Proc. Natl. Acad. Sci. USA
Vol. 87, pp. 5623-5627, August 1990
Developmental Biology
MyoD binds cooperatively to two sites in a target enhancer sequence: Occupancy of two sites is required for activation (cooperativity/myogenesis/transcription)
HAROLD WEINTRAUB*, ROBERT DAVIS, DANIEL LOCKSHON, AND ANDREW LASSAR Fred Hutchinson Cancer Research Center, 1124 Columbia Street, Seattle, WA 98104
Contributed by Harold Weintraub, April 30, 1990
ABSTRACT MyoD is a master regulatory gene for myogenesis. Its product, the MyoD protein, appears to act by binding to muscle-specific enhancer sequences. We show that MyoD binds cooperatively to two sites in the muscle-specific creatine kinase enhancer; this is dramatically reflected in dissociation-rate measurements. A deletion of the acidic N terminus (residues 3-56) results in a protein that binds normally to single sites but fails to bind cooperatively to two adjacent sites, suggesting a role of the N terminus in cooperative interactions. In tranfection assays, a reporter gene flanked by a single MyoD binding site fails to be activated by cotransfected MyoD expression vectors. In contrast, a reporter with two or more MyoD binding sites is activated by wild-type MyoD but not by N-terminally deleted MyoD. A reporter gene with a single binding site, although not activated by MyoD, can nonetheless compete for expression with a reporter gene containing three sites. Thus, in vivo, a single site can bind MyoD, but occupancy of two or more sites is required for subsequent transcriptional activation.
usually activated as a program. The myogenic switch induced by withdrawal of serum has analogies to the lysis/lysogeny decision in bacteriophage A (12) and the response of hunchback to the bicoid gradient in Drosophila (13), both of which are dependent on cooperative interactions between DNAbinding regulatory factors. Given this, the observation that myoblasts differentiate in an all-or-none way, and the fact that many MyoD-responsive enhancers contain several MyoD binding sites, we decided to test whether MyoD can bind cooperatively to DNA. Here we describe the binding of bacterially produced MyoD to the muscle-specific creatine kinase (MCK) enhancer (2, 14), which contains two MyoD binding sites. We also show that activation of a chloramphenicol acetyltransferase (CAT) reporter gene requires two or more MyoD binding sites and that cooperative interactions in vitro and synergistic activation of two MyoD binding sites in vivo require the N-terminal 50 amino acids. This is an acidic region of MyoD distinct from the DNA-binding and dimerization domains-the basic (5) and helix-loop-helix (HLH; ref. 3) motifs (residues 100-162), respectively. While no function has previously been ascribed to the acidic N terminus of MyoD, it is highly conserved among frogs, mice, and humans and therefore anticipated to be important.
MyoD is a master regulatory gene for myogenesis. Expression of MyoD from a viral long terminal repeat (LTR) activates many muscle-specific genes in a variety of differentiated cell types (1) and the MyoD protein binds to many enhancers for muscle-specific structural genes (e.g., see ref. 2), either as a homooligomer or as a heterooligomer with E2A proteins, ubiquitously expressed DNA-binding proteins (3-5). How MyoD expression is controlled during development is not clear: MyoD transcription occurs only in presumptive skeletal muscle (6-8); in frog embryos expression of MyoD occurs rapidly after primary induction of mesoderm (8); MyoD activates its own transcription (9); somatic cell genetic experiments (10) have shown that in nonmuscle cells a trans-acting factor from a specific chromosome negatively regulates MyoD expression. There are also secondary controls on whether or not expressed MyoD will activate downstream genes for myogenesis. Thus, in many myoblast cell lines, MyoD RNA and protein are present at the same levels when myoblasts are proliferating in high serum or when myoblasts begin to activate the terminal myogenic program after removal of serum (6). Similarly, in frog embryos, MyoD RNA appears well before the appearance of muscle or muscle-specific actin (8). Possibly, the MyoD protein in myoblasts is in a form that can activate myoblast-specific genes (for example, the MyoD gene itself) but not myotube-specific genes (11). When proliferating myoblasts are induced to become muscle by withdrawal of growth factors, individual cells seem to make a decision to withdraw from the cell cycle and to differentiate or to continue to grow and not to differentiate; that is, muscle-specific terminal differentiation genes are
PROCEDURES Binding Assays. Protein-DNA complexes were separated in 1.4% agarose minigels (SeaPlaque low-melting; FMC) containing TBE buffer (50 mM Tris base/50 mM boric acid/1 mM EDTA). Electrophoresis was at 180 V for 30-60 min. Preparation of MyoD-glutathione transferase fusion proteins was described previously (2). The "AN" protein is a fusion protein missing residues 3-56 of wild-type MyoD (6). Protein, diluted from a 0.1-mg/ml stock solution, was added last to a 10-il binding reaction mixture containing 1 ng of 32P-labeled DNA in 20 mM Hepes, pH 7.6/50 mM KCI/1 mM EDTA/3 mM MgCI2/1 mM dithiothreitol/8% (vol/vol) glycerol/0.5% (vol/vol) Nonidet P-40 with poly(dI-dC) at 4 mg/ml. Methylation interference and CAT assays were done as described (2, 5). DNA. The following synthetic double-stranded oligodeoxyribonucleotides were used: R site, 5'-GATCCCCCCAACACCTGCTGCCTGA-3'; L site, 5'-ATTAACCCAGACATGTGGCTGCCCC-3'; R+L site, 5'-AACCCAGACATGTG-
GCTGCCCCCCCCCCCCCAACACCTGCTGCCTGAG-3'. In addition, the above R+L sequence was synthesized with 5 or 10 additional deoxycytidine residues in the oligo(dC) stretch to give the + 1/2 and + 1 derivatives, respectively, and with 5 or 10 fewer deoxycytidines to give the -1/2 and -1 derivatives, respectively. Labeling of these for use in binding assays was done by using T4 kinase and [y-32P]ATP on one Abbreviations: CAT, chloramphenicol acetyltransferase; HLH, helix-loop-helix; LTR, long terminal repeat; MCK, muscle-specific creatine kinase; TK, thymidine kinase. *To whom reprint requests should be addressed.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. 5623
5624
Developmental Biology: Weintraub et al.
strand, followed by annealing with a 2-fold molar excess of the second strand. The restriction fragments used in the binding assays were HindIII-BamHI fragments from plasmids 3300 CPK-CAT, 110 CPK-CAT (R+L sites), AL-110 CPK-CAT (R site), and B3-110 CPK-CAT (L site) and 1100-base-pair (bp) EcoO109IBamHI fragments of AEA and pD12D, kindly provided by J. Buskin and S. Hauschka (14). The fragments were 32P-labeled using T4 kinase after phosphatase treatment. Expression Assays. The plasmid vector pt(18)TKCAT, derived from pTKCAT (a gift from G. Schutz, German Cancer Research Center, Heidelberg), was used as a cloning vehicle for various oligonucleotides; these were cloned into the filled-in Sal I site of the polylinker. The sequence between the flanking vector sequences was determined to be, reading downstream toward the thymidine kinase (TK) promoter, AGCAGGTGTTGGGAG (one R site), GGCAGCAGGTGTTGGGAGGCAGCAGGTGTTGGAG (two R sites),
AGGCAGCAGGTGTTAGGCAGCAGGTGTTAGGCAGCAGGTGTTAG (three R sites), or AGCAGGTGTTGGGAGGCAGCAGGTGTTGGGAGGCAGCAGGTGTTGGGAGGCAGCAGGTGT (four R sites). In addition the R+L site and the + Y2, + 1, - Y2, and -1 oligonucleotides described above were also cloned into the filled-in Sal I site of the vector in both orientations and the sequence was subsequently determined. Transfection assays were done as described (1).
RESULTS Cooperative Binding of MyoD to the MCK Enhancer. MyoD binds to two sites [the "right" (R) and the "left" (L) site] in the muscle MCK enhancer (2, 14). Equilibrium titration with MyoD showed that the R site, the stronger site (2), became
A LR-
Wr ,x1:
0
1
2
3
1
4 5
2
B L
3
4 5
c Of t _
Offw
L
gR
m
eo
Milt R
Off L-R R !"
WT
1kb
g_
FIG. 1. Cooperative binding of MyoD to the two sites in the MCK enhancer. (A) Equilibrium binding. Increasing concentrations of MyoD (100 Ag/ml; 0-5 pl added to a 10-pl reaction mixture) were added to either a wild-type (WT) or an R-site mutant (Mut-R) fragment from the MCK enhancer (1 ng per reaction mixture). After 30 min, samples were electrophoresed. R, gel-shifted complex with predominantly the R site filled; L+R, gel-shifted complex with the L and the R site filled; L, gel-shifted complex with the L site filled. (B and C) Dissociation of MyoD from the MCK enhancer. MyoD (5 Al) was allowed to equilibrate with either the wild-type (Lower) or R-site mutant (Upper) fragment of the MCK enhancer as described above. In C, the same MCK sequence (R+L) was excised as a 1-kilobase (kb) fragment from the cloning vector. Competitor DNA (200 ng of unlabeled R+L fragment) was added and at various times [0, 1, 2,4, 8, 16, and 32 min (lanes left to right) in B; 0, 2, 4, 8, 16, and 32 min in C] samples were loaded directly onto a running agarose gel.
Proc. NatL Acad Sci. USA 87 (1990)
occupied first and then the L site filled (Fig. lA), as assayed previously by methylation protection and interference (2). There was no suggestion of cooperativity between sites since the L site filled, in this equilibrium assay, at the same concentrations of MyoD whether or not the R site was mutated (Fig. 1A). In separate experiments (data not shown), the R site filled identically whether or not the L site was mutated. Cooperative interactions were further studied by assaying the dissociation rate ("off" rate) for MyoD binding. MyoD was bound at relatively high concentration to either the entire MCK enhancer fragment (R+L) or a fragment containing only the L site as a result of a mutation in the R site. After 30 min, an excess of unlabeled enhancer fragment was added and at successive time points, samples were loaded immediately onto agarose gels. The level of competitor was such that in equilibrium studies, it inhibited binding of labeled fragment by 20-fold. Increasing the level by a factor of 10 did not alter the dissociation rate (see below), indicating that the competitor does not actively remove bound MyoD at these concentrations. Within a minute, MyoD dissociated from the L site of a fragment where the R site was unoccupied because of mutation (Fig. 1B Upper). When the L site was mutated, dissociation occurred from the R site within 5 min (data not shown). In contrast, when both sites were simultaneously filled in the wild-type fragment, molecules containing the doubly occupied sites were stable for at least 30 min (Fig. 1B Lower); within the same population, singly filled DNA molecules (at the R site) dissociated within 10 min, although this is likely to be an overestimate since dissociation ofthe doubly occupied site probably involves a singly occupied intermediate. For a 1-kb fragment containing two sites (Fig. 1C), there was also a much slower dissociation from doubly filled sites. Thus, filling both sites stabilizes the binding to the L site by a factor of 30 and the binding to the R site, by a factor of 3 or 4 as compared to the dissociation of MyoD bound to similar fragments containing either a mutated R site or a mutated L site. Since the dissociation-rate studies suggest a physical interaction between MyoD complexes bound at the R and L sites, we conclude that MyoD binds cooperatively to the two sites in the MCK enhancer. To account for the fact that cooperative binding of MyoD was not observed with equilibrium measurements (Fig. LA), we assume that MyoD bound at the R site inhibits the on rate for binding to the L site and that the two effects-decrease in on rate and decrease in off rate-essentially cancel each other. The molecular basis for this presumed interference is not known and, as far as we are aware, such interference is unprecedented; however, it seems to be enhanced by MyoD mutants missing the MyoD N-terminal region (see Fig. 2 and text). Perhaps a single MyoD complex bound at the R site can interact simultaneously with the L site. The R and L sites of the MCK enhancer are normally separated by a string of 13 deoxycytidine residues (14). To investigate whether the spacing between the R and L sites was critical to the cooperativity detected in the off-rate assay, fragments containing the R and L sites separated by an extra ½2 turn or 1 turn of DNA were constructed with 5 or 10 additional dC-dG base pairs; fragments deleted by Y/ or 1 turn were also made. The off rate for all four constructs was not dramatically different, suggesting that cooperativity is not sensitive to helical pitch (data not shown; however, see Fig. 2D below). Presumably, the interacting surfaces of MyoD complexes at the R site and MyoD complexes at the L site are rather flexible. Moreover, cooperativity is also apparent using dimers of the R site, suggesting that neither the poly(dC) stretch nor some unique property of the L site is
required (data not shown).
Developmental Biology: Weintraub et al.
Proc. NatL Acad. Sci. USA 87 (1990)
The N-terminal 50 Residues of MyoD Are Required for
5625
groups are modified. Le Bowitz et al. (15) have made similar observations for cooperative binding of the Oct-2 protein to adjacent octamer (strong) and heptamer (weak) sites, where methylation interference is more dramatic at the heptamer site when the octamer site is deleted. The bacterial MyoD we used for these studies was a fusion protein with glutathione transferase (2, 5); however, cooperative binding of MyoD was probably not a consequence of the glutathione transferase moiety since AN-MyoD, also a fusion protein, failed to show cooperative binding and in recent experiments, a non-fusion MyoD protein made in bacteria also showed cooperative binding that depended on the N terminus. MyoD Activation of MCK in Vivo Requires Multiple Binding Sites. Reporter constructs with one or two R sites linked 30 bp upstream of a herpes virus TK promoter-CAT reporter gene (1R vs. 2R) were cotransfected into C3H/1OTY2 mouse fibroblasts with LTR expression vectors encoding wild-type MyoD, AN-MyoD, or AC-MyoD (Table 1). A significant signal was observed only with the reporter construct containing two R sites. Constructs with three or four R sites were slightly more active (2-fold) than those with 2 R sites (data not shown); orientation of the R sites (i.e., two or three R sites facing toward or away from the promoter) seemed to have little effect on activity or lack of activity (data not shown). MyoD and AC-MyoD gave comparable signals; significantly, the AN-MyoD construct showed low activity, even on reporter constructs with four sites. As with the DNA-binding studies, we also inserted and deleted S or 10 bp between the R and L sites in these CAT reporters and found very little effect on MyoD-dependent expression (data not shown). As a control, the AN-MyoD construct can activate a more complicated reporter where the entire 3.3-kb MCK upstream region and promoter drove the CAT gene (Table 1). ANMyoD can convert C3H/1OTY2 cells to muscle and it forms a tight heterooligomer with E12 that binds specifically to the MCK enhancer (5). Thus, it seems that in the minimal construct with two (or even three or four) R sites driving the CAT gene, AN-MyoD cannot activate in vivo; however, in the more complex case, with the 3.3-kb MCK upstream region, presumably additional MyoD binding sites or, more likely, additional factors [e.g., MEF-2, another musclespecific DNA-binding activity with sites adjacent to the MCK enhancer (16)] stabilize AN-MyoD binding. Interactions with these components would presumably depend upon regions of MyoD other than the N terminus. To determine whether MyoD could actually bind in vivo to a single site, we tested the ability of such a plasmid containing a single R site to compete for CAT expression from a vector
Cooperativity. Previous work showed that bacterial MyoD deleted of either the basic region (residues 102-121) or helix 2 of the HLH region (residues 143-162) failed to bind DNA (2, 5). Mutants with deletions of the acidic N terminus (residues 3-56; AN-MyoD) or the C terminus (residues 167-318; AC-MyoD) bind DNA and also activate myogenesis (2, 5). In a more thorough investigation ofthese mutants, both AN-MyoD and AC-MyoD bound the isolated R and L sites equivalently for both equilibrium (Fig. 2 A and B) and off-rate assays (data not shown), and the AC-MyoD mutant (which migrates much faster as a complex due to the smaller size of AC-MyoD) bound to the R+L fragment like wild-type MyoD (Fig. 2C). In contrast, at these concentrations AN-MyoD (Fig. 2C) filled the L site only marginally in the R+L fragment. Attempts to overcome the failure of AN-MyoD to fill the L site by changing the helical relationship between the R and L sites by 5-bp or 10-bp insertions and deletions were not successful (Fig. 2D). Cooperative binding of MyoD requiring the N terminus is also suggested from methylation interference results (Fig. 3). When MyoD binds to the individual R and L sites (on separate DNA fragments), specific methylation interference and protection patterns were seen (2). Similarly, methylation protection was observed over both the R and the L site in doubly occupied fragments containing both sites (2). In methylation interference experiments using fragments that contained both sites, the typical R-site interference pattern was seen for singly or doubly occupied species with wild-type MyoD, AN-MyoD, and AC-MyoD (Fig. 3, vertical bar R). Surprisingly, for doubly occupied fragments the typical Lsite interference pattern was not seen for MyoD or AC-MyoD (arrows) even though both the R and L sites were occupied as determined by mobility shift, methylation protection, and genetic deletion analysis (2). In contrast, with doubly occupied fragments, using concentrations of AN-MyoD higher than those shown in Fig. 2 (but equivalent to those used for wild-type MyoD and AC-MyoD in these experiments), interference was seen over both the R site and (weakly, but reproducibly) the L site (Fig. 3, arrowheads). We interpret these data to mean that doubly occupied fragments with MyoD or AC-MyoD can occupy methylated L sites because of cooperative interactions with MyoD at occupied R sites; hence, no interference over the L site is seen. With ANMyoD, cooperative interactions are weaker. However, when double occupancy is forced with high levels of AN-MyoD, more of the binding energy depends upon proper contacts of AN-MyoD with specific functional groups in the L site; hence, methylation interference is observed when these
C
A
OIL
0
0
R
&N-mm
R.L
:
R
C f AC_-
R-L
D
B ..
iA~j
AL'"
:
j
II-
L
N *N_
AI
acC--
R-L_
+1/2
0
-1/2
FIG. 2. The N terminus of
MyoD is needed for joint
occu-
pancy of the R and L sites. (A and B) AN-MyoD or AC-MyoD (100
p g/ml; 0, 1, 2, 3, or 4 ,ul) was added to 1 ng of oligonucleotide (25 bp) containing either the R or the L site. (C) AN-MyoD or ACMyoD (0, 1, 2, 3, 4, orS LI) was &1t C' added ifi ito 5 ng of fragment (48 bp) containing both R and L sites. (D)
R and L sites separated by insertions or deletions of 1/2 or 1 turn in successive groups of three lanes were mixed with 3 ,ul of buffer, AN-MyoD, or AC-MyoD. In all cases in D, AN-MyoD gave a single-band shift whereas AC-MyoD -gave a double shift.
5626
Developmental Biology: Weintraub et al. A N
MyoD
AC
R
R R IF R L R F R L R F
R L R F _
- t -9
am
*
T
-'
.
_
a w
amamat
Proc. NatL Acad. Sci. USA 87 (1990) Table 1. Two R sites, but not one, can lead to MyoD-dependent activation
Relative CAT activity Reporter AC-MyoD AN-MyoD MyoD EMSV template 4 0 6 3 1R-CAT 45 3 54 1 2R-CAT 0 95 89 100 MCK-CAT Expression vectors containing one or two R sites linked to pTK-CAT (1R-CAT and 2R-CAT) or containing 3.3 kb of MCK promoter and upstream region linked to CAT (MCK-CAT) were cotransfected into C3H/1OTY2 cells with Moloney murine sarcoma virus LTR enhancer-promoter vectors driving expression of wildtype MyoD, AN-MyoD, or AC-MyoD, or as a control, with the parental expression vector (EMSV). CAT activities have been normalized to those obtained using MyoD to activate MCK-CAT and represent averages from three separate experiments.
containing three binding sites. Fig. 4 shows that the plasmid containing a single R site driving TK-CAT, which itself will not express CAT above background (Table 1), can, nevertheless, inhibit expression from a vector containing three sites; the identical control vector without a MyoD binding site (TK-CAT) does not inhibit. We conclude that in the minimal situation with R sites driving TK-CAT, two or more R sites are needed for MyoD activation and that the N terminus of MyoD is required for the transcription machinery to recognize these multiple occupied sites.
RI DISCUSSION
_
dwm
L
_ am t
,41 am
* So
*-
_y _ __X_ _ gmM-. _ _ _
-_
4
Our results show that, as measured by dissociation rate, MyoD binds cooperatively to the two binding sites in the MCK enhancer; that cooperativity requires (either directly or indirectly) the acidic N-terminal 50 amino acid residues of MyoD; and that, in vivo, even though a single site can be occupied by MyoD, two or more binding sites, as well as the N terminus of MyoD, are required for activation of a minimal muscle-specific reporter gene containing multimerized R sites. Myogenesis requires activation of a large battery of structural genes. How a MyoD-activated switch coordinately turns on all of these genes is unclear. One possibility is that once effective MyoD levels reach a critical threshold (i.e., the switch is activated), MyoD first activates the myogenic genes such as MyoD itself (9), myogenin (17), Myf-S (18), and herculin (19)/Myf-6 (18)/Mrf4 (20), so that very high, effective levels of these myogenic activators are rapidly achieved (i.e., the switch is stabilized). This would initiate, and commit the cell to, a programmed expression of downstream genes. In this model, the role of multiple myogenic activators is to promote high-level expression once the switch is activated,
_wW w.__
_ _ -4400 B i*_~~~~~~Opo .Nw
myoD tk-cat
-
t
1R-cat 3R-cat FIG. 3. Cooperativity revealed by methylation interference. ANMyoD, AC-MyoD, or wild-type MyoD (10 Al) was mixed with methylated fragments (1 ng) containing both the R and the L site. Vertical bars indicate the interference patterns over the R site and over the L site. Shown are the fragments associated with the free (lanes F), singly occupied (lanes R), or doubly occupied (lanes R+L) complexes. Arrowheads indicate methylated guanosine residues that interfere with AN-MyoD binding to L site; methylation of these same residues does not interfere with binding of AC-MyoD or wild-type MyoD (see arrows).
FIG. 4. A single R site can compete in vivo with a vector containing three R sites. The MyoD expression vector (5 ,ug) was cotransfected in duplicate into C3H/10T½/2 cells together with a control TK-CAT vector (25 psg); with a competing vector containing a single R site (lR-CAT, 20.ug) and a reporter containing three R sites (3R-CAT, 5 ,ug); or with a control competing TK-CAT vector (20 ,g) together with a reporter containing three R sites (5 1%g). Cell lysates were incubated with radioactive chloramphenicol and CAT activity was detected by TLC separation of the labeled substrate and its acetylated products.
Developmental Biology: Weintraub et al. which might occur at any of the myogenic determining genes depending on the particular developmental situation. A major distinction (e.g., see ref. 21) is whether the requirement for multiple MyoD binding sites for in vivo expression reflects the need for the activation machinery (or an adaptor) to "touch" more than one MyoD-containing complex simultaneously, or whether "touching" a single complex will do, but extra sites are needed to assure that at least one site remains filled. The two alternatives above might be resolved by overexpressing MyoD and asking whether a reporter with a single R site will respond. Thus far, this type of experiment has shown no activation. Since a plasmid with a single MyoD binding site can specifically compete in transfection assays with the CAT vector containing three R sites, it is likely that MyoD can bind a single site in vivo. Consequently, we favor the notion that activation requires simultaneous recognition of at least two occupied MyoD binding sites. This would be compatible with cooperative binding of MyoD (see also refs. 22-24); otherwise, a single bound MyoD site might activate transcription and the potential regulatory advantages provided by cooperativity would be lost. This is a particularly acute problem with MyoD since its recognition sequence, CANNTG, is expected to be present once every 250 bp. Given that MyoD binds cooperatively to multiple sites, it was surprising that a single site was able to compete so effectively in the transfection experiments (Fig. 4) at such a moderate excess; however, the in vitro equilibrium binding results (Fig. 1) demonstrating marginal effects of cooperativity at equilibrium are consistent with this result. Both of these results might suggest that cooperativity (as measured by the dissociation rate) is not important in vivo. Rather, we propose that expression from a MyoD-driven reporter requires two events in series. The first is equilibrium binding to multiple sites. In this step, vectors with a single site can compete for MyoD binding. The second event is recognition of multiple MyoD complexes by the transcription machinery as discussed above. This seems to require simultaneous occupancy of two or more sites. The demonstration in vitro that the dissociation rate decreases by a factor of 30 when two sites are simultaneously occupied with MyoD complexes suggests the hypothesis that when functional MyoD reaches high enough levels to fill multiple sites, cooperativity keeps these sites jointly occupied for a long enough period of time so they can be jointly recognized by the transcription machinery. We thank Hazel Sive for suggestions and comments. This work
Proc. Natl. Acad. Sci. USA 87 (1990)
5627
was supported by the National Institutes of Health. A.L. was supported by a grant from the Lucille Markey Foundation. 1. Weintraub, H., Tapscott, S. J., Davis, R. L., Thayer, M. J., Adam, M. K., Lassar, A. B. & Miller, A. D. (1989) Proc. Natl. Acad. Sci. USA 86, 5434-5438. 2. Lassar, A. B., Buskin, J. N., Lockshon, D., Davis, R. L., Apone, S., Hauschka, S. D. & Weintraub, H. (1989) Cell 58, 823-831. 3. Murre, C., McCaw, P. S & Baltimore, D. (1989a) Cell 56, 777-783. 4. Murre, C., McCaw, P. S., Vassin, H., Caudy, M., Jan L. Y., Jan, Y. N., Cabrera, C. V., Buskin, J. N., Hauschka, S. D., Lassar, A. B., Weintraub, H. & Baltimore, D. (1989b) Cell 58, 537-544. 5. Davis, R. L., Cheng, P.-F., Lassar, A. B. & Weintraub, H. (1990) Cell 60, 733-746. 6. Davis, R. L., Weintraub, H. & Lassar, A. B. (1987) Cell 51, 987-1000. 7. Sasoon, D., Wright, W., Lin, U., Lassar, A., Weintraub, H. & Buckingham, M. (1989) Nature (London) 341, 303-307. 8. Hopwood, N. D., Pluck, A. & Gurdon, J. B. (1989) EMBO J. 8, 3409-3417. 9. Thayer, M. J., Tapscott, S. J., Davis, R. L., Wright, W. E., Lassar, A. B. & Weintraub, H. (1989) Cell 58, 241-248. 10. Thayer, M. J. & Weintraub, H. (1990) Cell, in press. 11. Benezra, R., Davis, R. L., Lockshon, D., Turner, D. L. & Weintraub, H. (1990) Cell 61, 49-59. 12. Ptashne, M. (1987) A Genetic Switch (Blackwell, Palo Alto, CA). 13. Driever, W. & Nusslein-Volhard, C. (1989) Nature (London) 337, 138-143. 14. Buskin, J. N. & Hauschka, S. D. (1989) Mol. Cell. Biol. 9, 2627-2640. 15. Le Bowitz, J. H., Clarc, R. G., Brenowitz, M. & Sharp, P. (1989) Genes Dev. 3, 1625-1638. 16. Gossett, L., Kelvin, D. J., Sterberg, E. A. & Olson, E. N. (1989) Mol. Cell. Biol. 9, 5022-5033. 17. Wright, W. E., Sasoon, D. A. & Lin, V. K. (1989) Cell 56, 607-617. 18. Braun, T., Buschhausen-Denker, G., Bober, E., Tannich, E. & Arnold, H. H. (1989) EMBO J. 8, 701-709. 19. Miner, J. H. & Wold, B. (1990) Proc. Natl. Acad. Sci. USA 87, 1089-1093. 20. Rhodes, S. J. & Konieczny, S. F. (1989) Genes Dev. 3, 20502061. 21. Giniger, E. & Ptashne, M. (1988) Proc. Natl. Acad. Sci. USA 85, 382-386. 22. Jansen-Durr, P., Boeuf, H. & Kedinger, C. (1989) EMBO J. 8, 3365-3370. 23. Tsai, S. Y., Tsai, M. & O'Malley, B. (1989) Cell 57, 443-448. 24. Schmid, W., Strahle, U., Schfitz, G., Schmitt, J. & Stunnenberg, H. (1989) EMBO J. 8, 2257-2263.
Vol. 87, pp. 5623-5627, August 1990
Developmental Biology
MyoD binds cooperatively to two sites in a target enhancer sequence: Occupancy of two sites is required for activation (cooperativity/myogenesis/transcription)
HAROLD WEINTRAUB*, ROBERT DAVIS, DANIEL LOCKSHON, AND ANDREW LASSAR Fred Hutchinson Cancer Research Center, 1124 Columbia Street, Seattle, WA 98104
Contributed by Harold Weintraub, April 30, 1990
ABSTRACT MyoD is a master regulatory gene for myogenesis. Its product, the MyoD protein, appears to act by binding to muscle-specific enhancer sequences. We show that MyoD binds cooperatively to two sites in the muscle-specific creatine kinase enhancer; this is dramatically reflected in dissociation-rate measurements. A deletion of the acidic N terminus (residues 3-56) results in a protein that binds normally to single sites but fails to bind cooperatively to two adjacent sites, suggesting a role of the N terminus in cooperative interactions. In tranfection assays, a reporter gene flanked by a single MyoD binding site fails to be activated by cotransfected MyoD expression vectors. In contrast, a reporter with two or more MyoD binding sites is activated by wild-type MyoD but not by N-terminally deleted MyoD. A reporter gene with a single binding site, although not activated by MyoD, can nonetheless compete for expression with a reporter gene containing three sites. Thus, in vivo, a single site can bind MyoD, but occupancy of two or more sites is required for subsequent transcriptional activation.
usually activated as a program. The myogenic switch induced by withdrawal of serum has analogies to the lysis/lysogeny decision in bacteriophage A (12) and the response of hunchback to the bicoid gradient in Drosophila (13), both of which are dependent on cooperative interactions between DNAbinding regulatory factors. Given this, the observation that myoblasts differentiate in an all-or-none way, and the fact that many MyoD-responsive enhancers contain several MyoD binding sites, we decided to test whether MyoD can bind cooperatively to DNA. Here we describe the binding of bacterially produced MyoD to the muscle-specific creatine kinase (MCK) enhancer (2, 14), which contains two MyoD binding sites. We also show that activation of a chloramphenicol acetyltransferase (CAT) reporter gene requires two or more MyoD binding sites and that cooperative interactions in vitro and synergistic activation of two MyoD binding sites in vivo require the N-terminal 50 amino acids. This is an acidic region of MyoD distinct from the DNA-binding and dimerization domains-the basic (5) and helix-loop-helix (HLH; ref. 3) motifs (residues 100-162), respectively. While no function has previously been ascribed to the acidic N terminus of MyoD, it is highly conserved among frogs, mice, and humans and therefore anticipated to be important.
MyoD is a master regulatory gene for myogenesis. Expression of MyoD from a viral long terminal repeat (LTR) activates many muscle-specific genes in a variety of differentiated cell types (1) and the MyoD protein binds to many enhancers for muscle-specific structural genes (e.g., see ref. 2), either as a homooligomer or as a heterooligomer with E2A proteins, ubiquitously expressed DNA-binding proteins (3-5). How MyoD expression is controlled during development is not clear: MyoD transcription occurs only in presumptive skeletal muscle (6-8); in frog embryos expression of MyoD occurs rapidly after primary induction of mesoderm (8); MyoD activates its own transcription (9); somatic cell genetic experiments (10) have shown that in nonmuscle cells a trans-acting factor from a specific chromosome negatively regulates MyoD expression. There are also secondary controls on whether or not expressed MyoD will activate downstream genes for myogenesis. Thus, in many myoblast cell lines, MyoD RNA and protein are present at the same levels when myoblasts are proliferating in high serum or when myoblasts begin to activate the terminal myogenic program after removal of serum (6). Similarly, in frog embryos, MyoD RNA appears well before the appearance of muscle or muscle-specific actin (8). Possibly, the MyoD protein in myoblasts is in a form that can activate myoblast-specific genes (for example, the MyoD gene itself) but not myotube-specific genes (11). When proliferating myoblasts are induced to become muscle by withdrawal of growth factors, individual cells seem to make a decision to withdraw from the cell cycle and to differentiate or to continue to grow and not to differentiate; that is, muscle-specific terminal differentiation genes are
PROCEDURES Binding Assays. Protein-DNA complexes were separated in 1.4% agarose minigels (SeaPlaque low-melting; FMC) containing TBE buffer (50 mM Tris base/50 mM boric acid/1 mM EDTA). Electrophoresis was at 180 V for 30-60 min. Preparation of MyoD-glutathione transferase fusion proteins was described previously (2). The "AN" protein is a fusion protein missing residues 3-56 of wild-type MyoD (6). Protein, diluted from a 0.1-mg/ml stock solution, was added last to a 10-il binding reaction mixture containing 1 ng of 32P-labeled DNA in 20 mM Hepes, pH 7.6/50 mM KCI/1 mM EDTA/3 mM MgCI2/1 mM dithiothreitol/8% (vol/vol) glycerol/0.5% (vol/vol) Nonidet P-40 with poly(dI-dC) at 4 mg/ml. Methylation interference and CAT assays were done as described (2, 5). DNA. The following synthetic double-stranded oligodeoxyribonucleotides were used: R site, 5'-GATCCCCCCAACACCTGCTGCCTGA-3'; L site, 5'-ATTAACCCAGACATGTGGCTGCCCC-3'; R+L site, 5'-AACCCAGACATGTG-
GCTGCCCCCCCCCCCCCAACACCTGCTGCCTGAG-3'. In addition, the above R+L sequence was synthesized with 5 or 10 additional deoxycytidine residues in the oligo(dC) stretch to give the + 1/2 and + 1 derivatives, respectively, and with 5 or 10 fewer deoxycytidines to give the -1/2 and -1 derivatives, respectively. Labeling of these for use in binding assays was done by using T4 kinase and [y-32P]ATP on one Abbreviations: CAT, chloramphenicol acetyltransferase; HLH, helix-loop-helix; LTR, long terminal repeat; MCK, muscle-specific creatine kinase; TK, thymidine kinase. *To whom reprint requests should be addressed.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. 5623
5624
Developmental Biology: Weintraub et al.
strand, followed by annealing with a 2-fold molar excess of the second strand. The restriction fragments used in the binding assays were HindIII-BamHI fragments from plasmids 3300 CPK-CAT, 110 CPK-CAT (R+L sites), AL-110 CPK-CAT (R site), and B3-110 CPK-CAT (L site) and 1100-base-pair (bp) EcoO109IBamHI fragments of AEA and pD12D, kindly provided by J. Buskin and S. Hauschka (14). The fragments were 32P-labeled using T4 kinase after phosphatase treatment. Expression Assays. The plasmid vector pt(18)TKCAT, derived from pTKCAT (a gift from G. Schutz, German Cancer Research Center, Heidelberg), was used as a cloning vehicle for various oligonucleotides; these were cloned into the filled-in Sal I site of the polylinker. The sequence between the flanking vector sequences was determined to be, reading downstream toward the thymidine kinase (TK) promoter, AGCAGGTGTTGGGAG (one R site), GGCAGCAGGTGTTGGGAGGCAGCAGGTGTTGGAG (two R sites),
AGGCAGCAGGTGTTAGGCAGCAGGTGTTAGGCAGCAGGTGTTAG (three R sites), or AGCAGGTGTTGGGAGGCAGCAGGTGTTGGGAGGCAGCAGGTGTTGGGAGGCAGCAGGTGT (four R sites). In addition the R+L site and the + Y2, + 1, - Y2, and -1 oligonucleotides described above were also cloned into the filled-in Sal I site of the vector in both orientations and the sequence was subsequently determined. Transfection assays were done as described (1).
RESULTS Cooperative Binding of MyoD to the MCK Enhancer. MyoD binds to two sites [the "right" (R) and the "left" (L) site] in the muscle MCK enhancer (2, 14). Equilibrium titration with MyoD showed that the R site, the stronger site (2), became
A LR-
Wr ,x1:
0
1
2
3
1
4 5
2
B L
3
4 5
c Of t _
Offw
L
gR
m
eo
Milt R
Off L-R R !"
WT
1kb
g_
FIG. 1. Cooperative binding of MyoD to the two sites in the MCK enhancer. (A) Equilibrium binding. Increasing concentrations of MyoD (100 Ag/ml; 0-5 pl added to a 10-pl reaction mixture) were added to either a wild-type (WT) or an R-site mutant (Mut-R) fragment from the MCK enhancer (1 ng per reaction mixture). After 30 min, samples were electrophoresed. R, gel-shifted complex with predominantly the R site filled; L+R, gel-shifted complex with the L and the R site filled; L, gel-shifted complex with the L site filled. (B and C) Dissociation of MyoD from the MCK enhancer. MyoD (5 Al) was allowed to equilibrate with either the wild-type (Lower) or R-site mutant (Upper) fragment of the MCK enhancer as described above. In C, the same MCK sequence (R+L) was excised as a 1-kilobase (kb) fragment from the cloning vector. Competitor DNA (200 ng of unlabeled R+L fragment) was added and at various times [0, 1, 2,4, 8, 16, and 32 min (lanes left to right) in B; 0, 2, 4, 8, 16, and 32 min in C] samples were loaded directly onto a running agarose gel.
Proc. NatL Acad Sci. USA 87 (1990)
occupied first and then the L site filled (Fig. lA), as assayed previously by methylation protection and interference (2). There was no suggestion of cooperativity between sites since the L site filled, in this equilibrium assay, at the same concentrations of MyoD whether or not the R site was mutated (Fig. 1A). In separate experiments (data not shown), the R site filled identically whether or not the L site was mutated. Cooperative interactions were further studied by assaying the dissociation rate ("off" rate) for MyoD binding. MyoD was bound at relatively high concentration to either the entire MCK enhancer fragment (R+L) or a fragment containing only the L site as a result of a mutation in the R site. After 30 min, an excess of unlabeled enhancer fragment was added and at successive time points, samples were loaded immediately onto agarose gels. The level of competitor was such that in equilibrium studies, it inhibited binding of labeled fragment by 20-fold. Increasing the level by a factor of 10 did not alter the dissociation rate (see below), indicating that the competitor does not actively remove bound MyoD at these concentrations. Within a minute, MyoD dissociated from the L site of a fragment where the R site was unoccupied because of mutation (Fig. 1B Upper). When the L site was mutated, dissociation occurred from the R site within 5 min (data not shown). In contrast, when both sites were simultaneously filled in the wild-type fragment, molecules containing the doubly occupied sites were stable for at least 30 min (Fig. 1B Lower); within the same population, singly filled DNA molecules (at the R site) dissociated within 10 min, although this is likely to be an overestimate since dissociation ofthe doubly occupied site probably involves a singly occupied intermediate. For a 1-kb fragment containing two sites (Fig. 1C), there was also a much slower dissociation from doubly filled sites. Thus, filling both sites stabilizes the binding to the L site by a factor of 30 and the binding to the R site, by a factor of 3 or 4 as compared to the dissociation of MyoD bound to similar fragments containing either a mutated R site or a mutated L site. Since the dissociation-rate studies suggest a physical interaction between MyoD complexes bound at the R and L sites, we conclude that MyoD binds cooperatively to the two sites in the MCK enhancer. To account for the fact that cooperative binding of MyoD was not observed with equilibrium measurements (Fig. LA), we assume that MyoD bound at the R site inhibits the on rate for binding to the L site and that the two effects-decrease in on rate and decrease in off rate-essentially cancel each other. The molecular basis for this presumed interference is not known and, as far as we are aware, such interference is unprecedented; however, it seems to be enhanced by MyoD mutants missing the MyoD N-terminal region (see Fig. 2 and text). Perhaps a single MyoD complex bound at the R site can interact simultaneously with the L site. The R and L sites of the MCK enhancer are normally separated by a string of 13 deoxycytidine residues (14). To investigate whether the spacing between the R and L sites was critical to the cooperativity detected in the off-rate assay, fragments containing the R and L sites separated by an extra ½2 turn or 1 turn of DNA were constructed with 5 or 10 additional dC-dG base pairs; fragments deleted by Y/ or 1 turn were also made. The off rate for all four constructs was not dramatically different, suggesting that cooperativity is not sensitive to helical pitch (data not shown; however, see Fig. 2D below). Presumably, the interacting surfaces of MyoD complexes at the R site and MyoD complexes at the L site are rather flexible. Moreover, cooperativity is also apparent using dimers of the R site, suggesting that neither the poly(dC) stretch nor some unique property of the L site is
required (data not shown).
Developmental Biology: Weintraub et al.
Proc. NatL Acad. Sci. USA 87 (1990)
The N-terminal 50 Residues of MyoD Are Required for
5625
groups are modified. Le Bowitz et al. (15) have made similar observations for cooperative binding of the Oct-2 protein to adjacent octamer (strong) and heptamer (weak) sites, where methylation interference is more dramatic at the heptamer site when the octamer site is deleted. The bacterial MyoD we used for these studies was a fusion protein with glutathione transferase (2, 5); however, cooperative binding of MyoD was probably not a consequence of the glutathione transferase moiety since AN-MyoD, also a fusion protein, failed to show cooperative binding and in recent experiments, a non-fusion MyoD protein made in bacteria also showed cooperative binding that depended on the N terminus. MyoD Activation of MCK in Vivo Requires Multiple Binding Sites. Reporter constructs with one or two R sites linked 30 bp upstream of a herpes virus TK promoter-CAT reporter gene (1R vs. 2R) were cotransfected into C3H/1OTY2 mouse fibroblasts with LTR expression vectors encoding wild-type MyoD, AN-MyoD, or AC-MyoD (Table 1). A significant signal was observed only with the reporter construct containing two R sites. Constructs with three or four R sites were slightly more active (2-fold) than those with 2 R sites (data not shown); orientation of the R sites (i.e., two or three R sites facing toward or away from the promoter) seemed to have little effect on activity or lack of activity (data not shown). MyoD and AC-MyoD gave comparable signals; significantly, the AN-MyoD construct showed low activity, even on reporter constructs with four sites. As with the DNA-binding studies, we also inserted and deleted S or 10 bp between the R and L sites in these CAT reporters and found very little effect on MyoD-dependent expression (data not shown). As a control, the AN-MyoD construct can activate a more complicated reporter where the entire 3.3-kb MCK upstream region and promoter drove the CAT gene (Table 1). ANMyoD can convert C3H/1OTY2 cells to muscle and it forms a tight heterooligomer with E12 that binds specifically to the MCK enhancer (5). Thus, it seems that in the minimal construct with two (or even three or four) R sites driving the CAT gene, AN-MyoD cannot activate in vivo; however, in the more complex case, with the 3.3-kb MCK upstream region, presumably additional MyoD binding sites or, more likely, additional factors [e.g., MEF-2, another musclespecific DNA-binding activity with sites adjacent to the MCK enhancer (16)] stabilize AN-MyoD binding. Interactions with these components would presumably depend upon regions of MyoD other than the N terminus. To determine whether MyoD could actually bind in vivo to a single site, we tested the ability of such a plasmid containing a single R site to compete for CAT expression from a vector
Cooperativity. Previous work showed that bacterial MyoD deleted of either the basic region (residues 102-121) or helix 2 of the HLH region (residues 143-162) failed to bind DNA (2, 5). Mutants with deletions of the acidic N terminus (residues 3-56; AN-MyoD) or the C terminus (residues 167-318; AC-MyoD) bind DNA and also activate myogenesis (2, 5). In a more thorough investigation ofthese mutants, both AN-MyoD and AC-MyoD bound the isolated R and L sites equivalently for both equilibrium (Fig. 2 A and B) and off-rate assays (data not shown), and the AC-MyoD mutant (which migrates much faster as a complex due to the smaller size of AC-MyoD) bound to the R+L fragment like wild-type MyoD (Fig. 2C). In contrast, at these concentrations AN-MyoD (Fig. 2C) filled the L site only marginally in the R+L fragment. Attempts to overcome the failure of AN-MyoD to fill the L site by changing the helical relationship between the R and L sites by 5-bp or 10-bp insertions and deletions were not successful (Fig. 2D). Cooperative binding of MyoD requiring the N terminus is also suggested from methylation interference results (Fig. 3). When MyoD binds to the individual R and L sites (on separate DNA fragments), specific methylation interference and protection patterns were seen (2). Similarly, methylation protection was observed over both the R and the L site in doubly occupied fragments containing both sites (2). In methylation interference experiments using fragments that contained both sites, the typical R-site interference pattern was seen for singly or doubly occupied species with wild-type MyoD, AN-MyoD, and AC-MyoD (Fig. 3, vertical bar R). Surprisingly, for doubly occupied fragments the typical Lsite interference pattern was not seen for MyoD or AC-MyoD (arrows) even though both the R and L sites were occupied as determined by mobility shift, methylation protection, and genetic deletion analysis (2). In contrast, with doubly occupied fragments, using concentrations of AN-MyoD higher than those shown in Fig. 2 (but equivalent to those used for wild-type MyoD and AC-MyoD in these experiments), interference was seen over both the R site and (weakly, but reproducibly) the L site (Fig. 3, arrowheads). We interpret these data to mean that doubly occupied fragments with MyoD or AC-MyoD can occupy methylated L sites because of cooperative interactions with MyoD at occupied R sites; hence, no interference over the L site is seen. With ANMyoD, cooperative interactions are weaker. However, when double occupancy is forced with high levels of AN-MyoD, more of the binding energy depends upon proper contacts of AN-MyoD with specific functional groups in the L site; hence, methylation interference is observed when these
C
A
OIL
0
0
R
&N-mm
R.L
:
R
C f AC_-
R-L
D
B ..
iA~j
AL'"
:
j
II-
L
N *N_
AI
acC--
R-L_
+1/2
0
-1/2
FIG. 2. The N terminus of
MyoD is needed for joint
occu-
pancy of the R and L sites. (A and B) AN-MyoD or AC-MyoD (100
p g/ml; 0, 1, 2, 3, or 4 ,ul) was added to 1 ng of oligonucleotide (25 bp) containing either the R or the L site. (C) AN-MyoD or ACMyoD (0, 1, 2, 3, 4, orS LI) was &1t C' added ifi ito 5 ng of fragment (48 bp) containing both R and L sites. (D)
R and L sites separated by insertions or deletions of 1/2 or 1 turn in successive groups of three lanes were mixed with 3 ,ul of buffer, AN-MyoD, or AC-MyoD. In all cases in D, AN-MyoD gave a single-band shift whereas AC-MyoD -gave a double shift.
5626
Developmental Biology: Weintraub et al. A N
MyoD
AC
R
R R IF R L R F R L R F
R L R F _
- t -9
am
*
T
-'
.
_
a w
amamat
Proc. NatL Acad. Sci. USA 87 (1990) Table 1. Two R sites, but not one, can lead to MyoD-dependent activation
Relative CAT activity Reporter AC-MyoD AN-MyoD MyoD EMSV template 4 0 6 3 1R-CAT 45 3 54 1 2R-CAT 0 95 89 100 MCK-CAT Expression vectors containing one or two R sites linked to pTK-CAT (1R-CAT and 2R-CAT) or containing 3.3 kb of MCK promoter and upstream region linked to CAT (MCK-CAT) were cotransfected into C3H/1OTY2 cells with Moloney murine sarcoma virus LTR enhancer-promoter vectors driving expression of wildtype MyoD, AN-MyoD, or AC-MyoD, or as a control, with the parental expression vector (EMSV). CAT activities have been normalized to those obtained using MyoD to activate MCK-CAT and represent averages from three separate experiments.
containing three binding sites. Fig. 4 shows that the plasmid containing a single R site driving TK-CAT, which itself will not express CAT above background (Table 1), can, nevertheless, inhibit expression from a vector containing three sites; the identical control vector without a MyoD binding site (TK-CAT) does not inhibit. We conclude that in the minimal situation with R sites driving TK-CAT, two or more R sites are needed for MyoD activation and that the N terminus of MyoD is required for the transcription machinery to recognize these multiple occupied sites.
RI DISCUSSION
_
dwm
L
_ am t
,41 am
* So
*-
_y _ __X_ _ gmM-. _ _ _
-_
4
Our results show that, as measured by dissociation rate, MyoD binds cooperatively to the two binding sites in the MCK enhancer; that cooperativity requires (either directly or indirectly) the acidic N-terminal 50 amino acid residues of MyoD; and that, in vivo, even though a single site can be occupied by MyoD, two or more binding sites, as well as the N terminus of MyoD, are required for activation of a minimal muscle-specific reporter gene containing multimerized R sites. Myogenesis requires activation of a large battery of structural genes. How a MyoD-activated switch coordinately turns on all of these genes is unclear. One possibility is that once effective MyoD levels reach a critical threshold (i.e., the switch is activated), MyoD first activates the myogenic genes such as MyoD itself (9), myogenin (17), Myf-S (18), and herculin (19)/Myf-6 (18)/Mrf4 (20), so that very high, effective levels of these myogenic activators are rapidly achieved (i.e., the switch is stabilized). This would initiate, and commit the cell to, a programmed expression of downstream genes. In this model, the role of multiple myogenic activators is to promote high-level expression once the switch is activated,
_wW w.__
_ _ -4400 B i*_~~~~~~Opo .Nw
myoD tk-cat
-
t
1R-cat 3R-cat FIG. 3. Cooperativity revealed by methylation interference. ANMyoD, AC-MyoD, or wild-type MyoD (10 Al) was mixed with methylated fragments (1 ng) containing both the R and the L site. Vertical bars indicate the interference patterns over the R site and over the L site. Shown are the fragments associated with the free (lanes F), singly occupied (lanes R), or doubly occupied (lanes R+L) complexes. Arrowheads indicate methylated guanosine residues that interfere with AN-MyoD binding to L site; methylation of these same residues does not interfere with binding of AC-MyoD or wild-type MyoD (see arrows).
FIG. 4. A single R site can compete in vivo with a vector containing three R sites. The MyoD expression vector (5 ,ug) was cotransfected in duplicate into C3H/10T½/2 cells together with a control TK-CAT vector (25 psg); with a competing vector containing a single R site (lR-CAT, 20.ug) and a reporter containing three R sites (3R-CAT, 5 ,ug); or with a control competing TK-CAT vector (20 ,g) together with a reporter containing three R sites (5 1%g). Cell lysates were incubated with radioactive chloramphenicol and CAT activity was detected by TLC separation of the labeled substrate and its acetylated products.
Developmental Biology: Weintraub et al. which might occur at any of the myogenic determining genes depending on the particular developmental situation. A major distinction (e.g., see ref. 21) is whether the requirement for multiple MyoD binding sites for in vivo expression reflects the need for the activation machinery (or an adaptor) to "touch" more than one MyoD-containing complex simultaneously, or whether "touching" a single complex will do, but extra sites are needed to assure that at least one site remains filled. The two alternatives above might be resolved by overexpressing MyoD and asking whether a reporter with a single R site will respond. Thus far, this type of experiment has shown no activation. Since a plasmid with a single MyoD binding site can specifically compete in transfection assays with the CAT vector containing three R sites, it is likely that MyoD can bind a single site in vivo. Consequently, we favor the notion that activation requires simultaneous recognition of at least two occupied MyoD binding sites. This would be compatible with cooperative binding of MyoD (see also refs. 22-24); otherwise, a single bound MyoD site might activate transcription and the potential regulatory advantages provided by cooperativity would be lost. This is a particularly acute problem with MyoD since its recognition sequence, CANNTG, is expected to be present once every 250 bp. Given that MyoD binds cooperatively to multiple sites, it was surprising that a single site was able to compete so effectively in the transfection experiments (Fig. 4) at such a moderate excess; however, the in vitro equilibrium binding results (Fig. 1) demonstrating marginal effects of cooperativity at equilibrium are consistent with this result. Both of these results might suggest that cooperativity (as measured by the dissociation rate) is not important in vivo. Rather, we propose that expression from a MyoD-driven reporter requires two events in series. The first is equilibrium binding to multiple sites. In this step, vectors with a single site can compete for MyoD binding. The second event is recognition of multiple MyoD complexes by the transcription machinery as discussed above. This seems to require simultaneous occupancy of two or more sites. The demonstration in vitro that the dissociation rate decreases by a factor of 30 when two sites are simultaneously occupied with MyoD complexes suggests the hypothesis that when functional MyoD reaches high enough levels to fill multiple sites, cooperativity keeps these sites jointly occupied for a long enough period of time so they can be jointly recognized by the transcription machinery. We thank Hazel Sive for suggestions and comments. This work
Proc. Natl. Acad. Sci. USA 87 (1990)
5627
was supported by the National Institutes of Health. A.L. was supported by a grant from the Lucille Markey Foundation. 1. Weintraub, H., Tapscott, S. J., Davis, R. L., Thayer, M. J., Adam, M. K., Lassar, A. B. & Miller, A. D. (1989) Proc. Natl. Acad. Sci. USA 86, 5434-5438. 2. Lassar, A. B., Buskin, J. N., Lockshon, D., Davis, R. L., Apone, S., Hauschka, S. D. & Weintraub, H. (1989) Cell 58, 823-831. 3. Murre, C., McCaw, P. S & Baltimore, D. (1989a) Cell 56, 777-783. 4. Murre, C., McCaw, P. S., Vassin, H., Caudy, M., Jan L. Y., Jan, Y. N., Cabrera, C. V., Buskin, J. N., Hauschka, S. D., Lassar, A. B., Weintraub, H. & Baltimore, D. (1989b) Cell 58, 537-544. 5. Davis, R. L., Cheng, P.-F., Lassar, A. B. & Weintraub, H. (1990) Cell 60, 733-746. 6. Davis, R. L., Weintraub, H. & Lassar, A. B. (1987) Cell 51, 987-1000. 7. Sasoon, D., Wright, W., Lin, U., Lassar, A., Weintraub, H. & Buckingham, M. (1989) Nature (London) 341, 303-307. 8. Hopwood, N. D., Pluck, A. & Gurdon, J. B. (1989) EMBO J. 8, 3409-3417. 9. Thayer, M. J., Tapscott, S. J., Davis, R. L., Wright, W. E., Lassar, A. B. & Weintraub, H. (1989) Cell 58, 241-248. 10. Thayer, M. J. & Weintraub, H. (1990) Cell, in press. 11. Benezra, R., Davis, R. L., Lockshon, D., Turner, D. L. & Weintraub, H. (1990) Cell 61, 49-59. 12. Ptashne, M. (1987) A Genetic Switch (Blackwell, Palo Alto, CA). 13. Driever, W. & Nusslein-Volhard, C. (1989) Nature (London) 337, 138-143. 14. Buskin, J. N. & Hauschka, S. D. (1989) Mol. Cell. Biol. 9, 2627-2640. 15. Le Bowitz, J. H., Clarc, R. G., Brenowitz, M. & Sharp, P. (1989) Genes Dev. 3, 1625-1638. 16. Gossett, L., Kelvin, D. J., Sterberg, E. A. & Olson, E. N. (1989) Mol. Cell. Biol. 9, 5022-5033. 17. Wright, W. E., Sasoon, D. A. & Lin, V. K. (1989) Cell 56, 607-617. 18. Braun, T., Buschhausen-Denker, G., Bober, E., Tannich, E. & Arnold, H. H. (1989) EMBO J. 8, 701-709. 19. Miner, J. H. & Wold, B. (1990) Proc. Natl. Acad. Sci. USA 87, 1089-1093. 20. Rhodes, S. J. & Konieczny, S. F. (1989) Genes Dev. 3, 20502061. 21. Giniger, E. & Ptashne, M. (1988) Proc. Natl. Acad. Sci. USA 85, 382-386. 22. Jansen-Durr, P., Boeuf, H. & Kedinger, C. (1989) EMBO J. 8, 3365-3370. 23. Tsai, S. Y., Tsai, M. & O'Malley, B. (1989) Cell 57, 443-448. 24. Schmid, W., Strahle, U., Schfitz, G., Schmitt, J. & Stunnenberg, H. (1989) EMBO J. 8, 2257-2263.
