MOLECULAR CARCINOGENESIS4:445-449 (1991)

Mutations in the p53 Tumor Suppressor Gene in Human Cutaneous Squamous Cell Carcinomas William E. Pierceall. Tapas Mukhopadhyay. Leonard H. Goldberg, and Honnavara N. Ananthaswamy’ Departmentr of Immunology (WEf HNA) and Thoracic Surgery (TM), The Universityof Texas M. D. Anderson Cancer Center. and Department of Dermatology (LHG), 6aylor College of Medicine, Houston, Texas In this study, we analyzed 10 human squamous cell carcinomas (SCCs) for alterations in the p53 tumor suppressor gene in exons 4 through 9 by single-strand conformation polymorphism (SSCP) analysis. We found that 2 of 10 SCCs displayed unusual SSCP alleles a t exon 7 of the p53gene. Subsequent cloning and sequencing of PCR-amplified exon 7 DNA from these two tumors revealed that one had a G+A transition a t the first position of codon 244,predicting a glycine-to-serine amino acid change, while the other tumor exhibited a G+T base change a t the second nucleotide of codon 248,predicting an arginine-to-leucine substitution. Because the mutations in the p53 tumor suppressor gene in both tumors were located opposite potential pyrimidine dimer sites (C-C),i t is consistent with these mutations having been induced by the ultraviolet radiation present in sunlight. These studies demonstrate that inactivation of the p53 tumor suppressor gene, as well as activation of ras oncogenes, may be involved in the pathogenesis of some human skin cancers. Key words: UV carcinogenesis, sunlight, skin cancer, p53 gene, SSCP INTRODUCTION Several genetic alterations that perturb normal cellular growth control mechanisms can cause cancers. These include point mutations, deletions, translocations, amplifications, and gene rearrangements, and occur primarily in two classes of interacting genes-oncogenes and tumor suppressor genes. While mutation or amplification of certain oncogenes can facilitate cell growth and tumor formation [ 1-41, loss or mutation of tumor suppressor genes, which normally inhibit these processes, can promote tumor formation [5-71. Oncogenes such as rasact as positive growth regulators. In contrast, tumor suppressor genes are negative growth regulatorsthat block transformation and maintain the cell’s normal phenotype. Several recently cloned genes such as Rbj8-1 11, p53[12-16], DCC (1 7,181, NF-1 [ 19-21], WT-1 122-251, and K-rev-llrap-lA [26,27] are known to function as tumor suppressors. While the wild-type p53 gene is a tumor suppressor [13-161, some mutant p53 alleles act as tumor promoters [15,16,28]. The p53 tumor suppressor gene is inactivated through loss or somatic mutation in several types of human tumors [12,29-411. In addition, germline transmission of the mutated p53 gene has been detected in patients suffering from Li-Fraumeni syndrome 142.431. Our previous studies have shown that human nonmelanoma skin cancers arising on sun-exposed body sites contain mutated, amplified, or deleted rds oncogenes 144.45). However, it is not known whether alterations in the p53 or other tumor suppressor genes also play a role in the pathogenesis of human skin cancers. In this paper, we used single-strand conformation polymorphism (SSCP) 0 199 1 WILEY-LISS, INC.

analysis and nucleotide sequencing to demonstrate that some human squamous cell carcinomas (SCCs) originating on sun-exposed body sites contain point mutations in the p53 tumor suppressor gene. These mutations may have been induced by ultraviolet (UV) radiation present in sunlight.

MATERIALSAND METHODS Skin Tumors Histologically confirmed SCCs were obtained from sunexposed body sites (face, ear, and neck) of 40-70-yr old Caucasian patients of both sexes. The tumor tissues were resected surgically, and either the DNA was extracted immediately or the tumors were frozen at -70°C until DNA extraction. In some cases, matching unexposed (lower back) skin from the same patient was used as a control. None of the patients had undergone chemotherapy or radiation treatment for skin cancers prior to surgical removal of the tumors. Synthetic Oligonucleotide Primers Oligonucleotide primers were synthesized using an Applied Biosystemsoligodeoxynucleotide synthesizer (Foster City, CA) according to the sequences described by Buchman et al. [46l. The sequences of the primers used in this study are listed in Table 1.

’Corresponding author Department of Immunology, The University of Texas M D Anderson Cancer Center, 151 5 Holcombe Blvd , Box 178, Houston, Texas 77030 Abbreviations BCC. basal cell carcinoma, EDTA, ethylenediaminetetraacetic acid, PCR, polymerase chain reaction. SCC, squarnous cell carcinoma. SSCe single strand conformation polymorphism, TBE, Trisborate-EDTA buffer, UV, ultraviolet

446

PIERCEALL ETAL.

Nucleotide Sequencing

Table 1. Primers Used for Amplification o f p53Target Sequences Exon 4 5 -6

7 8-9

Primer sequence* TTCACCCATCTACAGTCCCC TCAG GGCAACTGACC GTGCA TTC CTCTTCCTG CAGTACTC AGACCTCAGGCGGCTCATAG TCTC CTAGG l l G G CTCTGAC CAAGTGGCTC CTGAC CTGGA C CTATCCTGAGTAGTGGTAATC CC CAAGACTAGTACCTGAAG

Product length (bp) 308 397 133 332

*The first primer in each set lies 5’ to the target sequence and the second primer lies 3’ to the target sequence. Sequences are given in the 5’ to 3’ orientation.

Polymerase Chain Reaction Genomic DNA from p53 exons 4-9 was amplified as described by Saiki et al. [47]. The primers were end-labeled with 32P using T4 polynucleotide kinase as described by Maniatis et al. [48] before being added to the polymerase chain reaction (PCR) mixture. The reaction mixture, containing 0.5 p g genomic DNA and 0.6 p g of each 32P-endlabeled 5’ and 3’ primer, was denatured by incubation at 95°C for 5 min. The final reaction volume of 100 pL containing 200 p M of each deoxynucleotide triphosphate, 3.0 m M MgCI2, 1X GeneAmp (Perkin-Elmer Cetus, Norwalk, CT) reaction buffer (50 m M KCI, 10 m M Tris-HCI, pH 8.31, and 2.5 U Taq polymerase (Perkin-Elmer Cetus) was overlayed with 100 p L mineral oil and amplified in a DNAThermal Cycler (Perkin-Elmer Cetus) for 35 cycles. Each cycle consisted of denaturation at 94°C for 1 min, primer annealing at 55°C (for exons 5-6 and 8-9) or 66°C (for exons 4 and 7) for 2 min, and primer extension at 72°C for 2 min. The final extension cycle was prolonged 5 min to insure that the product DNAs were of full length. Single-Strand Conformation Polymorphism Analysis SSCP analysis was performed according to the procedure described by Hensel et al. [49]. Briefly, 1 p L of each PCR product was added to 100 pL of 0.1 YOsodium dodecyl sulfate, 10 m M ethylenediaminetetraacetic acid (EDTA), pH 8.0. Ten microliters of the diluted sample was mixed with 10 p L denaturing sample buffer (95% formamide, 20 m M EDTA, pH 8.0, 0.05% bromophenol blue, and xylene cyanol FF). The samples in formamide buffer were heated to 80°C for 5 min to denature them, and 3 pL of each sample was electrophoresed on 5% polyacrylamide (19: 1, acrylamide/ bis-acry1amide)sequencinggels(30 cm wide x 36 cm long x 0.4 cm thick) containing 1 x TBE buffer (18 m M Tris, 18 m M boric acid, and 0.4 m M EDTA, pH 8.0) using a BRL Model 52 sequencing gel apparatus at 45 W (constant power). Best results were achieved when the gels were run at 4°C in comparison with those run at room temperature. All gels were run until the samples had traversed at least half the length of the gel. After electrophoresis, the gels were dried and exposed to x-ray film at - 70°C for 4-20 h.

PCR was performed with unlabeled primers for 35 cycles, and one tenth of the reaction volume was electrophoresed on 3% Nusieve:1% agarose gels. Bands of the expected lengths were isolated and subcloned into the Smal site of BlueScript plasmids (Stratagene, Inc., La Jolla, CAI. k h e richid coliJM DH5a cells were transformed with these plasmids and the transformed colonies isolated. Representative clones of each SSCPpositive DNA were sequenced to detect the mutations in exon 7. Recombinant plasmid DNA was isolated and iki nucleotide sequence was determined using the Sequenase kit (U.S. Biochemical Corp., Cleveland, Ohio). Both strands of each template were sequenced in separate reactions using alternative p53 primen as sequencing primers.

RESULTS AND DISCUSSION We initially employed the SSCP assay to determine whether the genomic DNA from human SCCs had alterations in the p53 tumor suppressor gene. SSCP is a rapid and sensitive assay for detecting nucleotide alterations, including point mutations [50,51]. In this assay, DNA segments 100-400 bp long are amplified by PCR, heat denatured, and electrophoresed on high-resolution, nondenaturing acrylamide gels. Under these conditions, each single-stranded DNA fragment assumes a secondary structure determined in part by its nucleotide sequence. If there are nucleotide alterations of even a single base, the electrophoretic mobility of the PCR product will be affected. Several examples of single-base changes significantly affecting the electrophoretic mobility of PCR products have been reported [49-531. None of 10 SCCs we analyzed exhibited differences in exons 4, 5, 6, 8, or 9 of the p53 gene (data not shown). However, 2 of 10 SCCs exhibited polymorphic exon 7 bands. The autoradiograph shown in Figure 1 reveals that extra bands are present in tumors 5 and 7 (lanes 5 and 7, respectively), but not in the other tumors. These results suggest that these two SSCP-positive tumors may contain mutations in exon 7 of the p53 gene. We next subcloned and sequenced the PCR-amplified p53 exon 7 DNAs from the two SSCP-positive tumors to identify the nature of the mutations. Four subclones of each SSCP variant were selected randomly for nucleotide sequence analysis. We found that three subclones from tumor 5 exhibited mutations in codon 244 and two subclones from tumor 7 exhibited mutations in codon 248. One subclone from tumor 5 and two subclones from tumor 7 contained wild-type sequences (data not shown). The nucleotide sequence data shown in Figure 2 reveal that tumor 5 contains a G-bA mutation at position 1 of codon 244 (panel a), predicting a glycine-to-serine amino acid substitution, while tumor 7 contains a G+T mutation at position 2 of codon 248 (panel c), predicting an arginineto-leucine amino acid substitution. Since matching normal skin DNA from a non-sun-exposed site was available from the patient with tumor 7, we analyzed it for possible constitutive mutations in exon 7 of the p53 gene. DNA

447

~ 5 GENE 3 MUTATIONS IN HUMAN SCC

1 2 3 4 5 6 7 8 910

c

Figure 1. SSCP analysis of human SCC DNAs. Primers specific for exon 7 of the p53 gene were prelabeled with [32P]ATPand added to a PCR mixture containing 0.5 pg genomictumor DNA. PCR was performed as described in Materials and Methods. The PCR products were electrophoresed on nondenaturing acrylamide gels at 4°C. After electrophoresis, the gel was dried and autoradiographed. Lanes 1-10. DNA samples from 10 human SCCs. The arrow indicates the presence of unusual SSCP alleles in lanes 5 and 7. respectively. Four bands were consistently observed for DNAs containing wild-type p53 alleles. These bands probably representtwo single-strandedfragments, the residual undenatured fragment, and a separate conformer of the fragment [50,53].

sequencing of four clones (each sequenced for sense as well as antisense strands) indicated that the normal skin DNA contained only the wild-type (CGG) sequences at codon 248 (Figure 2b). This suggested that the mutation detected in the tumor 7 was somatic and not germline. The p53 mutations detected in tumors 5 and 7 were confirmed by a second PCR reaction and sequencing of addi-

a

Figure 2. Nucleotide sequence analysis of exon 7 from tumor DNA( exhibiting unusual SSCP alleles. The sequences shown wer: obtained using the antisense strand as a template and the 5 PCR primer (see Table 1) as the sequencing primer. Alternatively, the sense strand was sequenced using the 3’ PCR primer as the sequencing primer (data not shown). (a) Tumor 5; (b) normal

tional clones (two each) to rule out the possibility that the observed mutations resulted from base misincorporation during PCR. The fact that DNAs from both tumors containing G+A or G-+Tmutations also contained wild-type sequences for codons 244 (GGC) and 248 (CGG), respectively (data not shown), suggests either that both normal and mutated alleles were present in these two tumors or that these two tumors contain only the mutated alleles, and that the apparent wild-type alleles are due to contamination by normal cells that usually infiltrate the tumor mass. Therefore, it is difficult to tell whether the two mutated SCCs are homozygous, hemizygous, or heterozygous for the respective base change. Previous studies have shown that in some tumors, one of the p53 alleles is lost while the other is mutated [12,321. Most interesting, however, is the sequence at which the p53 mutations were detected in our human skin cancers. The p53 mutations a t both codons 244 and 248 occurred opposite C-C sequences, potential sites for pyrimidine dimer formation. Our previous studies showed that human SCCs and basal cell carcinomas (BCCs) contained specific mutations at codon 12 of Ha-ras and Ki-ras oncogenes and that these mutations also occurred at sites directly opposite C-C sequences 1451. In addition, the G-T mutations detected in NIH 3T3 cells transformed with in vitro UV-irradiated human c-Ha-ras-1 proto-oncogene DNA also occurred opposite C-C sequences (54). A comparison of the sequences of the Ha-ras, Ki-ras, and p53 codons at which specific mutations occurred in human skin cancers (Table 2 ) shows that the C-C sequences are the preferred targets for UV-

b

C

skin DNA from patient 7; (c) tumor 7. The 5’+3’ orientation of the sequence on the autoradiograph is read from top to bottom. W. T. Seq. refers to the wild-type nucleotide sequence of codons 243-249. The mutations in codons 244 (G-tA) and 248 (G-T) are shown in the box.

448

PIERCEALL ETAL.

Table 2. Sequence Specificity for Mutations in Human Skin Cancers Gene Codon Ha-ras Ki-ras

12 12

p53

244

p53

248

Strand Sense Antisense Sense Antisense Sense Antisense Sense Antisense

Nucleotide seauence Wild-type Mutant Reference GGC

GTc*

45

AGTt

45

AGC

This study

gene. Three of the tumors exhibited a C C + l l double-base change at codons 245, 247-248, and 285-286. In addition, C+T base substitutions were also detected at a high frequency in some human SCCs. These results lend further support to our conclusion that C-C sequences are the main targets for UV-induced mutation in human skin cancers.

E G GGT E A GGC G G CGG

CTG* This study

GCC

'Eleven of 24 SCCs and 5 of 16 BCCs had G+T mutations. tone of 40 skin tumors (an SCC) had a G+A mutation. $The tumor with this p53 gene mutation also was shown previously to possess a G+T mutation a t Ha-rascodon 12 [451.

induced DNA damage and subsequent mutation in both the ras oncogenes and the p53 tumor suppressor gene. Taken together, these results argue a strong case for physical carcinogen (UV radiation) specificity with respect to sites of DNA damage and mutation in the induction of human skin cancers on sun-exposed body sites. They further suggest that C-C sequences are the preferred sites for mutation in nonmelanoma skin cancers, quite probably through the induction of pyrimidine dimers. Mutations in the p53 gene occur frequently in bladder (381, colon [12,32], lung [31-33,36,37], breast [321, brain [32], and esophageal [391 cancers, as well as in human T-cell and 8-cell leukemia [40,53] and malignant neurofibrosarcoma [32,41 I. However, the p53 mutations that we detected in human skin cancers appear to occur at relatively low frequency (20%). This could be due to the fact that our sample size is very small. In addition, we do not know whether mutations in the p53 gene occur in BCCs or are restricted to SCCs. This remains to be investigated. Nevertheless, the discovery of p53 mutations in human SCC suggests that alterations of tumor suppressor genes play a role in the pathogenesis of some human skin cancers. Further studies using additional human skin tumors are required to confirm the specificity of the p53 mutations that we have detected in human skin cancers and to establish a definitive role for the p53 gene in human skin carcinogenesis. ACKNOWLEDGMENTS This research was supported by Public Health Service grant R01-CA-46523 (to HNA) from the National Cancer Institute. William Pierceall is the recipient of a Predoctoral Fellowship from the National Institutes of Health under Training Grant T32-CA-09598. We would like to thank Dr. Chuck Hensel, of The University of Texas Health Science Center, San Antonio, for advice on SSCP analysis and Dr. Doug Brash, of Yale School of Medicine, for sending us a preprint of his manuscript in press. NOTE ADDED IN PROOF

A recent report by Brash et al. [55] has shown that 14 of 24 (58%) human SCCs contained mutations in the p53

Received June 27, 1991; revised August 7, 1991; accepted August 8.1991.

REFERENCES 1. Hunter T. Cooperation between oncogenes. Cell 64:249-270, 1991. 2. Bishop JM. Molecular themes in oncogenesis. Cell 64:235-248. 1991. 3. Bishop JM. Cellular oncogenes and their retroviruses. Annu Rev Biochem 52:301-354, 1983. 4. Land H, Parada LF, Weinberg RA. Cellular oncogenes and multistep carcinogenesis. Science 222:771-778, 1983. 5. KnudsonAG Jr. Hereditary cancer, oncogenes, and antioncogenes. Cancer Res45:1437-1443, 1985. 6. Cavenee WK, Hansen MF, Scrable HJ, James CD. Loss of genetic information in cancer. In: Book G, Marsh J (eds), Genetic Analysis of Tumor Suppression.Wiley, NewYork(Ciba Foundation Symposium 142), 1989, pp. 79-92. 7. Marshall CJ. Tumor suppressor genes. Cell 6431 3-326, 1991. 8. Friend SH, Bernards R, Rogelj S, et al. A human DNA segment with the properties of the gene that predisposes to retinoblastoma and osteosarcoma. Nature 323:643-646, 1986. 9. Lee WH, Brookstein R. Hong F, Young U,Shew JY, Lee EYHP. Human retinoblastoma susceptibility gene: Cloning, identification, and sequence. Science 235: 1394-1 399, 1987. 10. Harbour JW, Lai SL, Whang-Rng J, Gazdar AD, Minna JD, Kaye FJ. Abnormalities in structure and expression of the human retinoblastoma gene in SCLC. Science 241 :353-357,1988. 11. Lee EYHP. To H. Shew J, Bookstein R, Scully P. Lee WH. Inactivation of the retinoblastoma susceptibility gene in human breast cancers. Science 241 :218-221, 1988. 12. Baker SJ. Fearon ER, Nigro JM, et al. Chromosome 17 deletions and p53 gene mutations in colorectal carcinomas. Science 244:217-221,1989. 13. Finlay CA, Hinds PW, Levine AJ. The p53 proto-oncogene can act as a suppressor of transformation. Cell 57: 1083-1 093, 1989. 14. Eliyahu D,Michalwitz D. Eliyahu S, Pinhasi-Kimhi0, Oren M. Wildtype p53 can inhibit oncogene-mediated focus formation. Proc Natl Acad Sci USA 86:8763-8767, 1989. 15. Baker SJ, Markowitz S, Fearon ER, Willson JKV, Vogelstein B. Suppression of human colorectal carcinoma cell growth by wild-type p53. Science249:912-915, 1990. 16. Chen P-L, Chen Y, Bookstein R, Lee W-H. Genetic mechanisms of tumor suppression by the human p53 gene. Science 250: 15761580,1990. 17. Fearon ER, Cho KR, Nigro JM, et al. Identification of a chromosome 18q gene that is altered in colorectal cancers. Science 247:49-56.1990, 18. Fearon ER, kgelstein B. A genetic model for colorectal tumorigenesis. Cell 61 :759-767, 1990. 19. Cawthon RM, Weiss R, Xu G, et al. A major seqment of the neurofibromatosis type 1 gene: cDNA sequence, genomic structure, and point mutations. Cell 62:193-201, 1990. 20. Viskochil D, Buchberg AM, Xu G, et al. Deletions and a translocation interrupt a cloned gene at the neurofibromatosistype 1 locus. Cell 62:187-192, 1990. 21, Wallace MR, Marchuk DA, Anderson LB, et al. Type 1 neurofibromatosis gene: Identificationof a large transcript disrupted in three NF1 patients. Science 249: 181-1 86, 1990. 22 Call KM, Glaser T, Ito CY, et al. isolation and characterization of a zinc finger polypeptide gene a t the human chromosome 11 Wilms' tumor locus. Cell 60:509-520, 1990. 23 Gessler M, Poustka A, Cavenee W, Neve RL, Orkin SH, Bruns GAP Homozygous deletion in Wilms' turnours of a zinc-finger gene identified by chromosomejumping. Nature343:774-778,1990. 24 Haber DA, Buckler AJ, Glaser T, et al. An internal deletion within an l l p 1 3 zinc finger gene contributes to the development of Wilms'tumor. Cell 61:1257-1269. 1990. 25 Rose EA, Glaser T, Jones C, et al. Com lete physical map of the WAGR region of 1 1p l 3 localizes a candidate Wilms' tumor gene. Cell 60:495-508.1990.

P53 GENE MUTATIONS IN HUMAN SCC 26. Schaefer R, lyer J, €ten E, Nirkko AC. Partial reversion of the transformed phenotype in HRAS-transfected tumorigenic cells by transfer of a human gene. Proc Natl Acad Sci USA85: 1590-1 594,1988. 27. Kitayama H, Sugimoto Y, Matsuzaki T, lkawa Y, Noda M. A rasrelated gene with transformation suppressor activity. Cell 56: 77-84,1989. 28. Hinds P. Finlay C, Levine AJ. Mutation is required to activate the p53 gene for cooperation with the ras oncogene and transformation. J Virol63:739-746, 1989. 29. Wolf D, Rotter V. Major deletions in the gene encoding the p53 tumor antigen cause lack of p53 expression in HL-60 cells. Proc Natl Acad Sci USA 82:790-794, 1985. 30. Masuda H, Miller C, Koeffler HP. Battifora H, Cline MJ. Rearrangement of the p53 gene in human osteogenic sarcomas. Proc Natl Acad Sci USA84:7716-7719, 1987. 31. Takahashi T, Nau MM, Chiba I. p53: Afrequenttargetforgenetic abnormalities in lung cancer. Science 246:491-494, 1989. 32. Nigro JM, Baker SJ, Preisinger AC, et al. Mutations in the p53 gene occur in diverse human tumour types. Nature 342:705-708, 1989. 33. Bartek J, lggo R, Gannon 1, Lane DF! Genetic and immunological analysis of mutant p53 in human breast cancer cell lines. Oncogene 5:893-899, 1990. 34. Bressac 8, Galvin KM, Liang TJ, lsselbacher Kl, Wands JR, Ozturk M. Abnormal structure and expression of p53 gene in human hepatccellular carcinoma. Proc Natl Acad Sci USA 87: 1973-1977, 1990. 35. Chiba I, Takahashi T, Nau MM, et al. Mutations in the p53 gene are frequent in primary, resected non-small cell lung cancer. Lung cancer study group. Oncogene 5: 1603-1 610,1990. 36. lggo R, Gatter K, Bartek 1, Lane D, Harris AL. Increased expression of mutant forms of p53 oncogene in primary lung cancer. Lancet 335:675-679. 1990. 37. Rodrigues NR, Rowan A, Smith MEF, et al. p53 mutations in colorectal cancer. Proc Natl Acad Sci USA87.7555-7559, 1990. 38. Sidransky D, Von Eschenbach A, Tsai YC, et al. Identification of p53 gene mutations in bladder cancers and urine samples. Science 252:706-709.1991. 39. Hollstein MC, Metcalf RA, Welsh JA, Montesano R, Harris CC. Frequent mutation of the p53 gene in human esophageal cancer. Proc Natl Acad Sci USA 87:9958-9961, 1990. 40. Cheng H, Haas M. Frequent mutations in the p53 tumor suppressor gene in human leukemia T-cell lines. Mol Cell Biol 10: 5502-5509, 1990. 41. Menon AG, Anderson KM. RiccardiVM, et al. Chromosome 17p deletions and p53 mutations associated with the formation of malignant neurofibrosarcomas in Von Recklinghausen neurofibromatosis. Proc Natl Acad Sci USA 87:5435-5439. 1990.

449

42. Malkin D, Li FP. Strong LC, et al. Germline p53 mutations in a familial syndrome of breast cancer, sarcomas and other neoplasms. Science 250:1233-1238, 1990. 43. Srivastava 5, Zou 2, Pirollo K, Blattner W, Chang EH. Germ-line transmission of a mutated p53 gene in a cancer-prone family with Li-Fraumeni. Nature 348:747-749, 1990. 44. Ananthaswamy HN, Applegate LA, Goldberg LH, Bales ES. Deletion of the c-Ha-ras-1 allele in human skin cancers. Mot Carcinog 2:298-301,1989, 45. Pierceall WE, Goldberg LH, Tainsky MA, Mukhopadhyay T, Ananthaswamy HN. Ras gene mutation and amplification in human nonmelanoma skin cancers. Mol Carcinog 4: 196-202, 1991. 46. BuchmanVL, Chumakov PM, Ninkina NN, Samarina OR Georgiev GF! A variation in the structure of the protein-coding region of the human p53 gene. Gene 70:245-252,1988. 47. Saiki RK, Gelfaud DH, Stoffel 5, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487-491,1988. 48. Maniatis T, Fritsch EF, Sambrook J. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1982. 49. Hensel CH, Xiang RH, Sakaguchi AY, Naylor SL. Use of the single strand conformation polymorphismtechnique and PCR to detect p53 gene mutations in small cell lung cancer. Oncogene 6: 10671071,1991. 50. Orita M, lwahana H, Kanazawa H, Hayashi K, SekiyaT. Detection of polymorphisms of human DNA by gel electrophoresis as single strand conformation polymorphisms. Proc Natl Acad Sci USA 86:2766-2770.1989. 51. Orita M, Suzuki Y, Sekiya T. Hayashi K. Rapidand sensitive detection of point mutations and DNA polymorphisrns using the polymerase chain reaction. Genomics 52374-879. 1989. 52. Murakami Y, Hayashi K, Sekiya T. Detection of aberrations of the p53 alleles and the gene transcripts in human tumor cell lines by single-strand conformation polymorphism analysis. Cancer Res 51 :3356-3361, 1991. 53. Gaidano G, Ballerini P. Gong 12, et al. p53 mutations in human lymphoid malignancies: Association with Burkitt lymphoma and chronic lymphocytic leukemia. Proc Natl Acad Sci USA 88:54135417, 1991. 54. Pierceall WE, Ananthaswamy HN. Transformation of NIH 3T3 cells by transfection with UV-irradiated human c-Ha-ras-1 protooncogene DNA. Oncogene (in press). 55. Brash DE, Rudolph JA, Simon JA, et al. A role for sunlight in skin cancer: UV-induced p53 mutations in squamous cell carcinoma. Proc. Natl Acad Sci USA (in press).