬍ 0.01; n ⫽ 28, 27, 63, and 66 embryos for control MOs PBS, sod2 MOs PBS, control MOs PA, and sod2 MOs PA, respectively). For bacterial burdens, statistical significance was determined with an unpaired t test (***, P ⬍ 0.001; n ⫽ 10 or 11 for control or sod2 MOs, respectively; *, P ⬍ 0.05; n ⫽ 8 embryos).

January 2015 Volume 83 Number 1

Infection and Immunity

iai.asm.org

435

Downloaded from http://iai.asm.org/ on March 23, 2015 by UNIVERSITY OF MEMPHIS

cantly fewer neutrophils than controls (Fig. 4L, P ⬍ 0.01). We also noted that while the percentage of GFP⫹ cells increased in control morphants between 48 and 72 hpf (0.16 to 0.35%), the percentage of GFP⫹ cells remained relatively constant in sod2 morphants between 48 and 72 hpf (0.2 to 0.22%). We then tested the ability of phagocytes to mount a respiratory burst response in vivo. A fluorescence assay to quantify the respiratory burst in zebrafish embryos has been previously described (31, 32), in which PMA is used to activate protein kinase C, resulting in ROS production in phagocytes via NAPDH oxidase. At 48 hpf, the respiratory burst potentials of controls and sod2 morphants were similar (Fig. 4M). At 72 hpf, the respiratory burst potential was significantly lower in sod2 morphants than in controls (Fig. 4N, P ⬍ 0.0001), likely because of the reduced number of phagocytes in sod2 morphants than in controls at this time point. These results suggest that Sod2 is not required for development of the initial populations of zebrafish macrophages and neutrophils but is required for the increase in phagocyte numbers over developmental time or the maintenance of these cell types. The failure to establish or maintain an adequate phagocyte population potentially explains the increased susceptibility to bacterial infection observed in sod2 morphant zebrafish. The reduction of mitochondrial superoxide anions is sufficient to rescue neutrophil numbers and to promote bacterial clearance in sod2 morphant zebrafish. The enzymatic function of Sod2 is dismutation of mitochondrial superoxide anions, but it is unclear if the role of Sod2 in preserving the neutrophil number is due to regulation of superoxide. MitoTEMPO is a compound that scavenges mitochondrial superoxide anions, thereby mimicking the enzymatic function of Sod2. Control and sod2 morphants were incubated with and without 10 ␮M MitoTEMPO in an attempt to rescue the decreased neutrophil populations and innate immune deficiency observed in sod2 morphants. Neutrophil populations were visualized and quantified by confocal microscopy and flow cytometry, respectively; and one aspect of neutrophil function was quantified via respiratory burst assay. Exposure to MitoTempo alone did not change the respiratory burst of wildtype zebrafish (data not shown). MitoTEMPO rescued the diminished number of neutrophils at 72 hpf in sod2 morphants compared to that in controls (Fig. 5A to D). Concurrently, MitoTEMPO increased the respiratory burst potential of sod2 morphants, restoring it to near control levels (Fig. 5F). MitoTEMPO also decreased the bacterial burden in sod2 morphants infected with P. aeruginosa (Fig. 5E). The inoculum for this representative bacterial burden experiment was 3,040 CFU. The improved innate immune response to bacterial infection seen in sod2 morphants incubated in MitoTEMPO is likely due to the effect of MitoTEMPO on phagocyte populations rather than a direct effect

Peterman et al.

436

iai.asm.org

Infection and Immunity

January 2015 Volume 83 Number 1

Downloaded from http://iai.asm.org/ on March 23, 2015 by UNIVERSITY OF MEMPHIS

FIG 4 Sod2 enhances zebrafish phagocyte populations. (A to F) PTU-treated wild-type AB embryos, whole mounted, anterior left, dorsal top. ISH with a mpeg1 probe. (A) 28-hpf control. (B) 28-hpf sod2 morphant. Arrowheads in insets point to mpeg1-expressing cells in the yolk circulation valley. (C) 48-hpf control. (D) 48-hpf sod2 morphant. Note that at 48-hpf sod2 morphants display fewer macrophages in their caudal hematopoietic tissue than controls do (black arrowheads in insets). (E) 72-hpf control. (F) 72-hpf sod2 morphant. Insets of the heart/head region show that there are fewer mpeg1-expressing cells in sod2 morphants than in controls. (G to J=) Confocal micrographs of side-mounted, anterior left, dorsal top Tg(mpx:EGFP) zebrafish. (G) Fluorescence panel of 48-hpf control. (G=) Merged bright-field and fluorescence images of 48-hpf control. (H) Fluorescence panel of 48-hpf sod2 morphant. (H=) Merged bright-field and fluorescence images of 48-hpf sod2 morphant. (I) Fluorescence panel of 72-hpf control. (I=) Merged bright-field and fluorescence images of 72-hpf control. (J) Fluorescence panel of 72-hpf sod2 morphant. (J=) Merged bright-field and fluorescence images of 72-hpf sod2 morphant. sod2 morphants appear to have fewer neutrophils at 72 hpf than controls do. Arrowheads indicate a decrease in the neutrophil population in the caudal hematopoietic tissue. (K, L) Quantification of Mpx-GFP⫹ cells by flow cytometry in controls and sod2 morphants at 48 (K) and 72 (L) hpf. sod2 morphants have significantly fewer neutrophils than controls at 72 hpf (**, P ⬍ 0.01; n ⫽ 5 pooled embryos per treatment per replicate, 5 replicates per experiment). (M, N) Quantification of the respiratory burst in individual whole zebrafish. (M) At 48 hpf, the respiratory burst of sod2 morphants is equal to that of control morphants. (N) At 72 hpf, sod2 morphants have a significantly impaired ability to produce ROS in response to chemical activation of the phagocyte respiratory burst (***, P ⬍ 0.001; n ⫽ 24 embryos per treatment per experiment). Data are representative of three individual experiments. Error bars represent standard errors of the means. Statistical significance was determined with an unpaired t test.

Sod2 Function Promotes Innate Immunity In Vivo

there may be a failure in subsequent neutrophil maturation, either because of a reduction in the number of HSCs or HSC proliferation or differentiation into neutrophils. Loss of sod2 and increased oxidative stress are known to activate transcription factors such as FoxO3a, which could be involved in the altered phagocyte numbers observed in sod2 morphants. FoxO3a is a transcription factor that has been found to be necessary for maintenance of the HSC pool (47, 48). In FoxO3a⫺/⫺ mice, an increase in ROS led to a disrupted HSC quiescence, and elderly FoxO3a⫺/⫺ mice were shown to have a decreased population of HSCs. Additionally, FoxO3a⫺/⫺ mice were shown to have reduced SOD2 expression (47). Therefore, it is possible that proper maintenance of the HSC pool is dependent on the regulation of mitochondrial superoxide via SOD2 and that SOD2 depletion may be sufficient to negatively impact the HSC pool. Loss of Sod2 in zebrafish HSCs could cause aberrant mitochondrial function, potentially leading to loss of specification, changes in the cell cycle, or cell death. Alternatively, the toxic oxidizing environment caused by the loss of Sod2 could alter the HSC pool over time and this could serve as an explanation for the failure of sod2 morphants to generate or maintain normal phagocyte populations.

January 2015 Volume 83 Number 1

Another potential mechanism through which Sod2 and mitochondrial superoxide could be impacting phagocyte numbers is by mediating p53-dependent or p53-independent apoptosis. Previously, it has been shown that Sod2 and p53 negatively regulate each other, i.e., in the absence of Sod2, the expression of p53 is increased (49). The inflammatory cytokine tumor necrosis factor alpha (TNF-␣) has been shown to induce cell death via a p53independent mechanism in which TNF-␣-associated increases in mitochondrial ROS result in prolonged JNK activation and caspase activation (50). Therefore, the loss of Sod2 and resulting increase in mitochondrial superoxide could cell intrinsically or extrinsically activate p53-dependent or -independent apoptosis. Thus, the reduced phagocyte numbers in sod2 morphants could result from several different mechanisms, such as an altered microenvironment or cellular signals affecting apoptosis or hematopoiesis. Implications for SOD2 in human health. The upregulation of SOD2 in mouse and human cell lines in response to pathogens and a role for SOD2 in mammalian adaptive immunity suggest that the function of Sod2 elucidated here in innate immunity could be conserved in higher vertebrates. The proinflammatory signaling

Infection and Immunity

iai.asm.org

437

Downloaded from http://iai.asm.org/ on March 23, 2015 by UNIVERSITY OF MEMPHIS

FIG 5 Innate immune deficiency in sod2 morphants is rescued by MitoTEMPO. (A to C) Confocal micrographs of side-mounted, anterior left, dorsal top, 72-hpf Tg(mpx:EGFP) zebrafish. (A) Fluorescence panel of control. (B) Fluorescence panel of sod2 morphant. (C) Fluorescence panel of MitoTEMPO-treated sod2 morphant. sod2 morphants exposed to MitoTEMPO display recovered neutrophil populations. Arrowheads point to neutrophils in the caudal hematopoietic tissue. (D) Quantification of neutrophils via flow cytometry in sod2 morphants exposed to MitoTEMPO reveals that neutrophil populations are restored to control levels (**, P ⬍ 0.01; *, P ⬍ 0.05; n ⫽ 5 pooled embryos per treatment per replicate, 4 replicates per experiment). (E) sod2 morphants exposed to MitoTEMPO have better bacterial clearance than unexposed sod2 morphants (**, P ⬍ 0.01; n ⫽ 4, 9, and 6 embryos for control MOs, sod2 MOs, and sod2 MOs plus MitoTEMPO, respectively). (F) Respiratory-burst activity of sod2 morphants exposed to MitoTEMPO is restored to normal levels (***, P ⬍ 0.001; n ⫽ 12, 11, and 12 embryos for control MOs, sod2 MOs, and sod2 MOs plus MitoTEMPO, respectively). Data are representative of three individual experiments. Error bars represent standard errors of the means. Statistical significance was determined with one-way analysis of variance and Fisher’s least significant difference posttest.

Peterman et al.

ACKNOWLEDGMENTS This work was supported by NIH P20GM103534. We thank Robert Wheeler for providing RAW264.7 cells, John Singer for providing P. aeruginosa(p67T1), and Stephen Renshaw for providing Tg(mpx:EGFP) zebrafish. We also thank Paul Millard for helpful discussion; Clarissa Henry for helpful discussion and use of reagents; Mark Nilan for zebrafish maintenance; and Meghan Breitbach, Richard Luc, and Dawn Sullivan for their support and technical assistance throughout the course of this project.

REFERENCES 1. Scott I. 2010. The role of mitochondria in the mammalian antiviral defense system. Mitochondrion 10:316 –320. http://dx.doi.org/10.1016/j .mito.2010.02.005. 2. Ott M, Gogvadze V, Orrenius S, Zhivotovsky B. 2007. Mitochondria, oxidative stress and cell death. Apoptosis 12:913–922. http://dx.doi.org/10 .1007/s10495-007-0756-2. 3. Holley A, Dhar S, Xu Y, SC D. 2012. Manganese superoxide dismutase: beyond life and death. Amino Acids 42:139 –158. http://dx.doi.org/10 .1007/s00726-010-0600-9. 4. Siomek A. 2012. NF-␬B signaling pathway and free radical impact. Acta Biochim Pol 59:323–331.

438

iai.asm.org

5. Morgan MJ, Liu Z. 2011. Crosstalk of reactive oxygen species and NF-␬B signaling. Cell Res 21:103–115. http://dx.doi.org/10.1038/cr.2010.178. 6. Li X, Fang P, Mai J, Choi ET, Wang H, Yang X. 2013. Targeting mitochondrial reactive oxygen species as novel therapy for inflammatory diseases and cancers. J Hematol Oncol 6:19. http://dx.doi.org/10.1186 /1756-8722-6-19. 7. Zhou R, Yazdi AS, Menu P, Tschopp J. 2011. A role for mitochondria in NLRP3 inflammasome activation. Nature 469:221–225. http://dx.doi.org /10.1038/nature09663. 8. López-Armada MJ, Riveiro-Naveira RR, Vaamonde-García C, Valcárcel-Ares MN. 2013. Mitochondrial dysfunction and the inflammatory response. Mitochondrion 13:106 –118. http://dx.doi.org/10.1016/j.mito .2013.01.003. 9. Garrabou G, Morén C, López S, Tobías E, Cardellach F, Miró O, Casademont J. 2012. The effects of sepsis on mitochondria. J Infect Dis 205:392– 400. http://dx.doi.org/10.1093/infdis/jir764. 10. Lowes DA, Webster NR, Murphy MP, Galley HF. 2013. Antioxidants that protect mitochondria reduce interleukin-6 and oxidative stress, improve mitochondrial function, and reduce biochemical markers of organ dysfunction in a rat model of acute sepsis. Br J Anaesth 110:472– 480. http://dx.doi.org/10.1093/bja/aes577. 11. Kang D, Lee K-M, Park SK, Berndt SI, Peters U, Reding D, Chatterjee N, Welch R, Chanock S, Huang W-Y, Hayes RB. 2007. Functional variant of manganese superoxide dismutase (SOD2 V16A) polymorphism is associated with prostate cancer risk in the Prostate, Lung, Colorectal, and Ovarian cancer study. Cancer Epidemiol Biomarkers Prev 16:1581– 1586. http://dx.doi.org/10.1158/1055-9965.EPI-07-0160. 12. Yu Z, He X, Fu D, Zhang Y. 2011. Two superoxide dismutase [sic] (SOD) with different subcellular localizations involved in innate immunity in Crassostrea hongkongensis. Fish Shellfish Immunol 31:533–539. http://dx .doi.org/10.1016/j.fsi.2011.06.022. 13. Mahe YF, Perez MJ, Tacheau C, Fanchon C, Martin R, Rousset F, Seite S. 2013. A new Vitreoscilla filiformis extract grown on spa water-enriched medium activates endogenous cutaneous antioxidant and antimicrobial defenses through a potential Toll-like receptor 2/protein kinase C, zeta transduction pathway. Clin Cosmet Investig Dermatol 6:191–196. http: //dx.doi.org/10.2147/CCID.S47324. 14. Huang Q, Liu D, Majewski P, Schulte LC, Korn JM, Young RA, Lander ES, Hacohen N. 2001. The plasticity of dendritic cell responses to pathogens and their components. Science 294:870 – 875. http://dx.doi.org/10 .1126/science.294.5543.870. 15. Campa-Córdova A. 2002. Generation of superoxide anion and SOD activity in haemocytes and muscle of American white shrimp (Litopenaeus vannamei) as a response to ␤-glucan and sulphated polysaccharide. Fish Shellfish Immunol 12:353–366. http://dx.doi.org/10.1006 /fsim.2001.0377. 16. Basagoudanavar SH, Thapa RJ, Nogusa S, Wang J, Beg AA, Balachandran S. 2011. Distinct roles for the NF-kappa B RelA subunit during antiviral innate immune responses. J Virol 85:2599 –2610. http://dx.doi .org/10.1128/JVI.02213-10. 17. Olsson J, Jacobson TA, Paulsson JM, Dadfar E, Moshfegh A, Jacobson SH, Lundahl J. 2011. Expression of neutrophil SOD2 is reduced after lipopolysaccharide stimulation: a potential cause of neutrophil dysfunction in chronic kidney disease. Nephrol Dial Transplant 26:2195–2201. http://dx.doi.org/10.1093/ndt/gfq673. 18. Case AJ, McGill JL, Tygrett LT, Shirasawa T, Spitz DR, Waldschmidt TJ, Legge KL, Domann FE. 2011. Elevated mitochondrial superoxide disrupts normal T cell development, impairing adaptive immune responses to an influenza challenge. Free Radic Biol Med 50:448 – 458. http: //dx.doi.org/10.1016/j.freeradbiomed.2010.11.025. 19. Trede NS, Langenau DM, Traver D, Look AT, Zon LI. 2004. The use of zebrafish to understand immunity. Immunity 20:367–379. http://dx.doi .org/10.1016/S1074-7613(04)00084-6. 20. Bennett CM. 2001. Myelopoiesis in the zebrafish, Danio rerio. Blood 98:643– 651. http://dx.doi.org/10.1182/blood.V98.3.643. 21. Bertrand JY, Kim AD, Violette EP, Stachura DL, Cisson JL, Traver D. 2007. Definitive hematopoiesis initiates through a committed erythromyeloid progenitor in the zebrafish embryo. Development 134:4147– 4156. http://dx.doi.org/10.1242/dev.012385. 22. Davidson AJ, Zon LI. 2004. The “definitive” (and “primitive”) guide to zebrafish hematopoiesis. Oncogene 23:7233–7246. http://dx.doi.org/10 .1038/sj.onc.1207943. 23. Henry KM, Loynes CA, Whyte MK, Renshaw SA. 2013. Zebrafish as a

Infection and Immunity

January 2015 Volume 83 Number 1

Downloaded from http://iai.asm.org/ on March 23, 2015 by UNIVERSITY OF MEMPHIS

pathways involved in the innate immune response are not only employed during pathogen infections but can also be deregulated during, and contribute to, many disease states, as well as the natural aging process. Polymorphisms in SOD2 and subsequent increases in oxidative stress have been characterized in a number of different cancers (51–55). Conversely, elevated SOD2 activity has also been implicated in cancer (11, 56). Along with cancer, SOD2 deficiencies have been implicated in a number of other diseases, such as age-related macular degeneration and diabetes (57–60). It is known that some diabetic and cancer patients are more susceptible to infection (61, 62). However, deficiencies of SOD2 in these patients cannot be directly attributed to increased susceptibility to infection because of the number of other complex mutations present in these patients. As we have shown here, it is possible that the loss of SOD2, in addition to contributing to inflammatory diseases, could also cause an increased susceptibility to infection. Our work investigating the role of SOD2 in innate immunity provides further insight into the importance of mitochondrial superoxide regulation in resistance to infection and in general health. Previous studies have shown that the lack of proper mitochondrial function can occur as a result of sepsis and that a feedforward loop of oxidative stress and mitochondrial dysfunction worsens the condition. There have been attempts to ameliorate the septic condition in animals by improving mitochondrial function with targeted antioxidants. These attempts have had some success in restoring mitochondrial and organ function, reducing inflammatory signaling, and reducing oxidative stress (10, 63–65). Current therapies for septic patients that are critically ill include supplementation with antioxidants and have proven to help reduce the mortality rate of these patients (66–68). To the best of our knowledge, we are the first to use mitochondrion-targeted antioxidants in vivo as a method for improving the innate immune response to infection. Further work is needed to examine mitochondrial oxidative stress in phagocytes and the roles that hematopoiesis, vasculogenesis, and apoptosis play in the biology of these cell types. Mitochondrial dysfunction and the subsequent increase in oxidative stress cause organ failure and death in bacteremic patients, and our work suggests that mitochondrion-targeted antioxidants may be an effective supplemental therapy for these patients.

Sod2 Function Promotes Innate Immunity In Vivo

24.

25.

26.

28.

29. 30.

31. 32. 33.

34. 35.

36.

37. 38.

39.

40. 41.

42.

January 2015 Volume 83 Number 1

43.

44. 45. 46. 47.

48.

49.

50. 51.

52.

53.

54. 55.

56.

57.

58.

59.

60.

61.

tiate adult hematopoiesis. Development 135:1853–1862. http://dx.doi.org /10.1242/dev.015297. Song H-D, Sun X-J, Deng M, Zhang G-W, Zhou Y, Wu X-Y, Sheng Y, Chen Y, Ruan Z, Jiang C-L, Fan H-Y, Zon LI, Kanki JP, Liu TX, Look AT, Chen Z. 2004. Hematopoietic gene expression profile in zebrafish kidney marrow. Proc Natl Acad Sci U S A 101:16240 –16245. http://dx.doi .org/10.1073/pnas.0407241101. Reference deleted. Galley HF. 2011. Oxidative stress and mitochondrial dysfunction in sepsis. Br J Anaesth 107:57– 64. http://dx.doi.org/10.1093/bja/aer093. Galley HF. 2010. Bench-to-bedside review: targeting antioxidants to mitochondria in sepsis. Crit Care 14:230. http://dx.doi.org/10.1186/cc9098. Miyamoto K, Araki KY, Naka K, Arai F, Takubo K, Yamazaki S, Matsuoka S, Miyamoto T, Ito K, Ohmura M, Chen C, Hosokawa K, Nakauchi H, Nakayama K, Nakayama KI, Harada M, Motoyama N, Suda T, Hirao A. 2007. Foxo3a is essential for maintenance of the hematopoietic stem cell pool. Cell 1:101–112. http://dx.doi.org/10.1016/j.stem .2007.02.001. Tothova Z, Kollipara R, Huntly BJ, Lee BH, Castrillon DH, Cullen DE, McDowell EP, Lazo-Kallanian S, Williams IR, Sears C, Armstrong SA, Passegué E, DePinho RA, Gilliland DG. 2007. FoxOs are critical mediators of hematopoietic stem cell resistance to physiologic oxidative stress. Cell 128:325–339. http://dx.doi.org/10.1016/j.cell.2007.01.003. Drane P, Bravard A, Bouvard V, May E. 2001. Reciprocal downregulation of p53 and SOD2 gene expression-implication in p53 mediated apoptosis. Oncogene 20:430 – 439. http://dx.doi.org/10.1038/sj .onc.1204101. Kim JJ, Lee SB, Park JK, Yoo YD. 2010. TNF-alpha-induced ROS production triggering apoptosis is directly linked to Romo1 and Bcl-X(L). Cell Death Differ 17:1420 –1434. http://dx.doi.org/10.1038/cdd.2010.19. Ye H, Wang A, Lee B-S, Yu T, Sheng S, Peng T, Hu S, Crowe DL, Zhou X. 2008. Proteomic based identification of manganese superoxide dismutase 2 (SOD2) as a metastasis marker for oral squamous cell carcinoma. Cancer Genomics Proteomics 5:85–94. Hung RJ, Boffetta P, Brennan P, Malaveille C, Gelatti U, Placidi D, Carta A, Hautefeuille A, Porru S. 2004. Genetic polymorphisms of MPO, COMT, MnSOD, NQO1, interactions with environmental exposures and bladder cancer risk. Carcinogenesis 25:973–978. http://dx.doi.org/10 .1093/carcin/bgh080. Wang SS, Davis S, Cerhan JR, Hartge P, Severson RK, Cozen W, Lan Q, Welch R, Chanock SJ, Rothman N. 2006. Polymorphisms in oxidative stress genes and risk for non-Hodgkin lymphoma. Carcinogenesis 27: 1828 –1834. http://dx.doi.org/10.1093/carcin/bgl013. Hurt EM, Thomas SB, Peng B, Farrar WL. 2007. Integrated molecular profiling of SOD2 expression in multiple myeloma. Blood 109:3953–3962. http://dx.doi.org/10.1182/blood-2006-07-035162. Rajaraman P, Hutchinson A, Rothman N, Black PM, Fine HA, Loeffler JS, Selker RG, Shapiro WR, Linet MS, Inskip PD. 2008. Oxidative response gene polymorphisms and risk of adult brain tumors. Neuro Oncol 10:709 –715. http://dx.doi.org/10.1215/15228517-2008-037. Ambrosone CB, Freudenheim JL, Thompson PA, Bowman E, Vena JE, Marshall JR, Graham S, Laughlin R, Nemoto T, Shields PG. 1999. Manganese superoxide dismutase (MnSOD) genetic polymorphisms, dietary antioxidants, and risk of breast cancer. Cancer Res 59:602– 606. Kanwar M, Chan P-S, Kern TS, Kowluru RA. 2007. Oxidative damage in the retinal mitochondria of diabetic mice: possible protection by superoxide dismutase. Invest Ophthalmol Vis Sci 48:3805–3811. http://dx.doi.org /10.1167/iovs.06-1280. Shen X, Zheng S, Metreveli NS, Epstein PN. 2006. Protection of cardiac mitochondria by overexpression of MnSOD reduces diabetic cardiomyopathy. Diabetes 55:798 – 805. http://dx.doi.org/10.2337/diabetes.55.03 .06.db05-1039. Marrotte EJ, Chen D, Hakim JS, Chen AF. 2010. Manganese superoxide dismutase expression in endothelial progenitor cells accelerates wound healing in diabetic mice. J Clin Invest 120:4207– 4219. http://dx.doi.org /10.1172/JCI36858. Madsen-Bouterse SA, Zhong Q, Qing Mohammad G, Ho YS, Kowluru RA. 2010. Oxidative damage of mitochondrial DNA in diabetes and its protection by manganese superoxide dismutase. Free Radic Res 44:313– 321. http://dx.doi.org/10.3109/10715760903494168. Casqueiro J, Casqueiro J, Alves C. 2012. Infections in patients with diabetes mellitus: a review of pathogenesis. Indian J Endocrinol Metab 16(Suppl 1):S27–S36. http://dx.doi.org/10.4103/2230-8210.94253.

Infection and Immunity

iai.asm.org

439

Downloaded from http://iai.asm.org/ on March 23, 2015 by UNIVERSITY OF MEMPHIS

27.

model for the study of neutrophil biology. J Leukoc Biol 94:633– 642. http: //dx.doi.org/10.1189/jlb.1112594. Lin C-T, Tseng W-C, Hsiao N-W, Chang H-H, Ken C-F. 2009. Characterization, molecular modelling and developmental expression of zebrafish manganese superoxide dismutase. Fish Shellfish Immunol 27: 318 –324. http://dx.doi.org/10.1016/j.fsi.2009.05.015. Clatworthy AE, Lee JS-W, Leibman M, Kostun Z, Davidson AJ, Hung DT. 2009. Pseudomonas aeruginosa infection of zebrafish involves both host and pathogen determinants. Infect Immun 77:1293–1303. http://dx .doi.org/10.1128/IAI.01181-08. Chao C-C, Hsu P-C, Jen C-F, Chen I-H, Wang C-H, Chan H-C, Tsai P-W, Tung K-C, Wang C-H, Lan C-Y, Chuang Y-J. 2010. Zebrafish as a model host for Candida albicans infection. Infect Immun 78:2512–2521. http://dx.doi.org/10.1128/IAI.01293-09. Prajsnar TK, Renshaw SA, Ogryzko NV, Foster SJ, Serror P, Mesnage S. 2013. Zebrafish as a novel vertebrate model to dissect enterococcal pathogenesis. Infect Immun 81:4271– 4279. http://dx.doi .org/10.1128/IAI.00976-13. Phelan PE, Pressley ME, Witten PE, Mellon MT, Blake S, Kim CH. 2005. Characterization of snakehead rhabdovirus infection in zebrafish (Danio rerio). J Virol 79:1842–1852. http://dx.doi.org/10.1128/JVI.79.3 .1842-1852.2005. Renshaw SA, Loynes CA, Trushell DM, Elworthy S, Ingham PW, Whyte MKB. 2006. A transgenic zebrafish model of neutrophilic inflammation. Blood 108:3976 –3978. http://dx.doi.org/10.1182/blood-2006-05-024075. Singer JT, Phennicie RT, Sullivan MJ, Porter LA, Shaffer VJ, Kim CH. 2010. Broad-host-range plasmids for red fluorescent protein labeling of gram-negative bacteria for use in the zebrafish model system. Appl Environ Microbiol 76:3467–3474. http://dx.doi.org/10.1128/AEM.01679-09. Hermann AC, Millard PJ, Blake SL, Kim CH. 2004. Development of a respiratory burst assay using zebrafish kidneys and embryos. J Immunol Methods 292:119 –129. http://dx.doi.org/10.1016/j.jim.2004.06.016. Goody MF, Peterman E, Sullivan C, Kim CH. 2013. Quantification of the respiratory burst response as an indicator of innate immune health in zebrafish. J Vis Exp 2013:e50667. http://dx.doi.org/10.3791/50667. Goody MF, Kelly MW, Lessard KN, Khalil A, Henry CA. 2010. Nrk2bmediated NAD⫹ production regulates cell adhesion and is required for muscle morphogenesis in vivo. Dev Biol 344:809 – 826. http://dx.doi.org /10.1016/j.ydbio.2010.05.513. Jowett T. 1999. Analysis of protein and gene expression. Methods Cell Biol 59:63– 85. Kortum AN1, Rodriguez-Nunez I, Yang J, Shim J, Runft D, O’Driscoll ML, Haire RN, Cannon JP, Turner PM, Litman RT, Kim CH, Neely MN, Litman GW, Yoder JA. 2014. Differential expression and ligand binding indicate alternative functions for zebrafish polymeric immunoglobulin receptor (pIgR) and a family of pIgR-like (PIGRL) proteins. Immunogenetics 66:267–279. http://dx.doi.org/10 .1007/s00251-014-0759-4. Yoder JA, Turner PM, Wright PD, Wittamer V, Bertrand JY, Traver D, Litman GW. 2010. Developmental and tissue-specific expression of NITRs. Immunogenetics 62:117–122. http://dx.doi.org/10.1007/s00251-009 -0416-5. Wittamer V, Bertrand JY, Gutschow PW, Traver D. 2011. Characterization of the mononuclear phagocyte system in zebrafish. Blood 117: 7126 –7135. http://dx.doi.org/10.1182/blood-2010-11-321448. Dieterich S, Bieligk U, Beulich K, Hasenfuss G, Prestle J. 2000. Gene expression of antioxidative enzymes in the human heart: increased expression of catalase in the end-stage failing heart. Circulation 101:33–39. http: //dx.doi.org/10.1161/01.CIR.101.1.33. Asikainen TM, Raivio KO, Saksela M, Kinnula VL. 1998. Expression and developmental profile of antioxidant enzymes in human lung and liver. Am J Respir Cell Mol Biol 19:942–949. http://dx.doi.org/10.1165/ajrcmb .19.6.3248. Salin ML, McCord JM. 1974. Superoxide dismutases in polymorphonuclear leukocytes. J Clin Invest 54:1005–1009. http://dx.doi.org/10.1172 /JCI107816. Thisse B, Pflumio S, Fürthauer M, Loppin B, Heyer V, Degrave A, Woehl R, Lux A, Steffan T, Charbonnier XQ, Thisse C. 2001. Expression of the zebrafish genome during embryogenesis. ZFIN The Zebrafish Model Organism Database. http://zfin.org. Bertrand JY, Kim AD, Teng S, Traver D. 2008. CD41⫹ cmyb⫹ precursors colonize the zebrafish pronephros by a novel migration route to ini-

Peterman et al.

440

iai.asm.org

68.

69.

70.

71.

72.

RZ. 2013. The effect of selenium therapy on mortality in patients with sepsis syndrome: a systematic review and meta-analysis of randomized controlled trials. Crit Care Med 41:1555–1564. http://dx.doi.org/10.1097 /CCM.0b013e31828a24c6. Gitto E, Karbownik M, Reiter RJ, Tan DX, Cuzzocrea S, Chiurazzi P, Cordaro S, Corona G, Trimarchi G, Barberi I. 2001. Effects of melatonin treatment in septic newborns. Pediatr Res 50:756 –760. http://dx.doi.org /10.1203/00006450-200112000-00021. Justilien V, Pang J-J, Renganathan K, Zhan X, Crabb JW, Kim SR, Sparrow JR, Hauswirth WW, Lewin AS. 2007. SOD2 knockdown mouse model of early AMD. Invest Ophthalmol Vis Sci 48:4407– 4420. http://dx .doi.org/10.1167/iovs.07-0432. Celotto AM, Liu Z, Vandemark AP, Palladino MJ. 2012. A novel Drosophila SOD2 mutant demonstrates a role for mitochondrial ROS in neurodevelopment and disease. Brain Behav 2:424 – 434. http://dx.doi.org/10 .1002/brb3.73. Li Y, Huang TT, Carlson EJ, Melov S, Ursell PC, Olson JL, Noble LJ, Yoshimura MP, Berger C, Chan PH, Wallace DC, Epstein CJ. 1995. Dilated cardiomyopathy and neonatal lethality in mutant mice lacking manganese superoxide dismutase. Nat Genet 11:376 –381. http://dx.doi .org/10.1038/ng1295-376. Sun J, Molitor J, Tower J. 2004. Effects of simultaneous over-expression of Cu/ZnSOD and MnSOD on Drosophila melanogaster life span. Mech Ageing Dev 125:341–349. http://dx.doi.org/10.1016/j.mad.2004.01.009.

Infection and Immunity

January 2015 Volume 83 Number 1

Downloaded from http://iai.asm.org/ on March 23, 2015 by UNIVERSITY OF MEMPHIS

62. Rolston KVI, Bodey GP. 2003. Factors responsible for increased susceptibility to infections. In Kufe DW, Pollock RE, Weichselbaum RR, Bast RC, Jr, Gansler TS, Holland JF, Frei E (ed), Cancer medicine, 6th ed. BC Decker, Hamilton, Ontario, Canada. 63. Brealey D, Karyampudi S, Jacques TS, Novelli M, Stidwill R, Taylor V, Smolenski RT, Singer M. 2004. Mitochondrial dysfunction in a longterm rodent model of sepsis and organ failure. Am J Physiol Regul Integr Comp Physiol 286:R491–R497. http://dx.doi.org/10.1152/ajpregu.00432 .2003. 64. Zang QS, Sadek H, Maass DL, Martinez B, Ma L, Kilgore JA, Williams NS, Frantz DE, Wigginton JG, Nwariaku FE, Wolf SE, Minei JP. 2012. Specific inhibition of mitochondrial oxidative stress suppresses inflammation and improves cardiac function in a rat pneumonia-related sepsis model. Am J Physiol Heart Circ Physiol 302:H1847–H1859. http://dx.doi .org/10.1152/ajpheart.00203.2011. 65. Pathak E, MacMillan-Crow LA, Mayeux PR. 2012. Role of mitochondrial oxidants in an in vitro model of sepsis-induced renal injury. J Pharmacol Exp Ther 340:192–201. http://dx.doi.org/10.1124/jpet.111.183756. 66. Huang T-S, Shyu Y-C, Chen H-Y, Lin L-M, Lo C-Y, Yuan S-S, Chen P-J. 2013. Effect of parenteral selenium supplementation in critically ill patients: a systematic review and meta-analysis. PLoS One 8:e54431. http: //dx.doi.org/10.1371/journal.pone.0054431. 67. Alhazzani W, Jacobi J, Sindi A, Hartog C, Reinhart K, Kokkoris S, Gerlach H, Andrews P, Drabek T, Manzanares W, Cook DJ, Jaeschke