Natural Cardiac Extracellular Matrix Sheet as a Biomaterial for Cardiomyocyte Transplantation K.M. Leea, H. Kima, J.G. Nemenoa, W. Yanga, J. Yoonb, S. Leea,*, and J.I. Leea,c,* a
Regenerative Medicine Laboratory, Center for Stem Cell Research, Department of Biomedical Science and Technology, Institute of Biomedical Science & Technology (IBST), Konkuk University, Seoul, Republic of Korea; bIT Design Fusion Program, Graduate School Of NID Fusion Technology, Seoul National University of Science and Technology, Seoul, Republic of Korea; and cDepartment of Veterinary Medicine, College of Veterinary Medicine, Konkuk University, Seoul, Republic of Korea
ABSTRACT Cardiovascular diseases associated with myocardial infarction are among the major causes of death worldwide due to the limited regenerative capacity of cardiac tissues. Although various approaches, such as biosynthetic biomaterials, have been developed to promote postinfarction cardiac regeneration, a number of limitations, including the immune complications caused by biodegradation of these scaffolds and insufficient cell migration, need to be overcome prior to their clinical application. Hence, the development of natural biomaterials to support myocardial regeneration is crucial. Here, we investigated the effects of a natural biomaterial, cardiac extracellular matrix (ECM) on the proliferation and maintenance of cardiomyocytes in order to assess its suitability for cardiomyocyte expansion. The ECM components not only provide mechanical support, but also induce and preserve the required phenotypic and functional characteristics of the cells. We prepared ECM sheets from decellularized cardiac sections. Cardiomyocytes were then cultured with and without these cardiac ECM sheets. We compared the proliferation rates and phenotypes, and cardiac gene and protein expression, of the cultured cardiomyocytes by automatic cell counting and the MTT assay, microscopy, and RT-PCR and western blotting, respectively. The cardiomyocytes cultured with the natural cardiac ECM sheets exhibited higher proliferation rates and cardiac gene and protein expression than those cultured without the ECM sheets. Our results demonstrate that the ECM sheets are suitable for use in cardiomyocyte transplantation and can provide a novel in vitro model for investigating cell and ECM interactions. We hypothesize that these ECM sheets can be used in the future to improve cardiac transplantation strategies.
D
ESPITE the advancements in medicine, cardiovascular diseases related to myocardial infarction continue to be among the major health problems worldwide due to the limited regenerative capacity of damaged heart tissues [1]. Therefore, the development of novel cardiac tissue repair and regeneration strategies will be the future challenge in cardiac tissue engineering [2]. Recent studies in cardiovascular tissue engineering have focused on developing biomimetic and tissue-specific biomaterials by exploring the biological and chemical components in the cardiac microenvironment [3,4]. Various types of stem cells, including fetal cardiomyocytes, embryonic stem cells, skeletal myoblasts, crude bone marrow stem cells, hematopoietic stem cells, fibroblasts, smooth muscle ª 2015 by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710
Transplantation Proceedings, 47, 751e756 (2015)
cells, and induced pluripotent stem cells, have been studied for their ability to promote myocardial repair, and they have demonstrated varying levels of success in cardiomyocyte transplantation [4,5]. Furthermore, several biomaterials, including cardiac patches, left ventricular restraints, and various injectable products, have been developed over the This study was supported by a grant of the Korean Health Technology R&D Project, Ministry of Health & Welfare (A120275). Jeong Ik Lee and Soojung Lee contributed equally to this work and should be considered co-corresponding authors. *Address correspondence to Jeong Ik Lee, DVM, DVSc, DMSc, Konkuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul 143729, Korea. E-mail: [email protected] 0041-1345/15 http://dx.doi.org/10.1016/j.transproceed.2014.12.030
751
752
LEE, KIM, NEMENO ET AL
Fig 1. Experimental design. The schematic illustration shows the process of generating natural extracellular matrix (ECM) sheets from adult rat heart. The cardiomyocytes isolated from neonatal rats were cultured with and without cardiac ECM and used for subsequent experiments.
years. The efficiency of injectable biomaterials for the delivery of stem cells, as well as their effects on myocardium regeneration after infarction, have been reviewed previously [3,4,6]. Alginate, fibrin, intestinal submucosa, and chitosan are a few of the injectable biomaterials that have been demonstrated to improve regeneration of the infarcted myocardium [3]. Although promising results have been achieved in preclinical and early phase clinical applications of biosynthetic polymers as biomaterials, further investigations are required to establish their clinical effectiveness. We speculated that cotransplantation of cardiomyocytes and “intelligent” natural biomaterials can be a novel strategy to enhance the efficiency of cardiomyocyte transplantation. One such natural biomaterial is the three-dimensional (3D) cardiac extracellular matrix (ECM), which is composed of a network of interstitial collagens that houses the rest of the matrix components. ECM components not only provide structural and mechanical support, but also induce and preserve appropriate phenotypic and functional characteristics of the cardiac cells [7]. Recently, decellularization has been used extensively for developing biological ECM scaffolds. The process involves the application of a combination of detergents and other chemicals to remove the cellular components completely, while maintaining the ECM components and the integrity of the biological scaffold [6,8,9]. In this study, we developed decellularized sheets of natural cardiac ECM to support cellular myocardial regeneration by using thin cardiac tissue sections and investigated their effects on the proliferation and phenotype maintenance of cardiomyocytes.
0.1% DTT (Bio-Rad, Hercules, Calif., United States), 1% glucose (Sigma-Aldrich, St. Louis, Mo., United States), and 0.5% trypsin (Gibco, Carlsbad, Calif., United States) in phosphate-buffered saline (PBS), Supernatants were discarded and the cells were resuspended in fresh collagenase solution for 4e6 subsequent digestions. Cells were harvested by centrifugation at 700 g for 10 minutes and resuspended in Dulbecco’s modified Eagle medium/F-12 (DMEM/ F-12; Gibco) containing 5% heat-inactivated horse serum (Gibco), 10% heat-inactivated fetal bovine serum (FBS; Gibco), and 1% antibiotic-antimycotic solution (AA; Gibco). The isolated cardiac cells were plated at a seeding density of 2 104 cells/cm2 and incubated at 37 C with 5% CO2 for culturing.
Preparation of Natural Cardiac ECM Sheets Hearts were harvested from adult SD rats (Samtako) and were washed with PBS. Subsequently, the hearts were cut into 10-mm sections using a cryomicrotome (Thermo Fisher Scientific, Waltham, Mass., United States) to generate the cardiac ECM sheets following a previously described protocol [10,11]. For sterilization, cardiomyocyte ECM sheets were spread on a Petri dish and air-dried under ultraviolet radiation at room temperature on a clean bench for 12 hours (Fig 1).
Decellularization of the Natural Cardiac ECM Sheets The ECM sheets were rinsed with PBS and incubated in prewarmed decellularization solution consisting of 0.25% Triton X-100 (SigmaAldrich) and 10 mmol/L NH4OH (Daejung Chemicals, Gyeonggi-Do, Korea) in PBS, for 1.5 hours at 37 C. Subsequently, the supernatant from the decellularization solution was discarded. The decellularized Table 1. List of the Primers Used in This Study and Their Sequences Primer
MATERIALS AND METHODS Neonatal Rat Cardiomyocyte Isolation Neonatal ventricles from 1- to 2-day-old Sprague-Dawley (SD) rats (Samtako, Osan, Korea) were dissected, minced on ice, and digested for 10 minutes with an enzyme solution in a water bath at 37 C with gentle shaking by hand. The enzyme solution consisted of 0.1% collagenase type II (Worthington Biochemical Co., N.J., United States),
Cardiac troponin-T Forward Reverse Cardiac troponin-I Forward Reverse GATA-4 Forward Reverse GAPDH Forward Reverse
Sequence
AGACTGGAGCGAAGAAGGAAG TGTTCTGCAAGTGAGCCTCGATC TGCCTCCACAACACGAGAGAGATC AAGCACCTCTACTGCAAGGTTGGG GTGCCAACTGCCAGACTACC AGCCTTGTGGGGACAGCTTC GGACCAGGTTGTCTCCTGTG ATTCGAGAGAAGGGAGGGCT
ECM SHEETS AND CARDIOMYOCYTE TRANSPLANTATION
753
Fig 2. Confirmation of decellularization. (A) Cardiac sheets generated from rat heart before (top panel) and after (bottom panel) decellularization; (B) Microscopic image of hematoxylin and eosin stained rat cardiac ECM sheets (cross section) before and after decellularization; and (C) Microscopic image of hematoxylin and eosin stained 1-layer rat cardiac ECM sheets (longitudinal section) before and after decellularization. cardiac ECM sheets were washed 3 times with PBS to completely remove all cellular debris, and incubated in a working solution containing DNase I (50 units/mL; Invitrogen, Carlsbad, Calif., United States) and RNase A (2.5 mL/mL, Invitrogen) for about 3 hours, to digest the DNA and RNA, as well as to remove the residual cellular debris. Finally, the sheets were washed 3 times with PBS.
Histological Analysis After rats were sacrificed, hearts were immediately removed, embedded in Frozen Section Compound freezing medium (Leica Microsystems, Wetzlar, Germany), and sectioned into 5-mm slices. The ECM sheet specimens were immersion-fixed in 4% paraformaldehyde for 20 minutes. The ECM sheets, decellularized and nondecellularized, were embedded either in the freezing medium or in paraffin and were subsequently examined. Hematoxylin and eosin staining was used for histological examination.
supplemented with 10% FBS, 5% horse serum, and 1% AA. The cells were counted using the ADAM automatic cell counter (Digital Bio, Seoul, Korea) after 7, 10, and 14 days in culture. Three or 4 independent experiments were conducted. To determine the cell viability, cardiomyocytes were seeded in a 12-well plate at 7.6 107 cells/well and cultured in a humidified incubator with 5% CO2 at 37 C. Cell viability was assessed using the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5diphenyl-tetrazolium bromide] assay after 3, 5, and 7 days. One hundred microliters (1/10th of the culture volume) of MTT solution (Amersham Life Science, Cleveland, Ohio, United States) was added to each well and cells were incubated for 2 hours. The culture media were removed and the cells were detached using dimethyl sulfoxide (DMSO; Sigma-Aldrich). The optical density (OD) of the cells in each well was measured at 540 nm using an ELISA microplate reader (Spectra Max 190; Molecular Devices, Calif., United States).
Cell Viability Analysis
RNA Extraction and Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
Cardiomyocytes were seeded in 60-mm dishes (SPL Life Sciences, Seoul, Korea) at a density of 4.2 105 cells/dish in DMEM/F-12
Cardiomyocyte gene expression was evaluated with RT-PCR using the primers listed in Table 1. The gene expression of cardiac troponin-T
754
LEE, KIM, NEMENO ET AL
Fig 3. Phenotype and proliferation of cardiomyocytes cultured with or without cardiac ECM sheets. Phenotype of cardiomyocytes after 5 days in culture with (A) and without (B) ECM sheets. Cell number (C) and cell survival rate (D) of cardiomyocytes cultured with and without natural cardiac ECM sheets after 7, 10, and 14 days in culture, as determined by cell counting, respectively. Data are expressed as the mean SEM. The asterisks (*) represent statistically significant differences (P < .05). (cTnT), cardiac troponin-I (cTnI), and GATA4 was assessed with the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene as an internal control. Total RNA of each cardiomyocyte was isolated using TriZOL reagent (Invitrogen) following the manufacturer’s instructions. RNA concentrations were determined at 260 nm using the NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Wilmington, Del., United States). One microgram of total RNA from each sample was used for complementary DNA (cDNA) synthesis by RT. AccuPower Taq PCR Premix (Bioneer, Daejeon, Korea) was used for amplification. Amplification reactions were performed using a GeneAmp PCR System 9700 (Applied Biosystems, Foster City, Calif., United States). Thermal cycles were as follows: denaturation at 94 C for 5 minutes, followed by 25 cycles of denaturation at 94 C for 30 seconds, annealing at 58 C for 30 seconds, and extension at 72 C for 30 seconds. Success of PCR amplification was checked by gel electrophoresis using a 1.5% agarose gel (Carl Roth GmbH, Karlsruhe, Germany).
Western Blot Analysis Cardiomyocytes isolated from SD rats were seeded at 1.0 106 cells/ dish in 100-mm dishes (SPL Life) and were cultured with or without the natural cardiac ECM sheets until 80% confluence was achieved. The cells were washed with PBS, trypsinized (Gibco), and lysed in ice-cold lysis buffer (Elpis, Daejeon, Korea) containing protease inhibitor (Sigma-Aldrich). The cells were incubated on ice for 30 minutes, with vortexing every 10 minutes. The lysates were centrifuged at 13,000 rpm and 4 C for 15 minutes, and the resulting supernatants were used for immunoblot analysis. The protein concentrations of the cell lysates were determined by a Bradford assay (Bio-Rad) and proteins were separated by 12% SDS-PAGE (Bio-Rad). The separated proteins were transferred to a nitrocellulose membrane (Pall Corporation, Port Washington, N.Y., United States). After 1 hour, the nitrocellulose membranes were blocked with 5% BSA (bioWORLD, Dublin, Oh., United States) and incubated with the primary antibodies antieasarcomeric actin (Sigma-Aldrich) and antieb-actin (Santa Cruz Biotechnology, Santa Cruz, Calif., United States). Membranes were then incubated with horseradish peroxidaseeconjugated secondary
antibodies (Abcam, Cambridge, Mass., United States). Subsequently, immune complexes were visualized with WESTSAVE-gold enhanced chemiluminescent reagent (Ab Frontier, Seoul, Korea), and detected using a LAS-3000 imaging system (Fujifilm, Tokyo, Japan).
Statistical Analysis Data are expressed as the mean standard error of the mean (SEM). Significant differences at P < .05 were determined by 1-way analysis of variance, followed by Tukey’s Multiple Comparison Test (GraphPad Prism; GraphPad Software Inc., La Jolla, Calif., United States).
RESULTS Cardiac ECM Sheets and Their Effects on the Phenotypes and Proliferation Rates of Cardiomyocytes
The natural cardiac ECM sheets were successfully generated completely free of cellular debris as well as DNA and RNA as shown in Fig 2. After 7, 10, and 14 days in culture, cardiomyocytes grown with cardiac ECM sheets demonstrated
Fig 4. Proliferation rates of cardiomyocytes with and without natural cardiac ECM sheets after 3, 5, and 7 days in culture as determined by the MTT assay. Data are expressed as the mean SEM.
ECM SHEETS AND CARDIOMYOCYTE TRANSPLANTATION
755
Fig 5. Confirmation of cardiogenic properties of the isolated cardiomyocytes. mRNA (A, B) and protein (C) expression levels of several cardiac genes in cardiomyocytes cultured with and without natural cardiac ECM sheets, as determined by RT-PCR and western blot analysis, respectively.
better maintenance of their cardiac phenotypes than cardiomyocytes grown without ECM sheets (Figs 3A and 3B). Cell number and cell survival rates after 7, 10, and 14 culture days were higher for cardiomyocytes cultured with natural cardiac ECM than for those cultured without the ECM sheets (Figs 3C and 3D). Similarly, the viability and proliferation of cardiomyocytes cultured with natural cardiac ECM sheets were higher than those of cells that were grown without natural cardiac ECM sheets, after 3, 5, and 7 culture days (Fig 4). Cardiac Gene and Protein Expression in Cardiomyocytes
We analyzed whether the presence of natural cardiac ECM affects cardiac gene expression by determining the mRNA levels of the cardiac genes cTnT, cTnI, and GATA4 by RT-PCR, with the housekeeping gene GAPDH as an internal control. The results showed that cardiomyocytes grown with natural cardiac ECM expressed higher levels of the cardiac genes after 7 and 14 days in culture, except for GATA4, which exhibited a similar expression level after 14 days in culture (Figs 5A and 5B). Immunolabeling of a-sarcomeric actin demonstrated more intense staining for cardiomyocytes cultured with cardiac ECM sheets than for cardiomyocytes grown without ECM, after 7 days in culture (Fig 5C). DISCUSSION
Since the emergence of tissue engineering in 1993 [12], various approaches have been employed to develop therapeutic strategies for regenerative medicine. In the field of cardiology, engineering biomaterials for myocardial regeneration has been one of the research challenges, as the myocardium, among other cardiovascular organs, has a particularly limited
regenerative capacity [2]. Myocardial infarction, characterized by sudden cardiac cell death following ischemia and cardiac arrest [13], is a major contributor to cardiovascular-related morbidity and mortality. Over the years, a vast number of therapies and synthetic biomaterials for cardiac tissue repair have been developed. In addition, 3D myocardial tissues have been engineered by combining stem cells with synthetic scaffolds made of polymers like poly (glycolic acid), gelatin, alginate, or collagen. However, the clinical application of these approaches has been limited by factors such as immune complications and insufficient cell migration [14]. The major risks and challenges in the application of myocardial tissue engineering have previously been reviewed [2,15]. Cell sheet engineering has been used to efficiently generate biosynthetic scaffold-free materials for myocardial repair, while reducing post-transplantation scaffold-related complications [14,16]. Moreover, 3-layer cell sheets derived from human c-kite positive cardiac cells improved cardiac function as demonstrated by their post-transplantation angiogenic and antifibrotic effects in rodent models [17]. In this study, we demonstrated that natural cardiac ECM is a candidate “intelligent” biomaterial that can improve in vitro cell expansion while maintaining the appropriate phenotypic and functional characteristics of cardiomyocytes. We compared these features in cardiomyocytes cultured with and without natural ECM sheets after different number of days in culture. Cardiac ECM sheets could be easily generated from rat heart by decellularization, and they significantly improved maintenance of the cardiac phenotype in cardiomyocytes. Moreover, the cell proliferation and viability in cardiomyocytes cultured with natural ECM sheets were higher than that in cells cultured without the ECM sheets. The gene and protein expression of some cardiac genes was also higher in the former group than in the latter.
756
These results are consistent with our earlier findings that autologous ECM can be utilized as a bioscaffold for the expansion of chondrocytes [10]. We believe that these natural ECM sheets can be used in future to improve strategies for cardiomyocyte transplantation. CONCLUSIONS
We showed that cardiac ECM sheets manufactured from thin, decellularized, cardiac sections effectively preserve or even improve phenotypic characteristics and cell proliferation and viability rates of cardiomyocytes. Our findings suggest that cardiomyocyte ECM sheets can be a novel in vitro model for investigating cardiac cell and ECM interactions. However, further research on cotransplantation of cardiac cells and ECM is required to improve cell transplantation strategies. REFERENCES [1] Braunwald E, Bristow MR. Congestive heart failure: fifty years of progress. Circulation 2000;102:IV14e23. [2] Jawad H, Lyon AR, Harding SE, Ali NN, Boccaccini AR. Myocardial tissue engineering. Br Med Bull 2008;87:31e47. [3] Rane AA, Christman KL. Biomaterials for the treatment of myocardial infarction: a 5-year update. J Am Coll Cardiol 2011;58: 2615e29. [4] Leor J, Amsalem Y, Cohen S. Cells, scaffolds, and molecules for myocardial tissue engineering. Pharmacol Ther 2005;105:151e63. [5] Galvez-Monton C, Prat-Vidal C, Roura S, Soler-Botija C, Bayes-Genis A. Update: Innovation in cardiology (IV). Cardiac tissue engineering and the bioartificial heart. Rev Esp Cardiol (Engl Ed) 2013;66:391e9.
LEE, KIM, NEMENO ET AL [6] Christman KL, Lee RJ. Biomaterials for the treatment of myocardial infarction. J Am Coll Cardiol 2006;48:907e13. [7] Brown BN, Badylak SF. Extracellular matrix as an inductive scaffold for functional tissue reconstruction. Transl Res 2014;163: 268e85. [8] Lutolf MP, Hubbell JA. Synthetic biomaterials as instructive extracellular microenvironments for morphogenesis in tissue engineering. Nat Biotechnol 2005;23:47e55. [9] Crapo PM, Gilbert TW, Badylak SF. An overview of tissue and whole organ decellularization processes. Biomaterials 2011;32: 3233e43. [10] Yang W, Lee S, Jo YH, Lee KM, Nemeno JG, Nam BM, et al. Effects of natural cartilaginous extracellular matrix on chondrogenic potential for cartilage cell transplantation. Transplant Proc 2014;46:1247e50. [11] Takezawa T, Takenouchi T, Imai K, Takahashi T, Hashizume K. Cell culture on thin tissue sections commonly prepared for histopathology. FASEB J 2002;16:1847e9. [12] Vacanti JP, Langer R. Tissue engineering: the design and fabrication of living replacement devices for surgical reconstruction and transplantation. Lancet 1999;354(Suppl 1):SI32e4. [13] Thygesen K, Alpert JS, White HD. Universal definition of myocardial infarction. J Am Coll Cardiol 2007;50:2173e95. [14] Shimizu T, Yamato M, Kikuchi A, Okano T. Cell sheet engineering for myocardial tissue reconstruction. Biomaterials 2003;24:2309e16. [15] Alshammary S, Fukushima S, Miyagawa S, Matsuda T, Nishi H, Saito A, et al. Impact of cardiac stem cell sheet transplantation on myocardial infarction. Surg Today 2013;43:970e6. [16] Yang J, Yamato M, Kohno C, Nishimoto A, Sekine H, Fukai F, et al. Cell sheet engineering: recreating tissues without biodegradable scaffolds. Biomaterials 2005;26:6415e22. [17] Ellison GM, Vicinanza C, Smith AJ, Aquila I, Leone A, Waring CD, et al. Adult c-kit(pos) cardiac stem cells are necessary and sufficient for functional cardiac regeneration and repair. Cell 2013;154:827e42.
Regenerative Medicine Laboratory, Center for Stem Cell Research, Department of Biomedical Science and Technology, Institute of Biomedical Science & Technology (IBST), Konkuk University, Seoul, Republic of Korea; bIT Design Fusion Program, Graduate School Of NID Fusion Technology, Seoul National University of Science and Technology, Seoul, Republic of Korea; and cDepartment of Veterinary Medicine, College of Veterinary Medicine, Konkuk University, Seoul, Republic of Korea
ABSTRACT Cardiovascular diseases associated with myocardial infarction are among the major causes of death worldwide due to the limited regenerative capacity of cardiac tissues. Although various approaches, such as biosynthetic biomaterials, have been developed to promote postinfarction cardiac regeneration, a number of limitations, including the immune complications caused by biodegradation of these scaffolds and insufficient cell migration, need to be overcome prior to their clinical application. Hence, the development of natural biomaterials to support myocardial regeneration is crucial. Here, we investigated the effects of a natural biomaterial, cardiac extracellular matrix (ECM) on the proliferation and maintenance of cardiomyocytes in order to assess its suitability for cardiomyocyte expansion. The ECM components not only provide mechanical support, but also induce and preserve the required phenotypic and functional characteristics of the cells. We prepared ECM sheets from decellularized cardiac sections. Cardiomyocytes were then cultured with and without these cardiac ECM sheets. We compared the proliferation rates and phenotypes, and cardiac gene and protein expression, of the cultured cardiomyocytes by automatic cell counting and the MTT assay, microscopy, and RT-PCR and western blotting, respectively. The cardiomyocytes cultured with the natural cardiac ECM sheets exhibited higher proliferation rates and cardiac gene and protein expression than those cultured without the ECM sheets. Our results demonstrate that the ECM sheets are suitable for use in cardiomyocyte transplantation and can provide a novel in vitro model for investigating cell and ECM interactions. We hypothesize that these ECM sheets can be used in the future to improve cardiac transplantation strategies.
D
ESPITE the advancements in medicine, cardiovascular diseases related to myocardial infarction continue to be among the major health problems worldwide due to the limited regenerative capacity of damaged heart tissues [1]. Therefore, the development of novel cardiac tissue repair and regeneration strategies will be the future challenge in cardiac tissue engineering [2]. Recent studies in cardiovascular tissue engineering have focused on developing biomimetic and tissue-specific biomaterials by exploring the biological and chemical components in the cardiac microenvironment [3,4]. Various types of stem cells, including fetal cardiomyocytes, embryonic stem cells, skeletal myoblasts, crude bone marrow stem cells, hematopoietic stem cells, fibroblasts, smooth muscle ª 2015 by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710
Transplantation Proceedings, 47, 751e756 (2015)
cells, and induced pluripotent stem cells, have been studied for their ability to promote myocardial repair, and they have demonstrated varying levels of success in cardiomyocyte transplantation [4,5]. Furthermore, several biomaterials, including cardiac patches, left ventricular restraints, and various injectable products, have been developed over the This study was supported by a grant of the Korean Health Technology R&D Project, Ministry of Health & Welfare (A120275). Jeong Ik Lee and Soojung Lee contributed equally to this work and should be considered co-corresponding authors. *Address correspondence to Jeong Ik Lee, DVM, DVSc, DMSc, Konkuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul 143729, Korea. E-mail: [email protected] 0041-1345/15 http://dx.doi.org/10.1016/j.transproceed.2014.12.030
751
752
LEE, KIM, NEMENO ET AL
Fig 1. Experimental design. The schematic illustration shows the process of generating natural extracellular matrix (ECM) sheets from adult rat heart. The cardiomyocytes isolated from neonatal rats were cultured with and without cardiac ECM and used for subsequent experiments.
years. The efficiency of injectable biomaterials for the delivery of stem cells, as well as their effects on myocardium regeneration after infarction, have been reviewed previously [3,4,6]. Alginate, fibrin, intestinal submucosa, and chitosan are a few of the injectable biomaterials that have been demonstrated to improve regeneration of the infarcted myocardium [3]. Although promising results have been achieved in preclinical and early phase clinical applications of biosynthetic polymers as biomaterials, further investigations are required to establish their clinical effectiveness. We speculated that cotransplantation of cardiomyocytes and “intelligent” natural biomaterials can be a novel strategy to enhance the efficiency of cardiomyocyte transplantation. One such natural biomaterial is the three-dimensional (3D) cardiac extracellular matrix (ECM), which is composed of a network of interstitial collagens that houses the rest of the matrix components. ECM components not only provide structural and mechanical support, but also induce and preserve appropriate phenotypic and functional characteristics of the cardiac cells [7]. Recently, decellularization has been used extensively for developing biological ECM scaffolds. The process involves the application of a combination of detergents and other chemicals to remove the cellular components completely, while maintaining the ECM components and the integrity of the biological scaffold [6,8,9]. In this study, we developed decellularized sheets of natural cardiac ECM to support cellular myocardial regeneration by using thin cardiac tissue sections and investigated their effects on the proliferation and phenotype maintenance of cardiomyocytes.
0.1% DTT (Bio-Rad, Hercules, Calif., United States), 1% glucose (Sigma-Aldrich, St. Louis, Mo., United States), and 0.5% trypsin (Gibco, Carlsbad, Calif., United States) in phosphate-buffered saline (PBS), Supernatants were discarded and the cells were resuspended in fresh collagenase solution for 4e6 subsequent digestions. Cells were harvested by centrifugation at 700 g for 10 minutes and resuspended in Dulbecco’s modified Eagle medium/F-12 (DMEM/ F-12; Gibco) containing 5% heat-inactivated horse serum (Gibco), 10% heat-inactivated fetal bovine serum (FBS; Gibco), and 1% antibiotic-antimycotic solution (AA; Gibco). The isolated cardiac cells were plated at a seeding density of 2 104 cells/cm2 and incubated at 37 C with 5% CO2 for culturing.
Preparation of Natural Cardiac ECM Sheets Hearts were harvested from adult SD rats (Samtako) and were washed with PBS. Subsequently, the hearts were cut into 10-mm sections using a cryomicrotome (Thermo Fisher Scientific, Waltham, Mass., United States) to generate the cardiac ECM sheets following a previously described protocol [10,11]. For sterilization, cardiomyocyte ECM sheets were spread on a Petri dish and air-dried under ultraviolet radiation at room temperature on a clean bench for 12 hours (Fig 1).
Decellularization of the Natural Cardiac ECM Sheets The ECM sheets were rinsed with PBS and incubated in prewarmed decellularization solution consisting of 0.25% Triton X-100 (SigmaAldrich) and 10 mmol/L NH4OH (Daejung Chemicals, Gyeonggi-Do, Korea) in PBS, for 1.5 hours at 37 C. Subsequently, the supernatant from the decellularization solution was discarded. The decellularized Table 1. List of the Primers Used in This Study and Their Sequences Primer
MATERIALS AND METHODS Neonatal Rat Cardiomyocyte Isolation Neonatal ventricles from 1- to 2-day-old Sprague-Dawley (SD) rats (Samtako, Osan, Korea) were dissected, minced on ice, and digested for 10 minutes with an enzyme solution in a water bath at 37 C with gentle shaking by hand. The enzyme solution consisted of 0.1% collagenase type II (Worthington Biochemical Co., N.J., United States),
Cardiac troponin-T Forward Reverse Cardiac troponin-I Forward Reverse GATA-4 Forward Reverse GAPDH Forward Reverse
Sequence
AGACTGGAGCGAAGAAGGAAG TGTTCTGCAAGTGAGCCTCGATC TGCCTCCACAACACGAGAGAGATC AAGCACCTCTACTGCAAGGTTGGG GTGCCAACTGCCAGACTACC AGCCTTGTGGGGACAGCTTC GGACCAGGTTGTCTCCTGTG ATTCGAGAGAAGGGAGGGCT
ECM SHEETS AND CARDIOMYOCYTE TRANSPLANTATION
753
Fig 2. Confirmation of decellularization. (A) Cardiac sheets generated from rat heart before (top panel) and after (bottom panel) decellularization; (B) Microscopic image of hematoxylin and eosin stained rat cardiac ECM sheets (cross section) before and after decellularization; and (C) Microscopic image of hematoxylin and eosin stained 1-layer rat cardiac ECM sheets (longitudinal section) before and after decellularization. cardiac ECM sheets were washed 3 times with PBS to completely remove all cellular debris, and incubated in a working solution containing DNase I (50 units/mL; Invitrogen, Carlsbad, Calif., United States) and RNase A (2.5 mL/mL, Invitrogen) for about 3 hours, to digest the DNA and RNA, as well as to remove the residual cellular debris. Finally, the sheets were washed 3 times with PBS.
Histological Analysis After rats were sacrificed, hearts were immediately removed, embedded in Frozen Section Compound freezing medium (Leica Microsystems, Wetzlar, Germany), and sectioned into 5-mm slices. The ECM sheet specimens were immersion-fixed in 4% paraformaldehyde for 20 minutes. The ECM sheets, decellularized and nondecellularized, were embedded either in the freezing medium or in paraffin and were subsequently examined. Hematoxylin and eosin staining was used for histological examination.
supplemented with 10% FBS, 5% horse serum, and 1% AA. The cells were counted using the ADAM automatic cell counter (Digital Bio, Seoul, Korea) after 7, 10, and 14 days in culture. Three or 4 independent experiments were conducted. To determine the cell viability, cardiomyocytes were seeded in a 12-well plate at 7.6 107 cells/well and cultured in a humidified incubator with 5% CO2 at 37 C. Cell viability was assessed using the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5diphenyl-tetrazolium bromide] assay after 3, 5, and 7 days. One hundred microliters (1/10th of the culture volume) of MTT solution (Amersham Life Science, Cleveland, Ohio, United States) was added to each well and cells were incubated for 2 hours. The culture media were removed and the cells were detached using dimethyl sulfoxide (DMSO; Sigma-Aldrich). The optical density (OD) of the cells in each well was measured at 540 nm using an ELISA microplate reader (Spectra Max 190; Molecular Devices, Calif., United States).
Cell Viability Analysis
RNA Extraction and Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
Cardiomyocytes were seeded in 60-mm dishes (SPL Life Sciences, Seoul, Korea) at a density of 4.2 105 cells/dish in DMEM/F-12
Cardiomyocyte gene expression was evaluated with RT-PCR using the primers listed in Table 1. The gene expression of cardiac troponin-T
754
LEE, KIM, NEMENO ET AL
Fig 3. Phenotype and proliferation of cardiomyocytes cultured with or without cardiac ECM sheets. Phenotype of cardiomyocytes after 5 days in culture with (A) and without (B) ECM sheets. Cell number (C) and cell survival rate (D) of cardiomyocytes cultured with and without natural cardiac ECM sheets after 7, 10, and 14 days in culture, as determined by cell counting, respectively. Data are expressed as the mean SEM. The asterisks (*) represent statistically significant differences (P < .05). (cTnT), cardiac troponin-I (cTnI), and GATA4 was assessed with the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene as an internal control. Total RNA of each cardiomyocyte was isolated using TriZOL reagent (Invitrogen) following the manufacturer’s instructions. RNA concentrations were determined at 260 nm using the NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Wilmington, Del., United States). One microgram of total RNA from each sample was used for complementary DNA (cDNA) synthesis by RT. AccuPower Taq PCR Premix (Bioneer, Daejeon, Korea) was used for amplification. Amplification reactions were performed using a GeneAmp PCR System 9700 (Applied Biosystems, Foster City, Calif., United States). Thermal cycles were as follows: denaturation at 94 C for 5 minutes, followed by 25 cycles of denaturation at 94 C for 30 seconds, annealing at 58 C for 30 seconds, and extension at 72 C for 30 seconds. Success of PCR amplification was checked by gel electrophoresis using a 1.5% agarose gel (Carl Roth GmbH, Karlsruhe, Germany).
Western Blot Analysis Cardiomyocytes isolated from SD rats were seeded at 1.0 106 cells/ dish in 100-mm dishes (SPL Life) and were cultured with or without the natural cardiac ECM sheets until 80% confluence was achieved. The cells were washed with PBS, trypsinized (Gibco), and lysed in ice-cold lysis buffer (Elpis, Daejeon, Korea) containing protease inhibitor (Sigma-Aldrich). The cells were incubated on ice for 30 minutes, with vortexing every 10 minutes. The lysates were centrifuged at 13,000 rpm and 4 C for 15 minutes, and the resulting supernatants were used for immunoblot analysis. The protein concentrations of the cell lysates were determined by a Bradford assay (Bio-Rad) and proteins were separated by 12% SDS-PAGE (Bio-Rad). The separated proteins were transferred to a nitrocellulose membrane (Pall Corporation, Port Washington, N.Y., United States). After 1 hour, the nitrocellulose membranes were blocked with 5% BSA (bioWORLD, Dublin, Oh., United States) and incubated with the primary antibodies antieasarcomeric actin (Sigma-Aldrich) and antieb-actin (Santa Cruz Biotechnology, Santa Cruz, Calif., United States). Membranes were then incubated with horseradish peroxidaseeconjugated secondary
antibodies (Abcam, Cambridge, Mass., United States). Subsequently, immune complexes were visualized with WESTSAVE-gold enhanced chemiluminescent reagent (Ab Frontier, Seoul, Korea), and detected using a LAS-3000 imaging system (Fujifilm, Tokyo, Japan).
Statistical Analysis Data are expressed as the mean standard error of the mean (SEM). Significant differences at P < .05 were determined by 1-way analysis of variance, followed by Tukey’s Multiple Comparison Test (GraphPad Prism; GraphPad Software Inc., La Jolla, Calif., United States).
RESULTS Cardiac ECM Sheets and Their Effects on the Phenotypes and Proliferation Rates of Cardiomyocytes
The natural cardiac ECM sheets were successfully generated completely free of cellular debris as well as DNA and RNA as shown in Fig 2. After 7, 10, and 14 days in culture, cardiomyocytes grown with cardiac ECM sheets demonstrated
Fig 4. Proliferation rates of cardiomyocytes with and without natural cardiac ECM sheets after 3, 5, and 7 days in culture as determined by the MTT assay. Data are expressed as the mean SEM.
ECM SHEETS AND CARDIOMYOCYTE TRANSPLANTATION
755
Fig 5. Confirmation of cardiogenic properties of the isolated cardiomyocytes. mRNA (A, B) and protein (C) expression levels of several cardiac genes in cardiomyocytes cultured with and without natural cardiac ECM sheets, as determined by RT-PCR and western blot analysis, respectively.
better maintenance of their cardiac phenotypes than cardiomyocytes grown without ECM sheets (Figs 3A and 3B). Cell number and cell survival rates after 7, 10, and 14 culture days were higher for cardiomyocytes cultured with natural cardiac ECM than for those cultured without the ECM sheets (Figs 3C and 3D). Similarly, the viability and proliferation of cardiomyocytes cultured with natural cardiac ECM sheets were higher than those of cells that were grown without natural cardiac ECM sheets, after 3, 5, and 7 culture days (Fig 4). Cardiac Gene and Protein Expression in Cardiomyocytes
We analyzed whether the presence of natural cardiac ECM affects cardiac gene expression by determining the mRNA levels of the cardiac genes cTnT, cTnI, and GATA4 by RT-PCR, with the housekeeping gene GAPDH as an internal control. The results showed that cardiomyocytes grown with natural cardiac ECM expressed higher levels of the cardiac genes after 7 and 14 days in culture, except for GATA4, which exhibited a similar expression level after 14 days in culture (Figs 5A and 5B). Immunolabeling of a-sarcomeric actin demonstrated more intense staining for cardiomyocytes cultured with cardiac ECM sheets than for cardiomyocytes grown without ECM, after 7 days in culture (Fig 5C). DISCUSSION
Since the emergence of tissue engineering in 1993 [12], various approaches have been employed to develop therapeutic strategies for regenerative medicine. In the field of cardiology, engineering biomaterials for myocardial regeneration has been one of the research challenges, as the myocardium, among other cardiovascular organs, has a particularly limited
regenerative capacity [2]. Myocardial infarction, characterized by sudden cardiac cell death following ischemia and cardiac arrest [13], is a major contributor to cardiovascular-related morbidity and mortality. Over the years, a vast number of therapies and synthetic biomaterials for cardiac tissue repair have been developed. In addition, 3D myocardial tissues have been engineered by combining stem cells with synthetic scaffolds made of polymers like poly (glycolic acid), gelatin, alginate, or collagen. However, the clinical application of these approaches has been limited by factors such as immune complications and insufficient cell migration [14]. The major risks and challenges in the application of myocardial tissue engineering have previously been reviewed [2,15]. Cell sheet engineering has been used to efficiently generate biosynthetic scaffold-free materials for myocardial repair, while reducing post-transplantation scaffold-related complications [14,16]. Moreover, 3-layer cell sheets derived from human c-kite positive cardiac cells improved cardiac function as demonstrated by their post-transplantation angiogenic and antifibrotic effects in rodent models [17]. In this study, we demonstrated that natural cardiac ECM is a candidate “intelligent” biomaterial that can improve in vitro cell expansion while maintaining the appropriate phenotypic and functional characteristics of cardiomyocytes. We compared these features in cardiomyocytes cultured with and without natural ECM sheets after different number of days in culture. Cardiac ECM sheets could be easily generated from rat heart by decellularization, and they significantly improved maintenance of the cardiac phenotype in cardiomyocytes. Moreover, the cell proliferation and viability in cardiomyocytes cultured with natural ECM sheets were higher than that in cells cultured without the ECM sheets. The gene and protein expression of some cardiac genes was also higher in the former group than in the latter.
756
These results are consistent with our earlier findings that autologous ECM can be utilized as a bioscaffold for the expansion of chondrocytes [10]. We believe that these natural ECM sheets can be used in future to improve strategies for cardiomyocyte transplantation. CONCLUSIONS
We showed that cardiac ECM sheets manufactured from thin, decellularized, cardiac sections effectively preserve or even improve phenotypic characteristics and cell proliferation and viability rates of cardiomyocytes. Our findings suggest that cardiomyocyte ECM sheets can be a novel in vitro model for investigating cardiac cell and ECM interactions. However, further research on cotransplantation of cardiac cells and ECM is required to improve cell transplantation strategies. REFERENCES [1] Braunwald E, Bristow MR. Congestive heart failure: fifty years of progress. Circulation 2000;102:IV14e23. [2] Jawad H, Lyon AR, Harding SE, Ali NN, Boccaccini AR. Myocardial tissue engineering. Br Med Bull 2008;87:31e47. [3] Rane AA, Christman KL. Biomaterials for the treatment of myocardial infarction: a 5-year update. J Am Coll Cardiol 2011;58: 2615e29. [4] Leor J, Amsalem Y, Cohen S. Cells, scaffolds, and molecules for myocardial tissue engineering. Pharmacol Ther 2005;105:151e63. [5] Galvez-Monton C, Prat-Vidal C, Roura S, Soler-Botija C, Bayes-Genis A. Update: Innovation in cardiology (IV). Cardiac tissue engineering and the bioartificial heart. Rev Esp Cardiol (Engl Ed) 2013;66:391e9.
LEE, KIM, NEMENO ET AL [6] Christman KL, Lee RJ. Biomaterials for the treatment of myocardial infarction. J Am Coll Cardiol 2006;48:907e13. [7] Brown BN, Badylak SF. Extracellular matrix as an inductive scaffold for functional tissue reconstruction. Transl Res 2014;163: 268e85. [8] Lutolf MP, Hubbell JA. Synthetic biomaterials as instructive extracellular microenvironments for morphogenesis in tissue engineering. Nat Biotechnol 2005;23:47e55. [9] Crapo PM, Gilbert TW, Badylak SF. An overview of tissue and whole organ decellularization processes. Biomaterials 2011;32: 3233e43. [10] Yang W, Lee S, Jo YH, Lee KM, Nemeno JG, Nam BM, et al. Effects of natural cartilaginous extracellular matrix on chondrogenic potential for cartilage cell transplantation. Transplant Proc 2014;46:1247e50. [11] Takezawa T, Takenouchi T, Imai K, Takahashi T, Hashizume K. Cell culture on thin tissue sections commonly prepared for histopathology. FASEB J 2002;16:1847e9. [12] Vacanti JP, Langer R. Tissue engineering: the design and fabrication of living replacement devices for surgical reconstruction and transplantation. Lancet 1999;354(Suppl 1):SI32e4. [13] Thygesen K, Alpert JS, White HD. Universal definition of myocardial infarction. J Am Coll Cardiol 2007;50:2173e95. [14] Shimizu T, Yamato M, Kikuchi A, Okano T. Cell sheet engineering for myocardial tissue reconstruction. Biomaterials 2003;24:2309e16. [15] Alshammary S, Fukushima S, Miyagawa S, Matsuda T, Nishi H, Saito A, et al. Impact of cardiac stem cell sheet transplantation on myocardial infarction. Surg Today 2013;43:970e6. [16] Yang J, Yamato M, Kohno C, Nishimoto A, Sekine H, Fukai F, et al. Cell sheet engineering: recreating tissues without biodegradable scaffolds. Biomaterials 2005;26:6415e22. [17] Ellison GM, Vicinanza C, Smith AJ, Aquila I, Leone A, Waring CD, et al. Adult c-kit(pos) cardiac stem cells are necessary and sufficient for functional cardiac regeneration and repair. Cell 2013;154:827e42.
