Histopathology 2015, 66, 781–790. DOI: 10.1111/his.12519
Myofibroblasts from salivary gland adenoid cystic carcinomas promote cancer invasion by expressing MMP2 and CXCL12 Haijie Guan, Jie Tan, Fuyin Zhang,1 Lu Gao, Liang Bai,2 Dongyuan Qi,2 Hui Dong,2 Lei Zhu, Xiaojie Li & Tingjiao Liu Section of Oral Pathology, College of Stomatology, 1Department of Oral Surgery, The Second Affiliated Hospital, and 2 Department of Oral Surgery, The First Affiliated Hospital, Dalian Medical University, Dalian, China Date of submission 1 April 2014 Accepted for publication 28 July 2014 Published online Article Accepted 7 August 2014
Guan H, Tan J, Zhang F, Gao L, Bai L, Qi D, Dong H, Zhu L, Li X & Liu T (2015) Histopathology 66, 781–790. DOI: 10.1111/his.12519
Myofibroblasts from salivary gland adenoid cystic carcinomas promote cancer invasion by expressing MMP2 and CXCL12 Objectives: Salivary gland adenoid cystic carcinoma (ACC) is one of the most common malignant tumours in the oral and maxillofacial region, and has high aggressive potential. Tumour and stroma interactions are critical in determining the biological characteristics of malignancy. The aim of this study was to investigate the presence of myofibroblasts and their roles in the invasive characteristics of ACC. Methods and results: Immunohistochemistry was used to detect the expression of vimentin (VIM), a-smooth muscle actin (a-SMA), matrix metalloproteinase 2 (MMP2) and CD34 in ACCs and normal salivary gland controls. A significant difference in a-SMA expression was found between normal
controls and ACCs, suggesting the presence of myofibroblasts in ACCs. Immunohistochemical staining also demonstrated higher MMP2 expression in the stroma of ACCs than in the controls (P < 0.001). Primary culture of myofibroblasts from one ACC showed great invasive activity, with high expression of MMP2 and C-X-C motif chemokine 12 (CXCL12) by reverse transcription polymerase chain reaction (RT-PCR) analysis. Conclusions: This study demonstrated the presence of myofibroblasts in ACC. Myofibroblasts might be related to the aggressive growth behaviour of ACC, owing to their high levels of expression of MMP2 and CXCL12.
Keywords: adenoid cystic carcinoma, CXCL12, invasion, MMP2, myofibroblasts
Introduction Adenoid cystic carcinoma (ACC) is among the most common carcinomas of salivary glands, but may also arise in a wide range of other locations, including the sinonasal tract, tracheobronchial tree, breast, vulva, and skin.1 ACC consists of two main cell types: ductal and modified myoepithelial cells. These two types of cell show three basic growth patterns: cribriform, Address for correspondence: T Liu, Building of College of Stomatology, West Section No. 9, South Road of Lvshun, Dalian 116044, China. e-mail: [email protected] © 2014 John Wiley & Sons Ltd.
tubular, and solid. The stroma within the tumour is generally hyalinized.2,3 Although it is typically slowgrowing, ACC usually grows very aggressively; the tumour may invade bone tissue extensively before there is obvious osseous destruction.2 The current effective treatment modalities for ACC in the head and neck include surgery and radiotherapy.4 The identification of molecular abnormalities underlying ACC is extremely important for the development of specific targeted therapies. Recent studies have shown that the t(6;9)(q22–23; p23–24) chromosomal translocation in ACC results in fusions of MYB exon 14 to the last coding exon(s) of NFIB.5–7 Significant efforts
782
H Guan et al.
are needed to improve our knowledge of the molecular genetic events in this malignancy, in order to provide new therapeutic targets. Genetic and cell biological studies indicate that tumour growth is determined not only by malignant cancer cells themselves, but also by the tumour stroma.8 Fibroblasts are an important component of the tumour stroma. They not only deposit extracellular matrix (ECM), but also secrete ECM-degrading proteases such as matrix metalloproteinases (MMPs).8 Thus, fibroblasts play a crucial role in maintaining ECM homeostasis by regulating ECM turnover. Studies on human carcinomas have identified ‘activated’ fibroblasts within tumour stroma, similar to the fibroblasts associated with wound healing.9 These modified fibroblasts are commonly identified by their expression of a-smooth muscle actin (a-SMA).8,10 Thus, they are often termed myofibroblasts, carcinoma-associated fibroblasts, or tumour-associated fibroblasts. Local fibroblasts, or fibroblast precursors, have generally been considered to be the major sources of myofibroblasts.11 However, recent studies have suggested additional cellular sources of myofibroblasts, such as endothelial cells, malignant epithelial cells undergoing epithelial–mesenchymal transition, or mesenchymal stem cells.12 Myofibroblasts produce a variety of autocrine and paracrine factors that affect tumour growth and metastasis.8,13–16 MMP2 derived from myofibroblasts enhances cancer cell invasion.17 The release of VEGF, FGF and CTGF by myofibroblasts stimulates angiogenesis.18 Recently, myofibroblast-derived chemokines, such as C-X-C motif chemokine 12 (CXCL12) and CXCL14, were found to recruit bone marrow-derived cells or immune cells into the growing tumour.15,19 Overall, myofibroblasts create a tumour-permissive microenvironment and contribute to the metastasis phenotype of cancer cells. With accumulating evidence for their cancer-promoting effects, myofibroblasts might serve as novel therapeutic targets in cancer.12 Myofibroblasts seem to promote cancer progression in an organ-specific manner. In breast cancer, myofibroblasts promote cancer cell growth, angiogenesis and invasion by producing CXCL12, MMP9, and MMP14;15,20 and in prostate cancer promote cancer cell growth and invasion by producing CXCL12, CXCL14, MMP2, and MMP3.19,21 Squamous cell carcinoma of the head and neck (HNSCC) is a relatively common human cancer characterized by high morbidity and mortality.22 It has been reported that growth factors secreted by myofibroblasts from HNSCC and oesophageal SCC promote
cancer invasion.22 Another study reported that fibroblast-derived MMP2 and MT1-MMP in HNSCC promote tumour growth and invasion.23 To develop effective stroma-targeted therapeutic strategies, it is necessary to determine the specific molecules secreted by myofibroblasts from different cancers. The aim of this study was to investigate the presence of myofibroblasts in ACC and the roles of these cells in the invasive characteristics of this tumour.
Materials and methods All studies involving human materials were approved by the Research Ethics Committee, Dalian Medical University, China.
PATIENTS AND TISSUE SAMPLES
The study included a total of 18 cases of ACC diagnosed at the First Affiliated Hospital of Dalian Medical University. The patients had received no chemotherapy or radiotherapy before surgical resection. They included 11 men and seven women; their ages ranged from 36 to 80 years. Nine cases arose in the parotid glands, four in the submandibular glands, two in the sublingual glands, and three cases in minor salivary glands. Diagnosis and histopathological classification were based on the World Health Organization classification of tumours. Pathology and genetics of head and neck tumours, using histological sections stained with haematoxylin and eosin.2 Eleven cases showed a cribriform growth pattern, two a tubular pattern, and five a solid pattern. Eighteen cases of normal salivary gland were used as controls.
IMMUNOHISTOCHEMICAL STAINING
The clones, dilutions and sources of primary antibodies used in our study are listed in Table 1. Immunohistochemical staining was performed using the streptavidin–biotin complex technique. Endogenous biotin was blocked using the IHC Biotin Block Kit (Maixin-Bio, Fuzhou, China), endogenous peroxidase activity using 3% hydrogen peroxide in methanol, and non-specific binding using 10% normal goat serum. The sections were incubated with the respective primary antibodies overnight at 4°C. After washing with phosphate-buffered saline (PBS), they were incubated with horseradish peroxidase-conjugated secondary antibodies (Invitrogen, Carlsbad, CA, USA). © 2014 John Wiley & Sons Ltd, Histopathology, 66, 781–790.
Myofibroblasts promote cancer invasion by expressing MMP2
Table 1. Clones, dilutions and sources of primary antibodies Antibody
Clone
Dilution
Source
VIM
V9
1:200
Invitrogen
a-SMA
1A4
1:100
Zeta Corporation
MMP2
CA-4001
1:50
Lab Vision Corporation
CD34
QBEnd-10
1:100
Dako
783
microvessels, tumour cells and other connective tissue elements was considered to be a single, countable microvessel. A vessel lumen was not required for identification of a microvessel. MYOFIBROBLAST ISOLATION AND CHARACTERIZATION
The antigen-bound peroxidase activity was visualized by staining the sections with diaminobenzidine chromogen. The sections were then counterstained with haematoxylin. Negative control experiments were carried out by replacing the primary antibodies with PBS. EVALUATION OF STAINING
The expression levels of vimentin (VIM), a-SMA and MMP2 in the stroma of ACCs and normal controls were evaluated in 10 random high-power fields (9400), each field measuring 0.24 mm2. As the main purpose of this study was to investigate the expression of target proteins in stroma, the parenchyma was filled white using image software. The integrated optical density (IOD) and the area of target distribution were measured with IMAGE-PRO PLUS 6.0 (Media Cybernetics, Inc., Silver Spring, MD, USA). We calculated the mean density of each field, and took the average of the mean density of 10 fields as the mean density of each case. Microvessel density (MVD) was evaluated by counting CD34-labelled neovessels in the endothelium. Hot spots (intense neovascularization) were assessed in tumour areas showing the highest density of CD34 staining. For vessel counting, a high-power field (9400) in each of the 10 most vascular areas was used. A CD34-positive endothelial cell or endothelial cell cluster that was clearly separate from adjacent
Myofibroblasts were isolated from a 65-year-old female patient with sublingual gland ACC as described previously.24 We used myofibroblasts passaged for three population doublings for initial characterization by immunofluorescent staining. Cells were fixed in 4% paraformaldehyde, washed with PBS, and incubated with 10% normal goat serum at room temperature for 30 min to block non-specific interactions. The cells were then incubated overnight at 4°C with the respective primary antibodies targeting pan-cytokeratin (AE1/AE3; Invitrogen), VIM and a-SMA. After several washes in PBS, cells were incubated with FITC-labelled goat anti-rabbit secondary antibody (Dako, Glostrup, Denmark) at a dilution of 1:100, at room temperature for 30 min. Nuclei were counterstained with diamidino-2-phenylindole (DAPI). MYOFIBROBLAST INVASION ASSAY
To evaluate the invasive activity of myofibroblasts, we used a microfluidic device developed in our previous study.24 Briefly, Cultrex Basement Membrane Extract (BME; R&D Systems, Minneapolis, MN, USA) was used as a substitute for ECM. BME alone and BME containing myofibroblasts (1 9 106/ml) were placed in the device. A definite interface between them was formed. The device was then placed inside a 37°C incubator with 5% CO2 and 95% relative humidity. The invasion of myofibroblasts into the BME matrix was recorded every day with an inverted fluorescence microscope (Olympus IX 71, Tokyo, Japan). A fibroblast cell line (HFL1) originally isolated from human fetal lung was used as the control (Cell
Table 2. Primers used for PCR Forward primer (50 –30 )
Reverse primer (50 –30 )
MMP2
CACTTTCCTGGGCAACAAAT
GCCTCGTATACCGCATCAAT
MMP9
GGCGCTCATGTACCCTATGT
CCTGTGTACACCCACACCTG
CXCL12
TCAGCCTGAGCTACAGATGC
CTTTAGCTTCGGGTCAATGC
18S rRNA
AAACGGCTACCACATCCAAG
CCCTCTTAATCATGGCCTCA
© 2014 John Wiley & Sons Ltd, Histopathology, 66, 781–790.
H Guan et al.
784
Bank of the Type Culture Collection of the Chinese Academy of Sciences). TOTAL RNA ISOLATION AND REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION (RT-PCR)
The total RNA of myofibroblasts was isolated using the Total RNA Isolation Kit (Macherey-Nagel, D€ uren, Germany). RNA was reverse transcribed to cDNA using the PrimeScript 1st Strand cDNA Synthesis Kit for RT-PCR (Takara Biotechnology, Dalian, China). The resulting cDNA products were subjected to PCR amplification using gene-specific primers for MMP2, MMP9, CXCL12, and 18S rRNA. The amplified products were electrophoresed in 1.5% agarose gel containing ethidium bromide with DL 2000 DNA Marker (Takara Biotechnology). The specific primers used are listed in Table 2. A
B
C
D
STATISTICAL ANALYSIS
Statistical analysis was performed using SPSS version 13.0 for Windows. The differences in expression of target proteins between ACCs and normal salivary glands were analysed by the Mann–Whitney U-test. Correlations were evaluated by the Spearman correlation coefficient test. A P-value of 0.05 was considered to be statistically significant.
Results MYOFIBROBLASTS PRESENT IN ACCs DETERMINED BY IMMUNOHISTOCHEMISTRY
VIM-positive stromal cells were found in both normal controls and ACCs (Figure 1A–E). However, a-SMApositive cells were rarely found in the stroma of normal
ACCs Controls
Cases
E
0.005
0.010
0.015 0.020 0.025 Expression of VIM (IOD)
0.030
0.035
Figure 1. Immunohistochemical staining of vimentin (VIM). A, Brown cytoplasmic staining in fibroblasts of normal salivary glands (arrow). B–D, Strong positive staining in fibroblasts of cribriform (B), tubular (C) and solid (D) subtypes of ACC (arrowheads). E, The expression levels of VIM in ACCs and normal controls. Scale bar: 20 lm.
© 2014 John Wiley & Sons Ltd, Histopathology, 66, 781–790.
Myofibroblasts promote cancer invasion by expressing MMP2
A
B
C
D
E
ACCs Controls
Cases
Figure 2. Immunohistochemical staining of a-smooth muscle actin (a-SMA). A, No staining was found in the fibroblasts of normal salivary glands (arrow). B–D, Strong positive staining in fibroblasts of cribriform (B), tubular (C) and solid (D) subtypes of ACC (arrowheads). E, The expression levels of a-SMA in ACCs and normal controls. Scale bar: 20 lm.
0.005
salivary glands (Figure 2A). In contrast, numerous aSMA-positive cells were found in the stroma of ACCs (Figure 2B–D). The expression level of a-SMA was significantly higher in ACCs than in normal controls (Figure 2E; P < 0.001), suggesting the existence of myofibroblasts in ACCs. No ACCs were completely a-SMA-negative in the stroma. Although the solid subtype of ACC showed a slightly higher expression level of a-SMA than the cribriform and tubular subtypes, no significant differences were found between them. MMP2 SHOWS HIGHER EXPRESSION IN THE STROMA OF ACCs THAN IN NORMAL CONTROLS
Using immunohistochemical staining it was found that MMP2 showed mild expression in the stroma of © 2014 John Wiley & Sons Ltd, Histopathology, 66, 781–790.
785
0.010
0.015 0.020 0.025 Expression of α-SMA (IOD)
0.030
0.035
normal salivary glands and strong expression in the stroma of ACCs (Figure 3A–E). The difference in MMP2 expression in the stroma between ACCs and normal controls was significant (P < 0.001). CORRELATION OF MICROVESSEL DENSITY WITH MYOFIBROBLASTS IN ACCs
Immunohistochemical staining of CD34 was performed for ACC cases and normal salivary gland controls. Vascular endothelial cells or endothelial cell clusters were evident around the tumours. The mean MVD value was 32.52 in ACCs and 18.47 in normal controls (Figure 4A–D); the difference in MVD between the two groups was significant (P < 0.05), suggesting active angiogenesis in ACCs. Next, we analysed the correlation between MVD and stromal
786
H Guan et al.
A
B
C
D
E
ACCs Controls
Cases
Figure 3. Immunohistochemical staining of MMP2. A, No staining in the fibroblasts of a normal controls (arrow). B–D, Positive staining in the stroma of cribriform (B), tubular (C) and solid (D) subtypes of ACC (arrowheads). E, The expression levels of MMP2 in ACCs and normal controls. Scale bar: 20 lm.
0.005
0.010 0.015 0.020 0.025 Expression of MMP2 (IOD)
a-SMA expression in ACCs, but no significant relationship was found (P > 0.05). ACC-DERIVED MYOFIBROBLASTS SHOW INCREASED INVASIVE ABILITY AND HIGH
0.030
0.035
degrade ECM. HFL1 cells were used as a control. It was found that MMP2 showed higher expression in myofibroblasts than in HFL1 cells, whereas no detectable change in MMP9 expression was found in either myofibroblasts or HFL1 cells (Figure 5F).
EXPRESSION OF MMP2
The invasive ability of ACC-derived myofibroblasts was assessed. These cells showed the typical hallmarks of fibroblasts, with cytoplasmic processes on 2D surface culture (Figure 5A). They were negative for pan-cytokeratin, and positive for both VIM and a-SMA (Figure 5B–D). To mimic the in-vivo status, we embedded the myofibroblasts in BME, a substitute for ECM. The myofibroblasts were round during the first day, and changed into a spindle shape after 24 h of culture (data not shown). Over time, the myofibroblasts extended long processes and invaded the adjacent BME (Figure 5E), suggesting that they had the ability to
CXCL12 EXPRESSION IN MYOFIBROBLASTS OF ACC
We tried to determine whether myofibroblasts promote ACC invasion by secreting cytokines. Our results demonstrated that ACC-derived myofibroblasts showed significantly higher expression of CXCL12 than HFL1 cells (Figure 6A,B).
Discussion Adenoid cystic carcinomas are characterized by a high potential for invasion. Until now, surgical © 2014 John Wiley & Sons Ltd, Histopathology, 66, 781–790.
Myofibroblasts promote cancer invasion by expressing MMP2
A
B
C
D
787
E
Cases
ACCs Controls
Figure 4. Immunohistochemical staining of CD34. Microvessels positive for CD34 were found in the stroma of normal controls (A), and the cribriform (B), tubular (C) and solid (D) subtypes of ACC. Scale bar: 20 lm.
0
excision has been the most common choice for ACC treatment, and adjunctive radiation therapy has been shown to slightly improve patient survival in some cases.25 Recent attempts to elucidate tumour behaviour have focused on the stroma, which is considered to be important for tumour growth and invasion.26 In this study, we tried to determine whether the stromal cells contribute to the invasive ability of ACCs. Extracellular matrix, which is composed of collagen, fibrillin, fibronectin, laminin, and proteoglycans, is a barrier against tumour invasion.27 Fibroblasts constitute an important source of ECM renewal, by synthesizing many of these components.28,29 In addition to secreting growth factors that directly affect cell growth and motility, myofibroblasts can secrete ECM-degrading proteases such as MMPs, which allow © 2014 John Wiley & Sons Ltd, Histopathology, 66, 781–790.
10
20 30 40 50 MVD (vessels / 400X field)
60
70
cancer cells to cross tissue boundaries and escape the primary tumour site.30 Biore et al.31 reported that myofibroblast-derived MMP1 stimulated invasion pathways by cleaving protease-activated receptor-1 on the breast cancer cell surface. Hu et al. reported that co-culture of myofibroblasts with human breast ductal carcinoma in situ (DCIS) epithelial cells enhanced their motility and invasion. This change was associated with increased MMP14 expression and MMP9 protease activity.20 MMP3 can cleave the cell surface protein E-cadherin either directly or indirectly by activation or induction of other proteases, and also enhances the conversion of normal mammary epithelial cells to mesenchymal cells and promotes tumour invasion.32 A study of oral squamous cell carcinoma (OSCC) showed that myofibroblasts stimulated invasion of SCC9 cells by increased
788
H Guan et al.
A
B
C
D
E
F 0h
MF
HFL1
MMP2 MMP9 48 h
18S rRNA
72 h
Expressionlevel
2
*
0.1
MF HFL1
1 0.5 0 MMP2
MMP1, MMP2, MMP9 and MMP13 production.33 Upregulation of MMP2 has been reported in human ovarian cancer cells, and is critical for cancer cell adhesion to the mesothelial lining of the peritoneum and omentum.34 Our study demonstrates that ACCderived myofibroblasts with high MMP2 expression show increased invasive ability, suggesting that myofibroblasts in ACCs might degrade ECM by expressing MMP2 to facilitate tumour cell invasion. It is now evident that the proteolytic activity of MMPs can be regulated at different levels, such as gene expression, compartmentalization, conversion from zymogen to active enzyme, and the presence of specific inhibitors.35,36 Therefore, further studies investigating the effects of MMP inhibitors, as well as using
MMP9
Figure 5. Characteristics of myofibroblasts isolated from ACC. A, Myofibroblasts showed the typical appearance of fibroblasts, with long processes on 2D surface culture (brightfield picture). B–D, Myofibroblasts showed negative pan-cytokeratin staining (B), positive labelling for VIM (C), and positive cytoplasmic staining for a-SMA (D). E, Myofibroblasts showed active invasion into the adjacent matrix. F, Myofibroblasts (MF) showed higher expression of MMP2 than HFL1 cells. Scale bar: 50 lm.
other methods, such as western blotting, should be undertaken in an attempt to better understand the role and influence of MMP2 in the behaviour of ACCs. Tumour angiogenesis has been previously demonstrated to occur in many tumours and with high MVD.37,38 Several studies of human breast and prostate carcinomas have shown that myofibroblasts secrete soluble factors, and that chemokines recruit endothelial progenitor cells into carcinomas, enhancing angiogenesis.15,39 However, our results demonstrated that the high MVD in ACCs was not related to the number of myofibroblasts, indicating that the promotion of angiogenesis by myofibroblasts was not significant in ACCs. © 2014 John Wiley & Sons Ltd, Histopathology, 66, 781–790.
MF CXCL12
18SrRNA
HFL1
Relative expression
Myofibroblasts promote cancer invasion by expressing MMP2
*
1.2
789
Acknowledgements
0.8
This work was supported by the National Natural Science Foundation of China (No. 81171425) and the Program for Liaoning Excellent Talents in University (No. LR201013).
0.4 0 MF
HFL1
Figure 6. (A, B), CXCL12 expression in myofibroblasts. CXCL12 showed higher expression in myofibroblasts (MF) than in HFL1 cells by RT-PCR analysis.
Myofibroblasts can interact with cancer cells directly. Interleukin-1a (IL-1a) released from OSCC cells induced myofibroblasts to secret CCL7, which can up-regulate MMP2 expression by OSCC cells to increase invasion.40 Investigation of the interaction between human prostate cancer cells and myofibroblasts identified a circuitry in which cancer cell-produced IL-6 affects fibroblast activation, which in turn causes the secretion of MMP2, enhancing cancer invasion.41 A study of human mammary DCIS showed that paracrine HGF–c-Met signalling between fibroblasts and pre-invasive DCIS cells increased the invasive phenotype of DCIS cells, including their ability to migrate and to degrade type IV collagen.42 A study focusing on the role of stromal-derived chemokines in prostate cancer progression showed that prostate cancer cells express CXCL2, CXCL5, CXCL6 and CXCL12 to promote tumour growth, angiogenesis, and invasion.43 Myofibroblasts overexpressing CXCL14 promoted the growth of prostate cancer xenografts and increased tumour angiogenesis and macrophage infiltration.19 Several studies have shown that CXCL12 signalling potentially regulates ACC invasion and metastasis. Previously, we showed that ACC-derived myofibroblasts induced ACC cell line invasion into a myofibroblast-containing matrix, and that ACC cells show high expression of CXCR4.24,44 In this study, it was demonstrated that CXCL12 is highly expressed in ACC-derived myofibroblasts. We propose that up-regulation of MMP2 in myofibroblasts of ACCs causes degradation of ECM at the invasion front, and that ACC tumour cells then follow the track of myofibroblasts into the surrounding tissue by a CXCL12–CXCR4 signalling pathway. In summary, our results demonstrate that ACCderived myofibroblasts show high invasive ability and express high levels of MMP2. The invasive growth behaviour of ACC might be attributable to the interaction between myofibroblasts and tumour cells. © 2014 John Wiley & Sons Ltd, Histopathology, 66, 781–790.
Author contributions Haijie Guan: reference collection, immunohistochemical staining for MMP2, RT-PCR, and statistical analysis. Jie Tan: immunohistochemical staining for CD34 and a-SMA. Fuyin Zhang: sample collection and student instruction. Lu Gao, Liang Bai and Dongyuan Qi: sample collection and H&E staining. Hui Dong: primary myofiboblast isolation. Lei Zhu: immunohistochemical staining for VIM. Xiaojie Li: myofibroblast invasion assay. Tingjiao Liu: study design, data analysis, and manuscript preparation.
Conflicts of interest The authors have no conflict of interest.
References 1. Brill LB 2nd, Kanner WA, Fehr A et al. Analysis of MYB expression and MYB–NFIB gene fusions in adenoid cystic carcinoma and other salivary neoplasms. Mod. Pathol. 2011; 24; 1169–1176. 2. Barnes L, Eveson JW, Reichart P eds. World Health Organization classification of tumours. Pathology and genetics of head and neck tumours. Lyon: IARC Press, 2005; 221–222. 3. Seifert G, Sobin LH. The World Health Organization’s histological classification of salivary gland tumors: a commentary on the second edition. Cancer 1992; 70; 379–385. 4. Bradley PJ. Adenoid cystic carcinoma of the head and neck: a review. Curr. Opin. Otolaryngol. Head Neck Surg. 2004; 12; 127–132. 5. Bell D, Hanna EY. Head and neck adenoid cystic carcinoma: what is new in biological markers and treatment? Curr. Opin. Otolaryngol. Head Neck Surg. 2013; 21; 124–129. 6. Wetterskog D, Lopez-Garcia MA, Lambros MB et al. Adenoid cystic carcinomas constitute a genomically distinct subgroup of triple-negative and basal-like breast cancers. J. Pathol. 2012; 226; 84–96. 7. Persson M, Andren Y, Mark J, Horlings HM, Persson F, Stenman G. Recurrent fusion of MYB and NFIB transcription factor genes in carcinomas of the breast and head and neck. Proc. Natl Acad. Sci. USA 2009; 106; 18740–18744. 8. Kalluri R, Zeisberg M. Fibroblasts in cancer. Nat. Rev. Cancer 2006; 6; 392–401. 9. Micke P, Ostman A. Tumour–stroma interaction: cancer-associated fibroblasts as novel targets in anti-cancer therapy? Lung Cancer 2004; 45 (Suppl. 2); S163–S175. 10. Gabbiani G. The myofibroblast in wound healing and fibrocontractive diseases. J. Pathol. 2003; 200; 500–503.
790
H Guan et al.
11. Ross R, Everett NB, Tyler R. Wound healing and collagen formation. VI. The origin of the wound fibroblast studied in parabiosis. J. Cell Biol. 1970; 44; 645–654. 12. Ostman A, Augsten M. Cancer-associated fibroblasts and tumor growth—bystanders turning into key players. Curr. Opin. Genet. Dev. 2009; 19; 67–73. 13. Joesting MS, Perrin S, Elenbaas B et al. Identification of SFRP1 as a candidate mediator of stromal-to-epithelial signaling in prostate cancer. Cancer Res. 2005; 65; 10423–10430. 14. Lewis MP, Lygoe KA, Nystrom ML et al. Tumour-derived TGFbeta1 modulates myofibroblast differentiation and promotes HGF/SF-dependent invasion of squamous carcinoma cells. Br. J. Cancer 2004; 90; 822–832. 15. Orimo A, Gupta PB, Sgroi DC et al. Stromal fibroblasts present in invasive human breast carcinomas promote tumor growth and angiogenesis through elevated SDF-1/CXCL12 secretion. Cell 2005; 121; 335–348. 16. Zhu CQ, Popova SN, Brown ER et al. Integrin alpha 11 regulates IGF2 expression in fibroblasts to enhance tumorigenicity of human non-small-cell lung cancer cells. Proc. Natl Acad. Sci. USA 2007; 104; 11754–11759. 17. Taniwaki K, Fukamachi H, Komori K et al. Stroma-derived matrix metalloproteinase (MMP)-2 promotes membrane type 1MMP-dependent tumor growth in mice. Cancer Res. 2007; 67; 4311–4319. 18. Yang F, Tuxhorn JA, Ressler SJ, McAlhany SJ, Dang TD, Rowley DR. Stromal expression of connective tissue growth factor promotes angiogenesis and prostate cancer tumorigenesis. Cancer Res. 2005; 65; 8887–8895. 19. Augsten M, Hagglof C, Olsson E et al. CXCL14 is an autocrine growth factor for fibroblasts and acts as a multi-modal stimulator of prostate tumor growth. Proc. Natl Acad. Sci. USA 2009; 106; 3414–3419. 20. Hu M, Peluffo G, Chen H, Gelman R, Schnitt S, Polyak K. Role of COX-2 in epithelial–stromal cell interactions and progression of ductal carcinoma in situ of the breast. Proc. Natl Acad. Sci. USA 2009; 106; 3372–3377. 21. Wang J, Ying G, Wang J et al. Characterization of phosphoglycerate kinase-1 expression of stromal cells derived from tumor microenvironment in prostate cancer progression. Cancer Res. 2010; 70; 471–480. 22. Grugan KD, Miller CG, Yao Y et al. Fibroblast-secreted hepatocyte growth factor plays a functional role in esophageal squamous cell carcinoma invasion. Proc. Natl Acad. Sci. USA 2010; 107; 11026–11031. 23. Zhang W, Matrisian LM, Holmbeck K, Vick CC, Rosenthal EL. Fibroblast-derived MT1-MMP promotes tumor progression in vitro and in vivo. BMC Cancer 2006; 6; 52. 24. Liu T, Lin B, Qin J. Carcinoma-associated fibroblasts promoted tumor spheroid invasion on a microfluidic 3D co-culture device. Lab Chip 2010; 10; 1671–1677. 25. Jaso J, Malhotra R. Adenoid cystic carcinoma. Arch. Pathol. Lab. Med. 2011; 135; 511–515. 26. Valach J, Fik Z, Strnad H et al. Smooth muscle actin-expressing stromal fibroblasts in head and neck squamous cell carcinoma: increased expression of galectin-1 and induction of poor prognosis factors. Int. J. Cancer 2012; 131; 2499–2508. 27. Ronnov-Jessen L, Petersen OW, Bissell MJ. Cellular changes involved in conversion of normal to malignant breast: importance of the stromal reaction. Physiol. Rev. 1996; 76; 69–125.
28. Rodemann HP, Muller GA. Characterization of human renal fibroblasts in health and disease: II. In vitro growth, differentiation, and collagen synthesis of fibroblasts from kidneys with interstitial fibrosis. Am. J. Kidney Dis. 1991; 17; 684–686. 29. Tomasek JJ, Gabbiani G, Hinz B, Chaponnier C, Brown RA. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat. Rev. Mol. Cell Biol. 2002; 3; 349–363. 30. Wiseman BS, Werb Z. Stromal effects on mammary gland development and breast cancer. Science 2002; 296; 1046–1049. 31. Boire A, Covic L, Agarwal A, Jacques S, Sherifi S, Kuliopulos A. PAR1 is a matrix metalloprotease-1 receptor that promotes invasion and tumorigenesis of breast cancer cells. Cell 2005; 120; 303–313. 32. Lochter A, Galosy S, Muschler J, Freedman N, Werb Z, Bissell MJ. Matrix metalloproteinase stromelysin-1 triggers a cascade of molecular alterations that leads to stable epithelial-to-mesenchymal conversion and a premalignant phenotype in mammary epithelial cells. J. Cell Biol. 1997; 139; 1861–1872. 33. Sobral LM, Bufalino A, Lopes MA, Graner E, Salo T, Coletta RD. Myofibroblasts in the stroma of oral cancer promote tumorigenesis via secretion of activin A. Oral Oncol. 2011; 47; 840–846. 34. Kikuchi R, Noguchi T, Takeno S, Kubo N, Uchida Y. Immunohistochemical detection of membrane-type-1-matrix metalloproteinase in colorectal carcinoma. Br. J. Cancer 2000; 83; 215–218. 35. Kenny HA, Kaur S, Coussens LM, Lengyel E. The initial steps of ovarian cancer cell metastasis are mediated by MMP-2 cleavage of vitronectin and fibronectin. J. Clin. Invest. 2008; 118; 1367–1379. 36. Kessenbrock K, Plaks V, Werb Z. Matrix metalloproteinases: regulators of the tumor microenvironment. Cell 2010; 141; 52–67. 37. Ogawa Y, Chung YS, Nakata B et al. Microvessel quantitation in invasive breast cancer by staining for factor VIII-related antigen. Br. J. Cancer 1995; 71; 1297–1301. 38. Zhang J, Peng B, Chen X. Expressions of nuclear factor kappaB, inducible nitric oxide synthase, and vascular endothelial growth factor in adenoid cystic carcinoma of salivary glands: correlations with the angiogenesis and clinical outcome. Clin. Cancer Res. 2005; 11; 7334–7343. 39. Yang S, Pham LK, Liao CP, Frenkel B, Reddi AH, Roy-Burman P. A novel bone morphogenetic protein signaling in heterotypic cell interactions in prostate cancer. Cancer Res. 2008; 68; 198–205. 40. Jung DW, Che ZM, Kim J et al. Tumor–stromal crosstalk in invasion of oral squamous cell carcinoma: a pivotal role of CCL7. Int. J. Cancer 2010; 127; 332–344. 41. Giannoni E, Bianchini F, Masieri L et al. Reciprocal activation of prostate cancer cells and cancer-associated fibroblasts stimulates epithelial–mesenchymal transition and cancer stemness. Cancer Res. 2010; 70; 6945–6956. 42. Jedeszko C, Victor BC, Podgorski I, Sloane BF. Fibroblast hepatocyte growth factor promotes invasion of human mammary ductal carcinoma in situ. Cancer Res. 2009; 69; 9148–9155. 43. Vindrieux D, Escobar P, Lazennec G. Emerging roles of chemokines in prostate cancer. Endocr. Relat. Cancer 2009; 16; 663–673. 44. Zhang Q, Liu T, Qin J. A microfluidic-based device for study of transendothelial invasion of tumor aggregates in realtime. Lab Chip 2012; 12; 2837–2842.
© 2014 John Wiley & Sons Ltd, Histopathology, 66, 781–790.
Copyright of Histopathology is the property of Wiley-Blackwell and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
Myofibroblasts from salivary gland adenoid cystic carcinomas promote cancer invasion by expressing MMP2 and CXCL12 Haijie Guan, Jie Tan, Fuyin Zhang,1 Lu Gao, Liang Bai,2 Dongyuan Qi,2 Hui Dong,2 Lei Zhu, Xiaojie Li & Tingjiao Liu Section of Oral Pathology, College of Stomatology, 1Department of Oral Surgery, The Second Affiliated Hospital, and 2 Department of Oral Surgery, The First Affiliated Hospital, Dalian Medical University, Dalian, China Date of submission 1 April 2014 Accepted for publication 28 July 2014 Published online Article Accepted 7 August 2014
Guan H, Tan J, Zhang F, Gao L, Bai L, Qi D, Dong H, Zhu L, Li X & Liu T (2015) Histopathology 66, 781–790. DOI: 10.1111/his.12519
Myofibroblasts from salivary gland adenoid cystic carcinomas promote cancer invasion by expressing MMP2 and CXCL12 Objectives: Salivary gland adenoid cystic carcinoma (ACC) is one of the most common malignant tumours in the oral and maxillofacial region, and has high aggressive potential. Tumour and stroma interactions are critical in determining the biological characteristics of malignancy. The aim of this study was to investigate the presence of myofibroblasts and their roles in the invasive characteristics of ACC. Methods and results: Immunohistochemistry was used to detect the expression of vimentin (VIM), a-smooth muscle actin (a-SMA), matrix metalloproteinase 2 (MMP2) and CD34 in ACCs and normal salivary gland controls. A significant difference in a-SMA expression was found between normal
controls and ACCs, suggesting the presence of myofibroblasts in ACCs. Immunohistochemical staining also demonstrated higher MMP2 expression in the stroma of ACCs than in the controls (P < 0.001). Primary culture of myofibroblasts from one ACC showed great invasive activity, with high expression of MMP2 and C-X-C motif chemokine 12 (CXCL12) by reverse transcription polymerase chain reaction (RT-PCR) analysis. Conclusions: This study demonstrated the presence of myofibroblasts in ACC. Myofibroblasts might be related to the aggressive growth behaviour of ACC, owing to their high levels of expression of MMP2 and CXCL12.
Keywords: adenoid cystic carcinoma, CXCL12, invasion, MMP2, myofibroblasts
Introduction Adenoid cystic carcinoma (ACC) is among the most common carcinomas of salivary glands, but may also arise in a wide range of other locations, including the sinonasal tract, tracheobronchial tree, breast, vulva, and skin.1 ACC consists of two main cell types: ductal and modified myoepithelial cells. These two types of cell show three basic growth patterns: cribriform, Address for correspondence: T Liu, Building of College of Stomatology, West Section No. 9, South Road of Lvshun, Dalian 116044, China. e-mail: [email protected] © 2014 John Wiley & Sons Ltd.
tubular, and solid. The stroma within the tumour is generally hyalinized.2,3 Although it is typically slowgrowing, ACC usually grows very aggressively; the tumour may invade bone tissue extensively before there is obvious osseous destruction.2 The current effective treatment modalities for ACC in the head and neck include surgery and radiotherapy.4 The identification of molecular abnormalities underlying ACC is extremely important for the development of specific targeted therapies. Recent studies have shown that the t(6;9)(q22–23; p23–24) chromosomal translocation in ACC results in fusions of MYB exon 14 to the last coding exon(s) of NFIB.5–7 Significant efforts
782
H Guan et al.
are needed to improve our knowledge of the molecular genetic events in this malignancy, in order to provide new therapeutic targets. Genetic and cell biological studies indicate that tumour growth is determined not only by malignant cancer cells themselves, but also by the tumour stroma.8 Fibroblasts are an important component of the tumour stroma. They not only deposit extracellular matrix (ECM), but also secrete ECM-degrading proteases such as matrix metalloproteinases (MMPs).8 Thus, fibroblasts play a crucial role in maintaining ECM homeostasis by regulating ECM turnover. Studies on human carcinomas have identified ‘activated’ fibroblasts within tumour stroma, similar to the fibroblasts associated with wound healing.9 These modified fibroblasts are commonly identified by their expression of a-smooth muscle actin (a-SMA).8,10 Thus, they are often termed myofibroblasts, carcinoma-associated fibroblasts, or tumour-associated fibroblasts. Local fibroblasts, or fibroblast precursors, have generally been considered to be the major sources of myofibroblasts.11 However, recent studies have suggested additional cellular sources of myofibroblasts, such as endothelial cells, malignant epithelial cells undergoing epithelial–mesenchymal transition, or mesenchymal stem cells.12 Myofibroblasts produce a variety of autocrine and paracrine factors that affect tumour growth and metastasis.8,13–16 MMP2 derived from myofibroblasts enhances cancer cell invasion.17 The release of VEGF, FGF and CTGF by myofibroblasts stimulates angiogenesis.18 Recently, myofibroblast-derived chemokines, such as C-X-C motif chemokine 12 (CXCL12) and CXCL14, were found to recruit bone marrow-derived cells or immune cells into the growing tumour.15,19 Overall, myofibroblasts create a tumour-permissive microenvironment and contribute to the metastasis phenotype of cancer cells. With accumulating evidence for their cancer-promoting effects, myofibroblasts might serve as novel therapeutic targets in cancer.12 Myofibroblasts seem to promote cancer progression in an organ-specific manner. In breast cancer, myofibroblasts promote cancer cell growth, angiogenesis and invasion by producing CXCL12, MMP9, and MMP14;15,20 and in prostate cancer promote cancer cell growth and invasion by producing CXCL12, CXCL14, MMP2, and MMP3.19,21 Squamous cell carcinoma of the head and neck (HNSCC) is a relatively common human cancer characterized by high morbidity and mortality.22 It has been reported that growth factors secreted by myofibroblasts from HNSCC and oesophageal SCC promote
cancer invasion.22 Another study reported that fibroblast-derived MMP2 and MT1-MMP in HNSCC promote tumour growth and invasion.23 To develop effective stroma-targeted therapeutic strategies, it is necessary to determine the specific molecules secreted by myofibroblasts from different cancers. The aim of this study was to investigate the presence of myofibroblasts in ACC and the roles of these cells in the invasive characteristics of this tumour.
Materials and methods All studies involving human materials were approved by the Research Ethics Committee, Dalian Medical University, China.
PATIENTS AND TISSUE SAMPLES
The study included a total of 18 cases of ACC diagnosed at the First Affiliated Hospital of Dalian Medical University. The patients had received no chemotherapy or radiotherapy before surgical resection. They included 11 men and seven women; their ages ranged from 36 to 80 years. Nine cases arose in the parotid glands, four in the submandibular glands, two in the sublingual glands, and three cases in minor salivary glands. Diagnosis and histopathological classification were based on the World Health Organization classification of tumours. Pathology and genetics of head and neck tumours, using histological sections stained with haematoxylin and eosin.2 Eleven cases showed a cribriform growth pattern, two a tubular pattern, and five a solid pattern. Eighteen cases of normal salivary gland were used as controls.
IMMUNOHISTOCHEMICAL STAINING
The clones, dilutions and sources of primary antibodies used in our study are listed in Table 1. Immunohistochemical staining was performed using the streptavidin–biotin complex technique. Endogenous biotin was blocked using the IHC Biotin Block Kit (Maixin-Bio, Fuzhou, China), endogenous peroxidase activity using 3% hydrogen peroxide in methanol, and non-specific binding using 10% normal goat serum. The sections were incubated with the respective primary antibodies overnight at 4°C. After washing with phosphate-buffered saline (PBS), they were incubated with horseradish peroxidase-conjugated secondary antibodies (Invitrogen, Carlsbad, CA, USA). © 2014 John Wiley & Sons Ltd, Histopathology, 66, 781–790.
Myofibroblasts promote cancer invasion by expressing MMP2
Table 1. Clones, dilutions and sources of primary antibodies Antibody
Clone
Dilution
Source
VIM
V9
1:200
Invitrogen
a-SMA
1A4
1:100
Zeta Corporation
MMP2
CA-4001
1:50
Lab Vision Corporation
CD34
QBEnd-10
1:100
Dako
783
microvessels, tumour cells and other connective tissue elements was considered to be a single, countable microvessel. A vessel lumen was not required for identification of a microvessel. MYOFIBROBLAST ISOLATION AND CHARACTERIZATION
The antigen-bound peroxidase activity was visualized by staining the sections with diaminobenzidine chromogen. The sections were then counterstained with haematoxylin. Negative control experiments were carried out by replacing the primary antibodies with PBS. EVALUATION OF STAINING
The expression levels of vimentin (VIM), a-SMA and MMP2 in the stroma of ACCs and normal controls were evaluated in 10 random high-power fields (9400), each field measuring 0.24 mm2. As the main purpose of this study was to investigate the expression of target proteins in stroma, the parenchyma was filled white using image software. The integrated optical density (IOD) and the area of target distribution were measured with IMAGE-PRO PLUS 6.0 (Media Cybernetics, Inc., Silver Spring, MD, USA). We calculated the mean density of each field, and took the average of the mean density of 10 fields as the mean density of each case. Microvessel density (MVD) was evaluated by counting CD34-labelled neovessels in the endothelium. Hot spots (intense neovascularization) were assessed in tumour areas showing the highest density of CD34 staining. For vessel counting, a high-power field (9400) in each of the 10 most vascular areas was used. A CD34-positive endothelial cell or endothelial cell cluster that was clearly separate from adjacent
Myofibroblasts were isolated from a 65-year-old female patient with sublingual gland ACC as described previously.24 We used myofibroblasts passaged for three population doublings for initial characterization by immunofluorescent staining. Cells were fixed in 4% paraformaldehyde, washed with PBS, and incubated with 10% normal goat serum at room temperature for 30 min to block non-specific interactions. The cells were then incubated overnight at 4°C with the respective primary antibodies targeting pan-cytokeratin (AE1/AE3; Invitrogen), VIM and a-SMA. After several washes in PBS, cells were incubated with FITC-labelled goat anti-rabbit secondary antibody (Dako, Glostrup, Denmark) at a dilution of 1:100, at room temperature for 30 min. Nuclei were counterstained with diamidino-2-phenylindole (DAPI). MYOFIBROBLAST INVASION ASSAY
To evaluate the invasive activity of myofibroblasts, we used a microfluidic device developed in our previous study.24 Briefly, Cultrex Basement Membrane Extract (BME; R&D Systems, Minneapolis, MN, USA) was used as a substitute for ECM. BME alone and BME containing myofibroblasts (1 9 106/ml) were placed in the device. A definite interface between them was formed. The device was then placed inside a 37°C incubator with 5% CO2 and 95% relative humidity. The invasion of myofibroblasts into the BME matrix was recorded every day with an inverted fluorescence microscope (Olympus IX 71, Tokyo, Japan). A fibroblast cell line (HFL1) originally isolated from human fetal lung was used as the control (Cell
Table 2. Primers used for PCR Forward primer (50 –30 )
Reverse primer (50 –30 )
MMP2
CACTTTCCTGGGCAACAAAT
GCCTCGTATACCGCATCAAT
MMP9
GGCGCTCATGTACCCTATGT
CCTGTGTACACCCACACCTG
CXCL12
TCAGCCTGAGCTACAGATGC
CTTTAGCTTCGGGTCAATGC
18S rRNA
AAACGGCTACCACATCCAAG
CCCTCTTAATCATGGCCTCA
© 2014 John Wiley & Sons Ltd, Histopathology, 66, 781–790.
H Guan et al.
784
Bank of the Type Culture Collection of the Chinese Academy of Sciences). TOTAL RNA ISOLATION AND REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION (RT-PCR)
The total RNA of myofibroblasts was isolated using the Total RNA Isolation Kit (Macherey-Nagel, D€ uren, Germany). RNA was reverse transcribed to cDNA using the PrimeScript 1st Strand cDNA Synthesis Kit for RT-PCR (Takara Biotechnology, Dalian, China). The resulting cDNA products were subjected to PCR amplification using gene-specific primers for MMP2, MMP9, CXCL12, and 18S rRNA. The amplified products were electrophoresed in 1.5% agarose gel containing ethidium bromide with DL 2000 DNA Marker (Takara Biotechnology). The specific primers used are listed in Table 2. A
B
C
D
STATISTICAL ANALYSIS
Statistical analysis was performed using SPSS version 13.0 for Windows. The differences in expression of target proteins between ACCs and normal salivary glands were analysed by the Mann–Whitney U-test. Correlations were evaluated by the Spearman correlation coefficient test. A P-value of 0.05 was considered to be statistically significant.
Results MYOFIBROBLASTS PRESENT IN ACCs DETERMINED BY IMMUNOHISTOCHEMISTRY
VIM-positive stromal cells were found in both normal controls and ACCs (Figure 1A–E). However, a-SMApositive cells were rarely found in the stroma of normal
ACCs Controls
Cases
E
0.005
0.010
0.015 0.020 0.025 Expression of VIM (IOD)
0.030
0.035
Figure 1. Immunohistochemical staining of vimentin (VIM). A, Brown cytoplasmic staining in fibroblasts of normal salivary glands (arrow). B–D, Strong positive staining in fibroblasts of cribriform (B), tubular (C) and solid (D) subtypes of ACC (arrowheads). E, The expression levels of VIM in ACCs and normal controls. Scale bar: 20 lm.
© 2014 John Wiley & Sons Ltd, Histopathology, 66, 781–790.
Myofibroblasts promote cancer invasion by expressing MMP2
A
B
C
D
E
ACCs Controls
Cases
Figure 2. Immunohistochemical staining of a-smooth muscle actin (a-SMA). A, No staining was found in the fibroblasts of normal salivary glands (arrow). B–D, Strong positive staining in fibroblasts of cribriform (B), tubular (C) and solid (D) subtypes of ACC (arrowheads). E, The expression levels of a-SMA in ACCs and normal controls. Scale bar: 20 lm.
0.005
salivary glands (Figure 2A). In contrast, numerous aSMA-positive cells were found in the stroma of ACCs (Figure 2B–D). The expression level of a-SMA was significantly higher in ACCs than in normal controls (Figure 2E; P < 0.001), suggesting the existence of myofibroblasts in ACCs. No ACCs were completely a-SMA-negative in the stroma. Although the solid subtype of ACC showed a slightly higher expression level of a-SMA than the cribriform and tubular subtypes, no significant differences were found between them. MMP2 SHOWS HIGHER EXPRESSION IN THE STROMA OF ACCs THAN IN NORMAL CONTROLS
Using immunohistochemical staining it was found that MMP2 showed mild expression in the stroma of © 2014 John Wiley & Sons Ltd, Histopathology, 66, 781–790.
785
0.010
0.015 0.020 0.025 Expression of α-SMA (IOD)
0.030
0.035
normal salivary glands and strong expression in the stroma of ACCs (Figure 3A–E). The difference in MMP2 expression in the stroma between ACCs and normal controls was significant (P < 0.001). CORRELATION OF MICROVESSEL DENSITY WITH MYOFIBROBLASTS IN ACCs
Immunohistochemical staining of CD34 was performed for ACC cases and normal salivary gland controls. Vascular endothelial cells or endothelial cell clusters were evident around the tumours. The mean MVD value was 32.52 in ACCs and 18.47 in normal controls (Figure 4A–D); the difference in MVD between the two groups was significant (P < 0.05), suggesting active angiogenesis in ACCs. Next, we analysed the correlation between MVD and stromal
786
H Guan et al.
A
B
C
D
E
ACCs Controls
Cases
Figure 3. Immunohistochemical staining of MMP2. A, No staining in the fibroblasts of a normal controls (arrow). B–D, Positive staining in the stroma of cribriform (B), tubular (C) and solid (D) subtypes of ACC (arrowheads). E, The expression levels of MMP2 in ACCs and normal controls. Scale bar: 20 lm.
0.005
0.010 0.015 0.020 0.025 Expression of MMP2 (IOD)
a-SMA expression in ACCs, but no significant relationship was found (P > 0.05). ACC-DERIVED MYOFIBROBLASTS SHOW INCREASED INVASIVE ABILITY AND HIGH
0.030
0.035
degrade ECM. HFL1 cells were used as a control. It was found that MMP2 showed higher expression in myofibroblasts than in HFL1 cells, whereas no detectable change in MMP9 expression was found in either myofibroblasts or HFL1 cells (Figure 5F).
EXPRESSION OF MMP2
The invasive ability of ACC-derived myofibroblasts was assessed. These cells showed the typical hallmarks of fibroblasts, with cytoplasmic processes on 2D surface culture (Figure 5A). They were negative for pan-cytokeratin, and positive for both VIM and a-SMA (Figure 5B–D). To mimic the in-vivo status, we embedded the myofibroblasts in BME, a substitute for ECM. The myofibroblasts were round during the first day, and changed into a spindle shape after 24 h of culture (data not shown). Over time, the myofibroblasts extended long processes and invaded the adjacent BME (Figure 5E), suggesting that they had the ability to
CXCL12 EXPRESSION IN MYOFIBROBLASTS OF ACC
We tried to determine whether myofibroblasts promote ACC invasion by secreting cytokines. Our results demonstrated that ACC-derived myofibroblasts showed significantly higher expression of CXCL12 than HFL1 cells (Figure 6A,B).
Discussion Adenoid cystic carcinomas are characterized by a high potential for invasion. Until now, surgical © 2014 John Wiley & Sons Ltd, Histopathology, 66, 781–790.
Myofibroblasts promote cancer invasion by expressing MMP2
A
B
C
D
787
E
Cases
ACCs Controls
Figure 4. Immunohistochemical staining of CD34. Microvessels positive for CD34 were found in the stroma of normal controls (A), and the cribriform (B), tubular (C) and solid (D) subtypes of ACC. Scale bar: 20 lm.
0
excision has been the most common choice for ACC treatment, and adjunctive radiation therapy has been shown to slightly improve patient survival in some cases.25 Recent attempts to elucidate tumour behaviour have focused on the stroma, which is considered to be important for tumour growth and invasion.26 In this study, we tried to determine whether the stromal cells contribute to the invasive ability of ACCs. Extracellular matrix, which is composed of collagen, fibrillin, fibronectin, laminin, and proteoglycans, is a barrier against tumour invasion.27 Fibroblasts constitute an important source of ECM renewal, by synthesizing many of these components.28,29 In addition to secreting growth factors that directly affect cell growth and motility, myofibroblasts can secrete ECM-degrading proteases such as MMPs, which allow © 2014 John Wiley & Sons Ltd, Histopathology, 66, 781–790.
10
20 30 40 50 MVD (vessels / 400X field)
60
70
cancer cells to cross tissue boundaries and escape the primary tumour site.30 Biore et al.31 reported that myofibroblast-derived MMP1 stimulated invasion pathways by cleaving protease-activated receptor-1 on the breast cancer cell surface. Hu et al. reported that co-culture of myofibroblasts with human breast ductal carcinoma in situ (DCIS) epithelial cells enhanced their motility and invasion. This change was associated with increased MMP14 expression and MMP9 protease activity.20 MMP3 can cleave the cell surface protein E-cadherin either directly or indirectly by activation or induction of other proteases, and also enhances the conversion of normal mammary epithelial cells to mesenchymal cells and promotes tumour invasion.32 A study of oral squamous cell carcinoma (OSCC) showed that myofibroblasts stimulated invasion of SCC9 cells by increased
788
H Guan et al.
A
B
C
D
E
F 0h
MF
HFL1
MMP2 MMP9 48 h
18S rRNA
72 h
Expressionlevel
2
*
0.1
MF HFL1
1 0.5 0 MMP2
MMP1, MMP2, MMP9 and MMP13 production.33 Upregulation of MMP2 has been reported in human ovarian cancer cells, and is critical for cancer cell adhesion to the mesothelial lining of the peritoneum and omentum.34 Our study demonstrates that ACCderived myofibroblasts with high MMP2 expression show increased invasive ability, suggesting that myofibroblasts in ACCs might degrade ECM by expressing MMP2 to facilitate tumour cell invasion. It is now evident that the proteolytic activity of MMPs can be regulated at different levels, such as gene expression, compartmentalization, conversion from zymogen to active enzyme, and the presence of specific inhibitors.35,36 Therefore, further studies investigating the effects of MMP inhibitors, as well as using
MMP9
Figure 5. Characteristics of myofibroblasts isolated from ACC. A, Myofibroblasts showed the typical appearance of fibroblasts, with long processes on 2D surface culture (brightfield picture). B–D, Myofibroblasts showed negative pan-cytokeratin staining (B), positive labelling for VIM (C), and positive cytoplasmic staining for a-SMA (D). E, Myofibroblasts showed active invasion into the adjacent matrix. F, Myofibroblasts (MF) showed higher expression of MMP2 than HFL1 cells. Scale bar: 50 lm.
other methods, such as western blotting, should be undertaken in an attempt to better understand the role and influence of MMP2 in the behaviour of ACCs. Tumour angiogenesis has been previously demonstrated to occur in many tumours and with high MVD.37,38 Several studies of human breast and prostate carcinomas have shown that myofibroblasts secrete soluble factors, and that chemokines recruit endothelial progenitor cells into carcinomas, enhancing angiogenesis.15,39 However, our results demonstrated that the high MVD in ACCs was not related to the number of myofibroblasts, indicating that the promotion of angiogenesis by myofibroblasts was not significant in ACCs. © 2014 John Wiley & Sons Ltd, Histopathology, 66, 781–790.
MF CXCL12
18SrRNA
HFL1
Relative expression
Myofibroblasts promote cancer invasion by expressing MMP2
*
1.2
789
Acknowledgements
0.8
This work was supported by the National Natural Science Foundation of China (No. 81171425) and the Program for Liaoning Excellent Talents in University (No. LR201013).
0.4 0 MF
HFL1
Figure 6. (A, B), CXCL12 expression in myofibroblasts. CXCL12 showed higher expression in myofibroblasts (MF) than in HFL1 cells by RT-PCR analysis.
Myofibroblasts can interact with cancer cells directly. Interleukin-1a (IL-1a) released from OSCC cells induced myofibroblasts to secret CCL7, which can up-regulate MMP2 expression by OSCC cells to increase invasion.40 Investigation of the interaction between human prostate cancer cells and myofibroblasts identified a circuitry in which cancer cell-produced IL-6 affects fibroblast activation, which in turn causes the secretion of MMP2, enhancing cancer invasion.41 A study of human mammary DCIS showed that paracrine HGF–c-Met signalling between fibroblasts and pre-invasive DCIS cells increased the invasive phenotype of DCIS cells, including their ability to migrate and to degrade type IV collagen.42 A study focusing on the role of stromal-derived chemokines in prostate cancer progression showed that prostate cancer cells express CXCL2, CXCL5, CXCL6 and CXCL12 to promote tumour growth, angiogenesis, and invasion.43 Myofibroblasts overexpressing CXCL14 promoted the growth of prostate cancer xenografts and increased tumour angiogenesis and macrophage infiltration.19 Several studies have shown that CXCL12 signalling potentially regulates ACC invasion and metastasis. Previously, we showed that ACC-derived myofibroblasts induced ACC cell line invasion into a myofibroblast-containing matrix, and that ACC cells show high expression of CXCR4.24,44 In this study, it was demonstrated that CXCL12 is highly expressed in ACC-derived myofibroblasts. We propose that up-regulation of MMP2 in myofibroblasts of ACCs causes degradation of ECM at the invasion front, and that ACC tumour cells then follow the track of myofibroblasts into the surrounding tissue by a CXCL12–CXCR4 signalling pathway. In summary, our results demonstrate that ACCderived myofibroblasts show high invasive ability and express high levels of MMP2. The invasive growth behaviour of ACC might be attributable to the interaction between myofibroblasts and tumour cells. © 2014 John Wiley & Sons Ltd, Histopathology, 66, 781–790.
Author contributions Haijie Guan: reference collection, immunohistochemical staining for MMP2, RT-PCR, and statistical analysis. Jie Tan: immunohistochemical staining for CD34 and a-SMA. Fuyin Zhang: sample collection and student instruction. Lu Gao, Liang Bai and Dongyuan Qi: sample collection and H&E staining. Hui Dong: primary myofiboblast isolation. Lei Zhu: immunohistochemical staining for VIM. Xiaojie Li: myofibroblast invasion assay. Tingjiao Liu: study design, data analysis, and manuscript preparation.
Conflicts of interest The authors have no conflict of interest.
References 1. Brill LB 2nd, Kanner WA, Fehr A et al. Analysis of MYB expression and MYB–NFIB gene fusions in adenoid cystic carcinoma and other salivary neoplasms. Mod. Pathol. 2011; 24; 1169–1176. 2. Barnes L, Eveson JW, Reichart P eds. World Health Organization classification of tumours. Pathology and genetics of head and neck tumours. Lyon: IARC Press, 2005; 221–222. 3. Seifert G, Sobin LH. The World Health Organization’s histological classification of salivary gland tumors: a commentary on the second edition. Cancer 1992; 70; 379–385. 4. Bradley PJ. Adenoid cystic carcinoma of the head and neck: a review. Curr. Opin. Otolaryngol. Head Neck Surg. 2004; 12; 127–132. 5. Bell D, Hanna EY. Head and neck adenoid cystic carcinoma: what is new in biological markers and treatment? Curr. Opin. Otolaryngol. Head Neck Surg. 2013; 21; 124–129. 6. Wetterskog D, Lopez-Garcia MA, Lambros MB et al. Adenoid cystic carcinomas constitute a genomically distinct subgroup of triple-negative and basal-like breast cancers. J. Pathol. 2012; 226; 84–96. 7. Persson M, Andren Y, Mark J, Horlings HM, Persson F, Stenman G. Recurrent fusion of MYB and NFIB transcription factor genes in carcinomas of the breast and head and neck. Proc. Natl Acad. Sci. USA 2009; 106; 18740–18744. 8. Kalluri R, Zeisberg M. Fibroblasts in cancer. Nat. Rev. Cancer 2006; 6; 392–401. 9. Micke P, Ostman A. Tumour–stroma interaction: cancer-associated fibroblasts as novel targets in anti-cancer therapy? Lung Cancer 2004; 45 (Suppl. 2); S163–S175. 10. Gabbiani G. The myofibroblast in wound healing and fibrocontractive diseases. J. Pathol. 2003; 200; 500–503.
790
H Guan et al.
11. Ross R, Everett NB, Tyler R. Wound healing and collagen formation. VI. The origin of the wound fibroblast studied in parabiosis. J. Cell Biol. 1970; 44; 645–654. 12. Ostman A, Augsten M. Cancer-associated fibroblasts and tumor growth—bystanders turning into key players. Curr. Opin. Genet. Dev. 2009; 19; 67–73. 13. Joesting MS, Perrin S, Elenbaas B et al. Identification of SFRP1 as a candidate mediator of stromal-to-epithelial signaling in prostate cancer. Cancer Res. 2005; 65; 10423–10430. 14. Lewis MP, Lygoe KA, Nystrom ML et al. Tumour-derived TGFbeta1 modulates myofibroblast differentiation and promotes HGF/SF-dependent invasion of squamous carcinoma cells. Br. J. Cancer 2004; 90; 822–832. 15. Orimo A, Gupta PB, Sgroi DC et al. Stromal fibroblasts present in invasive human breast carcinomas promote tumor growth and angiogenesis through elevated SDF-1/CXCL12 secretion. Cell 2005; 121; 335–348. 16. Zhu CQ, Popova SN, Brown ER et al. Integrin alpha 11 regulates IGF2 expression in fibroblasts to enhance tumorigenicity of human non-small-cell lung cancer cells. Proc. Natl Acad. Sci. USA 2007; 104; 11754–11759. 17. Taniwaki K, Fukamachi H, Komori K et al. Stroma-derived matrix metalloproteinase (MMP)-2 promotes membrane type 1MMP-dependent tumor growth in mice. Cancer Res. 2007; 67; 4311–4319. 18. Yang F, Tuxhorn JA, Ressler SJ, McAlhany SJ, Dang TD, Rowley DR. Stromal expression of connective tissue growth factor promotes angiogenesis and prostate cancer tumorigenesis. Cancer Res. 2005; 65; 8887–8895. 19. Augsten M, Hagglof C, Olsson E et al. CXCL14 is an autocrine growth factor for fibroblasts and acts as a multi-modal stimulator of prostate tumor growth. Proc. Natl Acad. Sci. USA 2009; 106; 3414–3419. 20. Hu M, Peluffo G, Chen H, Gelman R, Schnitt S, Polyak K. Role of COX-2 in epithelial–stromal cell interactions and progression of ductal carcinoma in situ of the breast. Proc. Natl Acad. Sci. USA 2009; 106; 3372–3377. 21. Wang J, Ying G, Wang J et al. Characterization of phosphoglycerate kinase-1 expression of stromal cells derived from tumor microenvironment in prostate cancer progression. Cancer Res. 2010; 70; 471–480. 22. Grugan KD, Miller CG, Yao Y et al. Fibroblast-secreted hepatocyte growth factor plays a functional role in esophageal squamous cell carcinoma invasion. Proc. Natl Acad. Sci. USA 2010; 107; 11026–11031. 23. Zhang W, Matrisian LM, Holmbeck K, Vick CC, Rosenthal EL. Fibroblast-derived MT1-MMP promotes tumor progression in vitro and in vivo. BMC Cancer 2006; 6; 52. 24. Liu T, Lin B, Qin J. Carcinoma-associated fibroblasts promoted tumor spheroid invasion on a microfluidic 3D co-culture device. Lab Chip 2010; 10; 1671–1677. 25. Jaso J, Malhotra R. Adenoid cystic carcinoma. Arch. Pathol. Lab. Med. 2011; 135; 511–515. 26. Valach J, Fik Z, Strnad H et al. Smooth muscle actin-expressing stromal fibroblasts in head and neck squamous cell carcinoma: increased expression of galectin-1 and induction of poor prognosis factors. Int. J. Cancer 2012; 131; 2499–2508. 27. Ronnov-Jessen L, Petersen OW, Bissell MJ. Cellular changes involved in conversion of normal to malignant breast: importance of the stromal reaction. Physiol. Rev. 1996; 76; 69–125.
28. Rodemann HP, Muller GA. Characterization of human renal fibroblasts in health and disease: II. In vitro growth, differentiation, and collagen synthesis of fibroblasts from kidneys with interstitial fibrosis. Am. J. Kidney Dis. 1991; 17; 684–686. 29. Tomasek JJ, Gabbiani G, Hinz B, Chaponnier C, Brown RA. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat. Rev. Mol. Cell Biol. 2002; 3; 349–363. 30. Wiseman BS, Werb Z. Stromal effects on mammary gland development and breast cancer. Science 2002; 296; 1046–1049. 31. Boire A, Covic L, Agarwal A, Jacques S, Sherifi S, Kuliopulos A. PAR1 is a matrix metalloprotease-1 receptor that promotes invasion and tumorigenesis of breast cancer cells. Cell 2005; 120; 303–313. 32. Lochter A, Galosy S, Muschler J, Freedman N, Werb Z, Bissell MJ. Matrix metalloproteinase stromelysin-1 triggers a cascade of molecular alterations that leads to stable epithelial-to-mesenchymal conversion and a premalignant phenotype in mammary epithelial cells. J. Cell Biol. 1997; 139; 1861–1872. 33. Sobral LM, Bufalino A, Lopes MA, Graner E, Salo T, Coletta RD. Myofibroblasts in the stroma of oral cancer promote tumorigenesis via secretion of activin A. Oral Oncol. 2011; 47; 840–846. 34. Kikuchi R, Noguchi T, Takeno S, Kubo N, Uchida Y. Immunohistochemical detection of membrane-type-1-matrix metalloproteinase in colorectal carcinoma. Br. J. Cancer 2000; 83; 215–218. 35. Kenny HA, Kaur S, Coussens LM, Lengyel E. The initial steps of ovarian cancer cell metastasis are mediated by MMP-2 cleavage of vitronectin and fibronectin. J. Clin. Invest. 2008; 118; 1367–1379. 36. Kessenbrock K, Plaks V, Werb Z. Matrix metalloproteinases: regulators of the tumor microenvironment. Cell 2010; 141; 52–67. 37. Ogawa Y, Chung YS, Nakata B et al. Microvessel quantitation in invasive breast cancer by staining for factor VIII-related antigen. Br. J. Cancer 1995; 71; 1297–1301. 38. Zhang J, Peng B, Chen X. Expressions of nuclear factor kappaB, inducible nitric oxide synthase, and vascular endothelial growth factor in adenoid cystic carcinoma of salivary glands: correlations with the angiogenesis and clinical outcome. Clin. Cancer Res. 2005; 11; 7334–7343. 39. Yang S, Pham LK, Liao CP, Frenkel B, Reddi AH, Roy-Burman P. A novel bone morphogenetic protein signaling in heterotypic cell interactions in prostate cancer. Cancer Res. 2008; 68; 198–205. 40. Jung DW, Che ZM, Kim J et al. Tumor–stromal crosstalk in invasion of oral squamous cell carcinoma: a pivotal role of CCL7. Int. J. Cancer 2010; 127; 332–344. 41. Giannoni E, Bianchini F, Masieri L et al. Reciprocal activation of prostate cancer cells and cancer-associated fibroblasts stimulates epithelial–mesenchymal transition and cancer stemness. Cancer Res. 2010; 70; 6945–6956. 42. Jedeszko C, Victor BC, Podgorski I, Sloane BF. Fibroblast hepatocyte growth factor promotes invasion of human mammary ductal carcinoma in situ. Cancer Res. 2009; 69; 9148–9155. 43. Vindrieux D, Escobar P, Lazennec G. Emerging roles of chemokines in prostate cancer. Endocr. Relat. Cancer 2009; 16; 663–673. 44. Zhang Q, Liu T, Qin J. A microfluidic-based device for study of transendothelial invasion of tumor aggregates in realtime. Lab Chip 2012; 12; 2837–2842.
© 2014 John Wiley & Sons Ltd, Histopathology, 66, 781–790.
Copyright of Histopathology is the property of Wiley-Blackwell and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
