Curr Microbiol (2014) 68:428–439 DOI 10.1007/s00284-013-0493-4

Mycobacterium avium Complex in Day Care Hot Water Systems, and Persistence of Live Cells and DNA in Hot Water Pipes Annette S. Bukh • Peter Roslev

Received: 11 September 2013 / Accepted: 24 September 2013 / Published online: 23 November 2013 Ó Springer Science+Business Media New York 2013

Abstract The Mycobacterium avium complex (MAC) is a group of opportunistic human pathogens that may thrive in engineered water systems. MAC has been shown to occur in drinking water supplies based on surface water, but less is known about the occurrence and persistence of live cells and DNA in public hot water systems based on groundwater. In this study, we examined the occurrence of MAC in hot water systems of public day care centers and determined the persistence of live and dead M. avium cells and naked DNA in model systems with the modern plumbing material cross-linked polyethylene (PEX). The occurrence of MAC and co-occurrence of Legionella spp. and Legionella pneumophila were determined using cultivation and qPCR. Co-occurrences of MAC and Legionella were detected in water and/or biofilms in all hot water systems at temperatures between 40 and 54 °C. Moderate correlations were observed between abundance of culturable MAC and that of MAC genome copies, and between MAC and total eubacterial genome copies. No quantitative relationship was observed between occurrence of Legionella and that of MAC. Persistence in hot water of live and dead M. avium cells and naked DNA was studied using PEX laboratory model systems at 44 °C. Naked DNA and DNA in dead M. avium cells persisted for weeks. Live M. avium increased tenfold in water and biofilms on PEX. The results suggest that water and biofilms in groundwaterbased hot water systems can constitute reservoirs of MAC, and that amplifiable naked DNA is relatively short-lived,

A. S. Bukh  P. Roslev (&) Section of Biology and Environmental Science, Department of Biotechnology, Chemistry and Environmental Engineering, Aalborg University, Sohngaardsholmsvej 57, 9000 Alborg, Denmark e-mail: [email protected]

123

whereas PEX plumbing material supports persistence and proliferation of M. avium.

Introduction Nontuberculous mycobacteria (NTM) including the Mycobacterium avium complex (MAC) represent a group of opportunistic human pathogens of potential public health concern [12, 33, 41, 46]. MAC can cause nontuberculous infections in humans and animals, and MAC infections have been associated with disseminated infections in HIV/AIDS patients, other immunodepressed patients, and the elderly [12, 15, 16, 18, 33, 46]. In recent years, increasing attention has been given to the prevalence of NTM disease, and a trend toward increasing MAC infections has been reported [6, 12, 22, 30, 39, 46, 49]. MAC is naturally found not only in freshwaters and humid environments but also in engineered water systems [1, 11, 12, 14, 19, 25, 33–35, 41, 44–46]. Transmission of MAC is likely to occur from the environment to mammals through inhalation of aerosols, and through ingestion of contaminated soil and water. In domestic systems, MAC has been detected in association with household plumbing in several countries [13, 14, 27, 34]. In some studies, bathrooms colonized with MAC were suggested as sources of infection as identical or related PFGE profiles were detected in patients and in their bathrooms [13, 27, 34]. Further studies have confirmed that MAC can form a biofilm on materials used in engineered water systems including copper, iron, steel, polycarbonate, polyethylene terephthalate, polyvinyl chloride, and cement [31, 38, 45, 47]. MAC has been associated with domestic water systems including potable hot water distribution systems [12, 14, 28, 34, 46]. In some countries, the source of water in

A. S. Bukh, P. Roslev: DNA in Hot Water Pipes

429

domestic hot water systems is groundwater used without disinfection (no UV or chlorination). Groundwater is simply subjected to aeration and sand filtration at public water works, but not disinfected prior to distribution because a sufficient microbial water quality is assumed. The nondisinfected potable water is subsequently heated in private and public buildings using domestic heat exchangers or hot water tanks, and circulated through water pipes mainly comprising galvanized or stainless steel and more recently cross-linked polyethylene (PEX). These hot water systems are often characterized by fluctuations in flow, residence times, persistence of dead ends, and water temperature. Although it is often recommended that the water temperature is at least 60 °C in hot water tanks or heat exchangers, the temperature is frequently 50 °C or less at distal sites in modern buildings. Interestingly, MAC can apparently survive at temperatures [50 °C [12, 13], so it is possible that MAC strains are present in hot water systems not previously considered reservoirs. Despite an obvious risk of MAC occurrence, relatively little is known about the presence of MAC in hot water systems in many European countries including the potential effect of modern plumbing materials such as PEX. In this study, we examined the occurrence of MAC in water and biofilm samples from hot water systems at nine public day care centers in Denmark using cultivationdependent and cultivation-independent methods (quantitative real-time PCR). The co-occurrence of Legionella spp. and Legionella pneumophila was also determined. We chose public day care centers because the occurrence of these opportunistic pathogens may serve as a source of infection in exposed children. Subsequently, we evaluated the persistence of MAC in water and biofilms in hot water PEX model systems. PEX was chosen to mimic conditions in modern buildings including some of the day care centers. Persistence studies not only included live and dead MAC but also naked MAC DNA to provide insights regarding cell survival and DNA persistence in hot water. The latter has implications not only for understanding the fate and persistence of MAC but also for interpreting qPCR methods targeting MAC DNA in engineered water systems.

of M. avium provided by Vibeke Thomsen, Statens Serum Institute (SSI), Copenhagen, Denmark; and L. pneumophila NCTC 12821 from the Health Protection Agency Culture Collection (HPACC; Salisbury, UK) provided by Søren Uldum, SSI, Denmark. Routine growth M. avium was carried at 37 °C on Middlebrook 7H9 Agar with BBL Middlebrook OADC Enrichment (BD, NJ, USA). Mycobacterium avium for spiking into microcosms was grown for 96 h at 37 °C on an orbital shaker in Middlebrook 7H9 Broth with Middlebrook OADC Enrichment (BD, NJ, USA). Legionella pneumophila was grown on Buffered Charcoal Yeast Extract (BCYE) Agar Base with Legionella supplement (SigmaAldrich, Steinheim, Germany).

Materials and Methods

Culturable Bacteria in Water and Biofilms

Bacterial Strains and Growth Conditions

Enumeration of the total number of culturable heterotrophic microorganisms (heterotrophic plate count, HPC) in hot water and biofilms was based on the pour plate method using plate count agar without glucose [17, 37]. Samples were incubated for 68 ± 4 h at 22 °C. Mycobacterium spp. in water and biofilm samples were cultivated on Middlebrook 7H10 Agar with BBL Middlebrook OADC

Two reference strains and one clinical isolate were included in this study: M. avium DSM 44156 from the German Collection of Microorganisms and Cell Cultures (DSMZ; Braunschweig, Germany) provided by Tine Wolff, Danish Technological Institute, Aarhus, Denmark; a clinical isolate

Sampling of Hot Water and Biofilms Water and biofilm samples were collected from showers or taps from washrooms at nine public day care centers located in Aalborg Municipality, Denmark. The public day care centers care for children between the ages of three and six, and all institutions receive water from public waterworks (exclusively groundwater based). Water samples were collected in 10-l sterile polypropylene bottles as 5-l pre- and post-flush water samples. Pre-flush samples were collected immediately after the tap was opened, whereas post-flush samples were collected after flushing for 3 min. Biofilm samples were taken post-flushing with sterile cotton wool swabs from brass surfaces in faucets and showerheads, and PVC surfaces in showerhead tubes. The swabs were transported in 2 ml of sterile Page’s Amoeba Saline (PAS) solution at ambient temperature (*20 °C). All samples were processed within 2 h of collection. Biofilms from the swabs were detached by three cycles of vortex and sonication in a total volume of 5 ml of PAS solution containing 0.05 % (v/v) of Tween-80. Water and biofilm samples for cultivation assays were filtered through 0.45lm mixed cellulose ester filters (47 mm; Advantec MFS, Inc., Tokyo, Japan). Two 1-l water samples for DNA extraction were filtered through 0.45-lm nylon filters (47 mm; MontaMil, Frisenette, Knebel, Denmark). Nylon filters and two aliquots of 0.5 ml biofilm eluate were transferred into 2-ml sterile bead beating tubes and stored at -80 °C until DNA extraction (see below).

123

430

Enrichment for 21 days at 37 °C [37]. Decontamination of samples was performed by heat treatment (50 °C for 30 min). Legionella spp. in water and biofilm samples were cultivated for seven days at 37 °C on BCYE Agar Base with Legionella supplement. Decontamination of samples was performed with heat treatment (50 °C for 30 min) [10, 37]. DNA Extraction from Hot Water and Biofilms 500–750 ll of extraction buffer (50 mM of NaCl, 50 mM of Tris–HCl (pH 7.6), 50 mM of EDTA, and 5 % (w/v) of SDS; pH 8.0) including glass beads (0.1 mm; Bertin Technologies, Montigny, France) and 1 ll of 1 M DTT was added to each tube, and the tubes were vortexed horizontally (Vortex Genie 2; MOBIO Laboratories, Inc., Carlsbad, CA, USA) at maximum speed for 10 min. Subsequently, samples were centrifuged for 3 min at 13,6009g, filters were removed, and the supernatants were transferred to 2-ml Phase Lock Gel Tubes (Heavy; 5 PRIME, Hamburg, Germany). DNA was extracted using 400 ll of phenol:chloroform:isoamyl alcohol 25:24:1, saturated with 10 mM of Tris–HCl (pH 8.0) and 1 mM of EDTA (PCI; Sigma) followed by a second extraction using 350 ll of PCI. DNA was precipitated at -20 °C for at least 1 h in the presence of 0.1 volume of 3 M of sodium acetate and 0.7 volume of isopropanol followed by centrifugation at 13,6009g for 30 min. Subsequently, pellets were washed using 0.5 ml of ice-cold 70 % ethanol. After removal of ethanol, the pellets were resuspended in 50 ll of TE buffer (10 mM of Tris–HCl and 1 mM of EDTA; pH 8.0), and DNA was dissolved overnight at 4 °C. If necessary, templates were re-extracted using a NucleoSpin Soil kit (Macherey–Nagel, Du¨ren, Germany) according to the manufacturer’s protocol. qPCR Quantitative real-time PCR (qPCR) assays used in this study were based on previously described primers (Table 1). BLAST analyses were performed to confirm in silico specificity. Each qPCR assay was optimized regarding Mg2? concentration, primer concentration, and annealing temperature (Table 1). qPCRs were carried out using an Mx3000PTM Quantitative PCR system (Stratagene, Agilent Technologies, La Jolla, CA, USA). The 20 ll reaction mixtures contained 10 ll of BrilliantÒ II SYBR QPCR Low ROX Master Mix (Stratagene), forward and reverse primers (Table 1), a final concentration of 2.5 mM of MgCl2, and 4 ll of template. The PCR conditions are given in Table 1. After amplification, a melting profile analysis was done from 55 to 95 °C. Standard curves were prepared using serial dilutions of L. pneumophila NCTC 12821 and clinical M. avium genomic DNA in nuclease-free water (Sigma).

123

A. S. Bukh, P. Roslev: DNA in Hot Water Pipes

The DNA stock concentrations were measured using a Quant-iT PicoGreen dsDNA kit (Invitrogen, Ltd., Paisley, UK). A standard curve for each qPCR assay was generated using Stratagene Mx3000P software, and a lower limit of quantification (LLOQ) was determined for each assay. Intraassay precision (expressed as coefficient of variation, CV %) was calculated from standard deviations of genome copy numbers obtained from three replicates of different template concentrations run simultaneously. CV % for inter-assay precision was calculated from standard deviations of genome copy numbers obtained from three replicates of one template concentration on three different days. Prior to PCR amplification of environmental samples, the templates were tested for PCR inhibitors by spiking dilutions of templates with a known amount of E. coli DNA. The dilution factor to overcome inhibition was determined from the samples where the known concentration of E. coli could be recovered. No CT values were obtained for negative extraction controls and no template controls. Confirmation of Presumptive Legionella spp. Three colonies from five different BCYE agar plates were picked. DNA from each colony was extracted as described above. PCR was used to confirm presumptive Legionella spp. The reaction mixtures contained 19 DreamTaq buffer (Fermentas, St. Leon-Rot, Germany), 200 lM of each dNTP, forward and reverse primers (Table 1), 2.5 mM of MgCl2, 1.5 U of DreamTaq polymerase (Fermentas), and 1 ll of template DNA in a total volume of 20 ll. Cycling conditions for amplification were initial denaturation at 95 °C for 5 min followed by 35 cycles of denaturation at 95 °C for 30 s, annealing for 45 s at 58 °C, extension for 30 s at 72 °C, and a final extension at 72 °C for 6 min. Amplification products were visualized by gel electrophoresis in 2 % (w/v) agarose gels containing 0.5 lg ml-1 of ethidium bromide. Phenotypes tested positive by PCR were enumerated. Cloning and Sequencing qPCR products obtained with the MAC and Legionella spp. primer sets (Table 1) from water and biofilm samples from the day care centers were cloned into StrataClone PCR Cloning Vector pSC-A-amp/kan according to the manufacturer’s instructions (Stratagene) in order to determine the primer specificity. Clones were selected and grown in 3 ml of Luria broth containing 0.1 mg ml-1 of ampicillin at 37 °C and 150 rpm. Plasmids were harvested using a NucleoSpin Plasmid kit (Macherey–Nagel, Du¨ren, Germany). Plasmids were digested using EcoRI (Fermentas) for 1 h at 37 °C, and insert-containing clones were identified by restriction fragment length polymorphism. Insert-

A. S. Bukh, P. Roslev: DNA in Hot Water Pipes

431

Table 1 Primers and PCR conditions for qPCR assays Target

Primer sequence (50 ?30 )

FPC (nM)

PCR conditions

MAC

F: AGAGTTTGATCCTGGCTCAG

400

10 min-95 °C

16S rDNA

R: ACCAGAAGACATGCGTCTTG

200

F: GAGGGTTGATAGGTTAAGAGC

200

10 min-95 °C

R: GGTCAACTTATCGCGTTTGCT

400

359 (30 s-95 °C, 60 s-58 °C, 60 s-72 °C, 10 s-81 °Ca)

[14]

433

L. pneumophila

F: GCAATGTCAACAGCAA

400

10 min-95 °C

mip gene

R: CATAGCGTCTTGCATG

300

359 (30 s-95 °C, 60 s-58 °Ca)

Eubacteria

F: TCCTACGGGAGGCAGCAGT

400

10 min-95 °C

300

192

359 (30 s-95 °C, 60 s-60 °C )

Legionella spp.

R: GGACTACCAGGGTATCTAATCCTGTT

Reference

a

16S rDNA

16S rDNA

Product (bp)

[29] [8]

159

[48]

466

[32]

a

359 (30 s-95 °C, 60 s-60 °C , 60 s-72 °C)

FPC final primer concentration, F forward primer, and R reverse primer a

Data used for quantification

containing clones were sequenced commercially by Macrogen Inc. (Seoul, South Korea). Sequences were blasted against known sequences in GenBank. Persistence of M. avium in Hot Water Customized sterile PEX tubes (volume: 133 ml; diameter: 3.25 cm) were used as microcosms. PEX material was chosen due to its wide application in domestic hot water systems in both European countries and in the USA (The Plastic Pipe and Fittings Association: www.ppfahome.org/ pex/faqpex.html). Three different combinations of hot water and M. avium were evaluated: (A) hot water inoculated with live M. avium DSM 44156 cells corresponding to a final concentration of *5 log10 cells ml-1; (B) hot water inoculated with DNA extracted from M. avium DSM 44156 corresponding to a final concentration of *5 log10 genome copies ml-1; and (C) hot water inoculated with dead M. avium DSM 44156 cells corresponding to a final concentration of *5 log10 cells ml-1. Furthermore, microcosms with filter-sterilized hot water (0.22 lm) were included to examine effects of the background flora including protozoa on MAC persistence in microcosms containing live cells and naked DNA (D and E). Hence, duplicate microcosms (A-C) contained 100 ml of hot water (initial temperature of 47 °C), whereas microcosms (D and E) contained 100 ml of filter-sterilized hot water. The water used in the microcosms was collected at a hot water tap in our laboratory building at Aalborg University. The hot water in the building consisted of municipal drinking water heated to 49 °C in a conventional central hot water tank, and then distributed to a series of distal hot water taps. The hot water used in experiments did not contain detectable concentrations of MAC as evaluated by qPCR using 1-l samples.

Mycobacterium avium DSM 44156 for spiking into microcosms was washed twice in sterile buffered peptone water and resuspended in 35 ml of peptone water. From the same batch, three fractions were derived for spiking into microcosms: (i) 10 ml of live cells, (ii) 10 ml of cell suspension pasteurized at 70 °C for 30 min, and (iii) 10 ml of cell suspension used for extraction of DNA using a NucleoSpin Soil kit (Macherey–Nagel). DNA integrity was confirmed in 0.8 % (w/v) agarose gel containing 0.5 mg ml-1 of ethidium bromide, and the efficiency of the pasteurization was confirmed by incubation on Middlebrook 7H10 agar with BBL Middlebrook OADC Enrichment for 21 days at 37 °C. All microcosms were incubated on an orbital shaker for 28 days at 44 °C. This temperature was selected as it was the average temperature measured in hot water systems at the investigated day care centers (see above). Sampling of water and biofilms from all PEX microcosms was conducted at days 0, 1, 3, 7, 14, 21, and 28. At each sampling, the total number of culturable microorganisms (HPC) and the genome copy number of M. avium (qPCR) were determined in the planktonic and sessile phases (water and biofilm, respectively) as described above. In addition, the abundance of live M. avium cells was determined on Middlebrook 7H10 agar with BBL Middlebrook OADC Enrichment as described above. Data Analysis Quantification of targets based on qPCR was expressed as genome copies. The average rRNA operon copy number in Legionella spp. genomes was determined to be 3.5 [7, 23], and mip is a single copy gene. Only a single rRNA operon is found in MAC species. The rRNA operon copy numbers in prokaryotes vary from 1 to 15 copies per species [20], and based on all bacterial species available in the

123

432

A. S. Bukh, P. Roslev: DNA in Hot Water Pipes 2

2

y=29.50-2.997log(x); R =0.995; E=115.6%

y=28.18-3.248log(x); R =0.996; E=102.2%

B

35

30

30

25

25

C (dRn)

20 15

T

T

C (dRn)

A

35

20 15

10

10

5

5

0 -2 10

10

0

10

2

10

4

10

6

10

0 -2 10

8

10

0

Initial genome copies 2

30

25

25

20

T

15

5

5 10

4

10

10

8

15 10

2

6

20

10

10

10

35

30

0

4

2

D

10

10

y=29.69-3.286log(x); R =0.993; E=101.5%

C (dRn)

T

C (dRn)

35

0 -2 10

2

Initial genome copies

y=34.02-3.372log(x); R =0.992; E=98.0%

C

10

6

10

8

Initial genome copies

0 -2 10

10

0

10

2

10

4

10

6

10

8

Initial genome copies

Fig. 1 Sensitivity of the qPCR assays for quantification of MAC (a), Legionella spp. (b), L. pneumophila (c), and eubacteria (d) (data represent mean genome copies ± SE). CT: cycle threshold

Ribosomal RNA Operon Copy Number Database [20], an average rRNA operon copy number of 4 was used to calculate bacterial genome copies. Statistical comparisons of the persistence of M. avium were determined using Student’s t test, and P \ 0.05 was considered statistically significant. Statistical tests were carried out using SPSS Statistics 17.0 (SPSS Inc, Chicago, IL, USA).

Results qPCR Assays The linear dynamic range of standard curves from the qPCR assays extended at least 5 log10 concentrations (Fig. 1). From the standard curves, LLOQs were determined for each assay as the lowest concentration within the

123

linear range at which three of three samples were tested positive. LLOQ for MAC was determined as 5 genome copies per reaction (Fig. 1a), 3 genome copies per reaction for Legionella spp. (Fig. 1b), 10 genome copies per reaction for L. pneumophila (Fig. 1c), and 2 genome copies per reaction for eubacteria (Fig. 1d). Primer specificity was determined by sequencing. Using BLAST, the primers targeting a part of the 16S rRNA gene in Legionella showed 100 % sequence identity to Legionella spp., and the primers targeting MAC showed 100 % sequence identity to MAC strains. Intra- and inter-assay precision was determined for each qPCR assay. For low initial concentrations of template, the intra-assay precision determined for each assay was good (B10.5 %), but the inter-assay precision was relatively high (up to 22.7 %). Overall, the performance of the qPCR assays was considered satisfactory [4].

A. S. Bukh, P. Roslev: DNA in Hot Water Pipes

433

Microbial Water Quality at Nine Danish Day Care Centers The maximum temperatures of the hot water at the public day care centers ranged from 40 to 54 °C with a mean value of 43.9 °C. Presumptive mycobacteria and Legionella spp. were detected by cultivation in water and/or biofilms at all of the nine day care centers (Table 2). Five day care centers showed presumptive mycobacteria in both pre- and postflush water and biofilms, and MAC was subsequently

detected in four systems by qPCR. At two sites, culturable Legionella spp. were not detected in water or biofilms using cultivation, but qPCR detected Legionella spp. in pre-flush and/or post-flush water samples. Using qPCR, low to moderate abundance of MAC was detected in water (1.81–4.15 log10 genome copies l-1) and/or biofilm (2.76–3.49 log10 genome copies cm-2) samples from all nine hot water systems (Table 2). Low to moderate abundance of L. pneumophila was detected in four of the nine systems tested in preand post-flush water samples (1.96–3.18 log10 genome

Table 2 Abundance of total microorganisms, Legionella, and mycobacteria determined by cultivation and qPCR in pre- and post-flush hot water and biofilm samples collected from hot water systems at nine day

care centers. The mean log10 abundance obtained using cultivationbased methods and qPCR is given (geometric mean ± SD). The range of abundance is given in parenthesis

Abundance Pre-flush

Post-flush

Biofilm

5.61 ± 1.77

Cultivation (log10 CFU l-1 or cm-2) HPC Legionella spp. Presumptive mycobacteria qPCR (log10 genome copies l Eubacteria

-1

5.85 ± 0.89

5.18 ± 0.84

(4.70–7.13)

(4.60–6.56)

(2.18–7.71)

4.47 ± 2.16

4.03 ± 2.55

1.42 ± 0.34

(3.70–6.12)

(3.70–6.43)

(0.51–1.72)

4.07 ± 1.28

4.12 ± 0.64

1.64 ± 0.99

(2.40–6.10)

(3.01–5.10)

(0.51–3.55) 5.94 ± 0.82

-2

or cm ) 5.93 ± 1.41

5.71 ± 0.84

(4.86–8.86)

(4.11–6.67)

(4.96–7.41)

Legionella spp.

4.09 ± 0.94

3.46 ± 0.28

4.49 ± 0.39

L. pneumophila

(3.35–5.82) 2.84 ± 0.05

(2.97–3.81) 2.63 ± 0.15

(4.16–5.23) 3.34 ± 0.11

(2.49–3.18)

(1.96–3.11)

(3.26–3.41)

MAC

2.45 ± 0.95

2.47 ± 0.77

3.08 ± 0.26

(1.86–4.15)

(1.81–3.70)

(2.76–3.49)

Table 3 Eubacteria, Legionella spp., and MAC in biofilms on brass surfaces in faucets and showerheads and on PVC surfaces in showerhead tubes measured using qPCR (log10 mean and range) Genome copies (log10 cm-2) Faucets (n = 4)

Eubacteria

6.13 ± 5.86 (5.03–6.46)

(brass surface)

Legionella spp.

4.49 ± 3.78 (4.39–4.56)

L. pneumophila

ND

MAC

3.09 ± 2.82 (2.76–3.28)

Showerheads (n = 2)

Eubacteria

5.06 ± 4.37 (4.96–5.14)

(brass surface)

Legionella spp.

ND

L. pneumophila

ND

MAC

3.48

Showerhead tubes (n = 5)

Eubacteria

6.78 ± 6.70 (5.13–7.43)

(PVC surface)

Legionella spp.

4.75 ± 4.58 (4.16–5.23)

L. pneumophila MAC

3.34 ± 0.11 (3.26–3.41) 2.99 ± 2.04 (2.88–3.04)

ND none detected

123

434

A. S. Bukh, P. Roslev: DNA in Hot Water Pipes

Genome copies (S-HW) CFU (S-HW) Genome copies (HW) CFU (HW)

10

6

10

5

10

4

10

3

10

2

0

5

10

15

20

25

DNA (S-HW) DNA (HW) Dead cells (HW)

B M. avium genome copies in water (per ml)

Live M. avium cells in water (per ml)

A

30

10

6

10

5

10

4

10

3

10

2

10

1

10

0

0

5

10

Time [d] Genome copies (S-HW) CFU (S-HW) Genome copies (HW) CFU (HW)

10

6

10

5

10

4

10

3

10

2

10

1

10

0

0

5

10

15

20

25

30

20

25

25

30

DNA (S-HW) DNA (HW) Dead (HW)

D

30

Time [d]

M. avium genome copies in biofilm (per cm 2)

Live M. avium cells in biofilm (per cm2)

C

15

Time [d]

10

6

10

5

10

4

10

3

10

2

10

1

10

0

0

5

10

15

20

Time [d]

Fig. 2 Persistence of M. avium DSM 44156 in water and biofilms in PEX microcosms containing either filter-sterilized hot tap water (S-HW) or hot tap water (HW) inoculated with live M. avium cells (a, c), DNA, or dead cells (b, d) (data represent mean ± SE)

copies l-1) and in biofilms (3.26–3.41 log10 genome copies cm-2). PVC surfaces in showerhead tubes contained more eubacteria compared to brass surfaces in faucets and showerheads, whereas the levels of MAC and Legionella spp. were comparable on PVC and brass (Table 3). Legionella pneumophila was detected in biofilms in PVC showerhead tubes, but not in biofilms on brass surfaces in faucets and showerheads (Table 3). Further analysis of data from Tables 2 and 3 indicated a positive linear relationship between the log-transformed

123

abundance of MAC and that of eubacterial genome copies in water samples (R2 = 0.85). A positive linear relationship was also observed between log-transformed qPCR data for Legionella spp. and eubacteria in water (R2 = 0.74) and biofilm samples (R2 = 0.95). For water samples, positive, linear relationships were also observed between log-transformed cultivation-based results and qPCR results for heterotrophic bacteria and MAC (R2 C 0.84). In contrast, no positive, linear relationships were determined between cooccurrence of Legionella spp. and MAC.

A. S. Bukh, P. Roslev: DNA in Hot Water Pipes

435 2

Table 4 Persistence rate coefficients (k) obtained for M. avium DSM 44156 in the planktonic phase of hot water microcosms determined using qPCR (mean genome copies ml-1 days-1 ± SE; n = 2) and culturing (mean CFU ml-1 days-1 ± SE; n = 2) Time interval (days)

CFU Genome (ml-1 days-1) copies -1 -1 (ml days )

Live cells (filtersterilized hot tap water)

0–14

-0.43 ± 0.01

-0.42 ± 0.01

0.36 ± 0.03

0.32 ± 0.01

DNA (filter-sterilized hot tap water)

0–14

-0.46 ± 0.02

0–28

-0.37 ± 0.12

Live cells (hot tap water)

0–14

-0.35 ± 0.05

-0.30 ± 0.07

0.10 ± 0.00 -0.73 ± 0.07

0.20 ± 0.03

DNA (hot tap water)

14–28 0–14 0–28

-0.17 ± 0.03

Dead cells (hot tap water)

0–14

-0.54 ± 0.14

0–28

-0.13 ± 0.01

14–28

6

S-HW HW

Log Genome copies

Microcosm

y=0.12+0.90x; R =0.684 2 y=-1.01+0.95x; R =0.477

5

4

3

2

2

3

4

5

6

Log CFU

Persistence of M. avium in Hot Water PEX Microcosms Persistence of M. avium DSM 44156 in hot tap water at 44 °C was examined in PEX microcosms inoculated with live M. avium cells, dead cells, or naked DNA extracted from M. avium. Incubations with live M. avium cells and naked DNA included microcosms with and without prior filter sterilization of hot tap water to remove indigenous microorganisms. Persistence of inoculated M. avium cells in the planktonic phase in microcosms with and without filter-sterilized hot water was examined using cultivation and qPCR (Fig. 2a). The concentration of M. avium DSM 44156 determined using both methods decreased by a factor of 3 log10 from day 0 to day 14, but then increased by a factor of 2 log10 from day 14 to 28. A comparable level of cells was generally detected using the two methods indicating that some cells remained culturable and that the increase after 14 days was due to growth of M. avium in the microcosms. Persistence rate coefficients (k) for both detection methods were subsequently calculated for days 0–14 and days 14–28 for planktonic cells (Table 4). For days 0–14, no significant differences in k were determined between filter-sterilized hot water and non-sterilized hot tap water microcosms (Student’s t test, degrees of freedom (df) = 6, P = 0.05) or between plate counts and genome copies (Student’s t test, df = 6, P = 0.63). However, the rate coefficients for the decay phase determined in filtersterilized hot tap water microcosms were greater compared to those determined in hot tap water microcosms indicating that M. avium DSM 44156 persisted slightly better in the presence of other microorganisms. For days 14–28, a significantly higher positive k was determined for filter-sterilized hot tap water compared to hot tap water microcosms (Student’s t test, df = 6, P = 0.002), and no significant

Fig. 3 Comparison between concentrations of M. avium determined using cultivation on Middlebrook 7H10 Agar with Middlebrook OADC Enrichment (CFU) and qPCR (genome copies) in filtersterilized hot tap water (S-HW) and hot tap water (HW) during 28 days of incubation at 44 °C

differences in k were determined between plate counts and genome copies (Student’s t test, df = 6, P = 0.69). This indicated that the regrowth of M. avium DSM 44156 (positive k) was faster in filter-sterilized hot tap water compared to hot tap water microcosms. The concentration of dead M. avium cells and naked DNA in the planktonic phase decreased by a factor of 3–4 log10 during the initial 14 days of incubation (Fig. 2b). No statistically significant difference was determined for naked DNA between filter-sterilized hot water and nonsterilized hot water (Student’s t test, df = 2, P = 0.115), although the persistence rate coefficient determined for hot tap water was almost twice as low as that for filter-sterilized hot tap water (-0.73 ± 0.07 vs. -0.46 ± 0.02, respectively). During the last 14 days of incubation, the levels of amplifiable naked DNA decreased slowly for both filter-sterilized and non-sterilized hot water (Fig. 2b). A significant difference was observed between the persistence of live planktonic cells and that of naked DNA in the hot water during the initial 14 days of incubation (Student’s t test, df = 2, P = 0.043), but not between live and dead cells (Student’s t test, df = 2, P = 0.34) or between naked DNA and dead cells (Student’s t test, df = 2, P = 0.34) in hot tap water within the same time period. Biofilms in PEX microcosms inoculated with live M. avium showed up to tenfold increase in M. avium per cm2 after 28 days using cultivation and qPCR (Fig. 2c). Culturable M. avium on PEX surfaces in contact with filter-

123

436

sterilized hot water increased from 3.87 to 4.27 log10 CFU cm-2, whereas M. avium on surfaces in hot water increased from 4.03 to 4.80 log10 cells cm-2 (Fig. 2c). During the same period, HPC counts in hot water biofilms increased from 2.25 ± 1.40 to 5.41 ± 4.57 log10 CFU cm-2, and eubacteria detected by qPCR increased from 4.92 ± 4.32 to 6.21 ± 5.80 log10 genome copies cm-2. In PEX microcosms inoculated with dead M. avium, levels of detectable M. avium cells in biofilms were more or less constant during the 28 days of incubation. In contrast, naked DNA was not detected on PEX surfaces beyond day 14 and 21 in microcosms with filter-sterilized and non-sterilized water, respectively (Fig. 2d). A general comparison for all microcosm experiments between concentrations of M. avium determined using cultivation (CFU) and quantification based on qPCR (genome copies) showed some similarity (Fig. 3). The results of the two quantification methods were moderately correlated for both filter-sterilized hot water microcosms (R2 = 0.68) and non-sterilized hot water microcosms (R2 = 0.48), although some variation was observed especially for the microcosms with indigenous microorganisms present (Fig. 3).

Discussion The opportunistic pathogens MAC and L. pneumophila can occur, survive, and proliferate in man-made hot water systems [2, 3, 9, 12, 14, 28, 33, 34, 43]. The presence of these bacteria in hot water systems may constitute sources for infections upon transmission from water to consumers [3, 13, 21, 34]. In this study, we evaluated the microbial water quality of nine Danish day care centers focusing on the presence of the opportunistic pathogens MAC and Legionella. The results confirmed the presence of both MAC and Legionella in water and/or biofilms in all public systems at water temperatures up to 54 °C. Subsequently, we examined the survival and persistence of live and dead M. avium in hot water PEX microcosms during a four-week period to compare detection methods and to increase knowledge about the fate and proliferation of M. avium in water and biofilms on plumbing material. It has been reported that M. avium can form biofilms (5.15 log10 cells cm-2) on polyethylene terephthalate (PET) in filter-sterilized groundwater at 20 °C and persist herein for at least 110 days [38]. In addition, M. avium was found to form biofilms (*2 log10 CFU cm-2) on PVC surfaces in drinking water at 7, 15, and 20 °C [24, 40], and on SS (*4 log10 CFU cm-2) and PC (*5 log10 CFU cm-2) in autoclaved potable water at 35 °C [47]. Rapid adherence of M. avium to copper, steel, and polyvinyl chloride has also been observed for tap water biofilm reactors operated at room temperature [31]. In the present study, screening of hot water systems in

123

A. S. Bukh, P. Roslev: DNA in Hot Water Pipes

public day care centers showed mean values of 3.15 log10 genome copies cm-2 of MAC, 4.68 log10 genome copies cm-2 of Legionella spp., and 3.08 log10 genome copies of L. pneumophila in biofilms on faucets, showerheads, and showerhead tubes exposed to water at 40 to 54 °C. In general, more eubacteria were associated with PVC surfaces compared to brass, but no differences in Legionella spp. or MAC levels were detected for these materials. Legionella pneumophila was not detected on brass surfaces in faucets and showerheads. Mathys et al. [28] found that temperature was the main factor affecting colonization of Legionella spp. in German hot water systems in households. In systems where the mean hot water temperature was B45 °C, higher average levels of culturable Legionella were detected compared to systems with higher temperatures (1756 vs. B73 CFU 100 ml-1), whereas no culturable Legionella was detected in systems with temperatures above 60 °C [28]. Only two of the nine domestic water systems tested in the present study had hot water temperatures C50 °C at the distal sites where the samples were collected. Interestingly, Legionella spp. and L. pneumophila were detected in the system operating with a water temperature of 54 °C, and MAC was found in both systems (50 and 54 °C). Further analysis of results from the Danish day care centers indicated a moderate linear correlation between the abundance of MAC genome copies and the abundance of eubacterial genome copies (R2 = 0.85). Interestingly, moderate positive correlations between genome copy numbers of mycobacteria and total bacteria have also been observed for other water types such as unchlorinated Dutch drinking water and chloraminated drinking water in the USA [42, 44]. However, in contrast to our study, MAC was not detected in unchlorinated water from Dutch groundwater or surface water-based water supplies despite the presence of other opportunistic pathogens [42]. When using nucleic acid amplification techniques such as qPCR for evaluation of water quality, it is important to know for how long time DNA from dead cells and naked DNA can persist in the source water [36]. In order to better understand the fate of live and dead cells of M. avium as well as naked M. avium genomic DNA, we examined the persistence of these fractions in hot water PEX microcosms using both cultivation-based detection and qPCR. We found that M. avium was able to survive, remain culturable, and proliferate in water and biofilms at 44 °C within weeks in both the presence and absence of indigenous hot water microorganisms. Growth and persistence of the rapid growers Mycobacterium chelonae and Mycobacterium fortuitum in sterile distilled water at 25 °C have been reported previously [5]. In contrast, Lehtola et al. [24] did not observe a potential for proliferation of M. avium in drinking water biofilms on PVC coupons when incubated for 4 weeks at 15 °C in a biofilm reactor during flow

A. S. Bukh, P. Roslev: DNA in Hot Water Pipes

through of tap water [24]. In a later study by the same authors, the tendency of a slight increase in M. avium concentration in similar drinking water biofilms was observed after 3 weeks of incubation at 20 °C [40]. However, from these experiments, it was not possible to determine whether the observed increase in M. avium levels was caused by normal fluctuations between sessile and planktonic cells or by net growth. In drinking water, Lehtola et al. [24] observed a rapid decrease in culturable, planktonic M. avium cells during the first week of incubation at 15 °C (from *5 to *2 log10 CFU ml-1). At day 28, the concentration of planktonic M. avium was 4.11 log10 CFU ml-1 [24]. Hence, they did observe a total decrease of M. avium in the water of 0.83 log10 CFU ml-1, but from day 7 to day 28, a 2 log10 increase of culturable M. avium cells was observed without a corresponding decrease in sessile cells. These findings are comparable to the results obtained in the present study with hot water at 44 °C where a 3 log10 decrease in the number of culturable M. avium cells was observed during the initial 14 days of incubation followed by a 2 log10 increase. In the present study, the persistence rate coefficients obtained for live cells during the first two weeks of incubation were greater in filter-sterilized hot tap water compared to hot tap water containing high levels of naturally occurring microorganisms including potential amoebae hosts. Some studies suggest that amoebae support environmental survival of mycobacteria [12, 25, 44, 45], but some acanthamoebae may apparently also contribute to environmental inactivation [26]. During the last two weeks of the experiment, significantly higher, positive persistence rate coefficients were obtained for live cells in the filter-sterilized hot tap water microcosm compared to the hot tap water indicating net growth. This, together with the observed increase in concentration of M. avium in biofilms in the filter-sterilized microcosm, indicated that M. avium replicated in hot water systems without the interaction with other microorganisms including amoebae. We also found that M. avium DSM 44156 was able to rapidly adhere to PEX at 44 °C both in the presence and absence of other microorganisms. During the first few hours of incubation, M. avium cells adhered to PEX surfaces in levels of 3.87 log10 and 4.03 log10 CFU cm-2 in filter-sterilized and non-sterilized hot water microcosms, corresponding to *3 % of the M. avium population. After four weeks, the sessile M. avium population constituted *67 % in the PEX pipes (diameter of 3.25 cm). The cross-linked PEX used in these experiments was made from high-density polyethylene and is identical to those most often used for domestic cold and hot water supply systems in new buildings and in remodeling projects. If one considers that most hot water installations in private homes uses PEX pipes with smaller diameters than

437

in the current study (\1.0 cm), these findings suggest that the vast majority of the MAC population in domestic hot water systems is likely sessile (e.g., [80 %). In summary, the study showed that the examined public hot water systems served as reservoirs for the opportunistic pathogens MAC and L. pneumophila as they were detected in hot water and/or biofilms in all of the 9 day care centers examined. The presence of these opportunistic pathogens in the hot water systems may impact public health by serving as potential sources of infection in susceptible individuals. Laboratory experiments further confirmed that M. avium can survive and proliferate at elevated temperatures in water and biofilms on modern plumbing material such as PEX. These findings suggest that precautions should be observed to avoid exposure to aerosolized bacteria at distal sites in buildings with attenuated hot water temperatures, and that the combined effect of water temperature and polymers such as PEX should be considered in the design and operation of modern hot water systems. Acknowledgments We thank Margit Paulsen for providing technical assistance and Associate Professor Niels Iversen for helpful discussions. This work was supported by the Danish Council for Strategic Research; the project SENSOWAQ—Sensors for Monitoring and Control of Water Quality; and by grants from the Obel Family Foundation. Conflict of interest of interest.

The authors declare that they have no conflict

References 1. Aboagye G, Rowe MT (2011) Occurrence of Mycobacterium avium subsp. paratuberculosis in raw water and water treatment operations for the production of potable water. Water Res 45:3271–3278 2. Bagh KL, Albrechtsen HJ, Arvin E, Ovesen K (2004) Distribution of bacteria in a domestic hot water system in a Danish apartment building. Water Res 38:225–235 3. Burnsed LJ, Hicks LA, Smithee LMK, Fields BS, Bradley KK, Pascoe N, Richards SM, Mallonee S, Littrell L, Benson RF, Moore MR, The Legionellosis Outbreak Investigation Team (2007) A large travel-associated outbreak of legionellosis among hotel guests: utility of the urine antigen assay in confirming pontiac fever. Clin Infect Dis 44:222–228 4. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT (2009) The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55:611–622 5. Carson LA, Petersen NJ, Favero MS, Aguero SM (1978) Growth characteristics of atypical mycobacteria in water and their comparative resistance to disinfectants. Appl Environ Microbiol 36:839–846 6. Cassidy PM, Hedberg K, Saulson A, McNelly E, Winthrop KL (2009) Nontuberculous mycobacterial disease prevalence and risk factors: a changing epidemiology. Clin Infect Dis 49:124–129

123

438 7. Cazalet C, Gomez-Valero L, Rusniok C, Lomma M, DervinsRavault D, Newton HJ, Sansom FM, Jarraud S, Zidane N, Ma L, Bouchier C, Etienne J, Hartland EL, Buchrieser C (2010) Analysis of the Legionella longbeachae genome and transcriptome uncovers unique strategies to cause Legionnaires’ disease. PLoS Genet 6(2):e1000851 8. Chang B, Sugiyama K, Taguri T, Amemura-Maekawa J, Kura F, Watanabe H (2009) Specific detection of viable Legionella cells by combined use of photoactivated ethidium monoazide and PCR/real time PCR. Appl Environ Microbiol 75:147–153 9. Declerck P, Behets J, Margineanu A, Hoef V, De Keersmaecker B, Ollevier F (2009) Replication of Legionella pneumophila in biofilms of water distribution pipes. Microbiol Res 164:593–603 10. DS 3029 (2001) Environmental quality—Enumeration of Legionella—Concentration and colony count on solid medium— Spread plate method. Danish Standards Association, Copenhagen, Denmark 11. Falkinham JO III, Nichols G, Bartram J, Dufour A, Portaels F (2004) Natural ecology and survival in water of mycobacteria of potential public health significance. In: Pedley, Bartram, Rees, Dufour, Cotruvo (eds) Pathogenic Mycobacteria in water: a guide to public health consequences, monitoring and management. IWA Publishing, London, pp 15–25 12. Falkinham JO III (2009) Surrounded by mycobacteria: nontuberculous mycobacteria in the human environment. J Appl Microbiol 107:356–367 13. Falkinham JO III (2011) Nontuberculous mycobacteria from household plumbing of patients with nontuberculous mycobacteria disease. Emerg Infect Dis 17:419–424 14. Feazel LM, Baumgartner LK, Peterson KL, Frank DN, Harris JK, Pace NR (2009) Opportunistic pathogens enriched in showerhead biofilms. PNAS 106:16393–16399 15. Herna´ndez-Gardun˜o E, Elwood RK (2010) Demographic risk factors of pulmonary colonization by non-tuberculous mycobacteria. Int J Tuberc Lung Dis 14:106–112 16. Inderlied CB, Kemper CA, Bermudez LE (1993) The Mycobacterium avium complex. Clin Microbiol Rev 6:266–310 17. ISO 6222 (1999) Water quality: Enumeration of culturable microorganisms. Colony count by inoculation in a nutrient agar culture medium. International Organization for Standardization. Geneva, Switzerland 18. Karakousis PC, Moore RD, Chaisson RE (2004) Mycobacterium avium complex in patients with HIV infection in the era of highly active antiretroviral therapy. Lancet Infect Dis 4:557–565 19. Klanicova B, Seda J, Slana I, Slany M, Pavlik I (2013) The tracing of Mycobacteria in drinking water supply systems by culture, conventional, and real time PCR. Current Microbiol 67:725–731 20. Klappenbach JA, Saxman PR, Cole JR, Schmidt TM (2001) rrnDB: the ribosomal RNA operon copy number database. Nucl Acid Res 29:181–184 21. Krøjgaard LJ, Krogfelt KA, Albrechtsen HJ, Uldum SA (2011) Cluster of legionnaires’disease in a newly built block of flats, Denmark, December 2008–January 2009. Eurosurveillance 16:1–7 22. Lai CC, Tan CK, Chou CH, Hsu HL, Liao CH, Huang YT, Yang PC, Luh KT, Hsueh PR (2010) Increasing incidence of nontuberculous mycobacteria, Taiwan, 2000–2008. Emerg Infect Dis 16:294–296 23. Lee ZM, Bussema C, Schmidt TM (2009) rrnDB: documenting the number of rRNA and tRNA genes in bacteria and archaea. Nucl Acid Res 37:489–493 24. Lehtola MJ, Torvinen E, Kusnetsov J, Pitka¨nen T, Maunula L, von Bonsdorff CH, Martikainen PJ, Wilks SA, Keevil CW, Miettinen IT (2007) Survival of Mycobacterium avium, Legionella pneumophila, Escherichia coli, and Calicivirases in drinking

123

A. S. Bukh, P. Roslev: DNA in Hot Water Pipes

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

water-associated biofilms grown under high-shear turbulent flow. Appl Environ Microbiol 73:2854–2859 Marciano-Cabral F, Jamerson M, Kaneshiro ED (2010) Freeliving amoebae, Legionella and Mycobacterium in tap water supplied by a municipal drinking water utility in the USA. J Water Health 8:71–82 Mardare C, Delahay RJ, Dale JW (2013) Environmental amoebae do not support the long-term survival of virulent mycobacteria. J Appl Microbiol 114:1388–1394 Marras TK, Wallace RJ, Koth LL, Stulbarg MS, Cowl CT, Daley CL (2005) Hypersensitivity pneumonitis reaction to Mycobacterium avium in household water. Chest 127:664–671 Mathys W, Stanke J, Harmuth M, Junge-Mathys E (2008) Occurrence of Legionella in hot water systems of single-family residences in suburbs of two German cities with special reference to solar and district heating. Int J Hyg Environ Health 211: 179–185 Miyamoto H, Yamamoto H, Arima K, Fujii J, Maruta K, Izu K, Shiomori T, Yoshida S (1997) Development of a new seminested PCR method for detection of Legionella species and its application to surveillance of Legionellae in hospital cooling tower water. Appl Environ Microbiol 63:2489–2494 Moore J, Kruijshaar M, Ormerod L, Drobniewski F, Abubakar I (2010) Increasing reports of non-tuberculous mycobacteria in England, Wales and Northern Ireland, 1995–2006. BMC Public Health 10:612 Mullis SN, Falkinham JO III (2013) Adherence and biofilm formation of Mycobacterium avium, Mycobacterium intracellulare, and Mycobacterium abscessus to household plumbing materials. J Appl Microbiol 115:908–914 Nadkarni MA, Martin FE, Jacques NA, Hunter N (2002) Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology 148:257–266 Nichols G, Ford T, Bartram J, Dufour A, Portaels F (2004) Introduction. In: Pedley S, Bartram J, Rees G, Dufour A, Cotruvo JA (eds) Pathogenic mycobacteria in water: a guide to public health consequences, monitoring and management. IWA Publishing, London, pp 1–14 Nishiuchi Y, Tamura A, Kitada S, Taguri T, Matsumoto S, Tateishi Y, Yoshimura M, Ozeki Y, Matsumura N, Ogura H, Maekura R (2009) Mycobacterium avium complex organisms predominantly colonize in the bathtub inlets of patients’ bathrooms. Jpn J Infect Dis 62:182–186 Ra¨sa¨nen NHJ, Rintala H, Miettinen IT, Torvinen E (2013) Comparison of culture and qPCR methods in detection of mycobacteria from drinking water. Can J Microbiol 59:280–286 Roslev P, Bukh AS (2011) State of the art molecular markers for fecal pollution source tracking in water. Appl Microbiol Biotechnol 89:1341–1355 Standard Methods for the Examination of Water and Wastewater (2005) American Public Health Association/American Water Works Association/Water Environment Federation, 21st edn. Washington, DC Tatchou-Nyamsi-Ko¨nig JA, Dailloux M, Block JC (2009) Survival of Mycobacterium avium attached to polyethylene terephthalate (PET) water bottles. J Appl Microbiol 106:825–832 Thomson RM (2010) Changing epidemiology of pulmonary nontuberculous mycobacteria infections. Emerg Infect Dis 16:1576–1583 Torvinen E, Lehtola MJ, Martikainen PJ, Miettinen IT (2007) Survival of Mycobacterium avium in drinking water biofilms as affected by water flow velocity, availability of phosphorus, and temperature. Appl Environ Microbiol 73:6201–6207 Vaerewijck MJM, Huys G, Palomino JC, Swings J, Portaels F (2005) Mycobacteria in drinking water distribution systems:

A. S. Bukh, P. Roslev: DNA in Hot Water Pipes

42.

43.

44.

45.

ecology and significance for human health. FEMS Microbiol Rev 29:911–934 van der Wielen PWJJ, van der Kooij D (2013) Nontuberculous mycobacteria, fungi, and opportunistic pathogens in unchlorinated drinking water in the Netherlands. Appl Environ Microbiol 79:825–834 Wadowsky RM, Yee RB, Mezmar L, Wing EJ, Dowling JN (1982) Hot water systems as sources of Legionella pneumophila in hospital and nonhospital plumbing fixtures. Appl Environ Microbiol 43:1104–1110 Wang H, Edwards M, Falkinham JO III, Pruden A (2012) Molecular survey of the occurrence of Legionella spp., Mycobacterium spp., Pseudomonas aeruginosa, and amoeba hosts in two chloraminated drinking water distribution systems. Appl Environ Microbiol 78:6285–6294 Wang H, Masters S, Hong Y, Stallings J, Falkinham JO III, Edwards M, Pruden (2012) Effect of disinfectant, water age, and pipe material on occurrence and persistence of Legionella,

439

46.

47.

48.

49.

mycobacteria, Pseudomonas aeruginosa, and two amoebas. Environ Sci Tech 46:11566–11574 Whiley H, Keegan A, Giglio S, Bentham R (2012) Mycobacterium avium complex: the role of potable water in disease transmission. J Appl Microbio 113:223–232 Williams MM, Yakrus MA, Arduino MJ, Cooksey RC, Crane CB, Banerjee SN, Hilborn ED, Donlan RM (2009) Structural analysis of biofilm formation by rapidly and slowly growing nontuberculous mycobacteria. Appl Environ Microbiol 75: 2091–2098 Wilson DA, Yen-Lieberman B, Reischi U, Gordon SM, Procop GW (2003) Detection of Legionella pneumophila by real-time PCR for the MIP gene. J Clin Microbiol 41:3327–3330 Winthrop KL, McNelley E, Kendall B, Marshall-Olson A, Morris C, Cassidy M, Saulson A, Hedberg K (2010) Pulmonary nontuberculous mycobacterial disease prevalence and clinical features: an emerging public health disease. Am J Respir Crit Care Med 182:977–982

123