JOURNAL

OF

Vol. 173, No. 10

BACTERIOLOGY, May 1991, p. 3261-3264

0021-9193/91/103261-04$02.00/0

Mutations Affecting the Shine-Dalgarno Sequences of the Untranslated Region of the Escherichia coli gltBDF Operon LAURA VELAZQUEZ, LAURA CAMARENA, JOSE LUIS REYES, AND FERNANDO BASTARRACHEA* Departamento de Biologia Molecular, Instituto de Investigaciones Biomedicas, Universidad Nacional Aut6noma de Mexico, Apartado Postal 70-228, Mexico, D.F. 04510, Me'xico Received 30 January 1991/Accepted 19 March 1991

Individual mutations which affected each of the two Shine-Dalgarno sequences at the 5' untranslated region of the gl&B gene of Escherichia coli were characterized. They were isolated in plasmids carrying a gltB'-'lacZ protein fusion preceded by the regulatory region of the gltBDF operon. Subcloning and nucleotide sequencing of -1,206 bp of DNA encompassing the gltBDF regulatory region showed that the mutations affected the first base at each of the two identical Shine-Dalgarno sequences, SD1 and SD2, located 40 and 8 bases, respectively, upstream from the putative gWtB open reading frame. Only mutation gltB2r227, an adenine in place of a guanine, affecting the first base of SD2, lowered I-galactosidase expression significantly, i.e., about fivefold. The results suggest that SD2 is the preferred functional site at which ribosomes initiate gltB mRNA translation.

ized colonies showing ,-galactosidase activity higher or lower than that of the parental strain, candidates representing each of the classes were purified for further characterization. We describe here two mutations, gltBlr226 and gltB2r227, which turned out to affect each of the two Shine-Dalgarno sequences at the nontranslated leader region of the gltBDF operon in pLLT1. To assess whether the mutations affected the gltBDF regulatory region, we purified HincII-HinclI DNA fragments -1,206 bp long encompassing the gltBDF regulatory region and 816 bp of downstream DNA encoding the first 272 amino acids of the NH2 end of gltB from pLLT1 or the putative mutant plasmids. They were fused in frame to codon 8 of lacZYA from nonmutagenized plasmid pMC1403 (3) (Fig. 1). Transformation of MX614 cells to Apr Lac' led to isolation of pLLT4 (wild type), pLLT5 (carrying gltBlr226, the original P-galactosidase up mutation), and pLLT6 (carrying gltB2r227, the original ,-galactosidase down mutation). The results in Table 1 show that the P-galactosidases made from MX614/pLLT5 and MX614/pLLT6 were 90 and 20%, respectively, of that made by MX614/pLLT4, regardless of whether the strains grew in 15 mM NH4+ or L-glutamate as the sole nitrogen source. This indicates that (i) the gltBDF regulatory region when subcloned into pLLT6 retained its original P-galactosidase down phenotype but when subcloned into pLLT5, however, lost its 3-galactosidase up phenotype and (ii) either it was originally misread or we segregated out one or more mutations during subcloning. The gltBDF operon of wild-type E. coli is repressed nearly 100% by external L-glutamate but fully derepressed upon addition of ammonia excess to the medium (1, 4, 23). The presence of L-glutamate as the only nitrogen source, however, repressed P-galactosidase expression from the pLLT plasmids only 10 to 30% compared with that made by the ammonia-grown strains. The poor repression exerted by external glutamate was similar for strains carrying either the mutant or wild-type gltBDF regulatory region. This is in agreement with previous findings (2), which indicate that pLLT multicopy plasmids carrying the gltBDF regulatory region titrate out a trans-acting chromosomal repressor. A gene coding for the putative repressor is believed to be absent in the pLLT family of plasmids but present in pRSP21

Glutamate synthase (EC 2.6.1.53) of Escherichia coli catalyzes the formation of two L-glutamate molecules from L-glutamine and 2-ketoglutarate and, together with glutamine synthetase (EC 6.3.1.2), is responsible for assimilation of low ammonia concentrations (reviewed in reference 20). Glutamate synthase is composed of four dimers, each of them formed by nonidentical subunits with Mrs of 135,000 and 53,000 (14, 17). We have established the existence of a gltBDF operon in E. coli (4) which is composed of genes encoding large (gltB) and small (gltD) subunits of glutamate synthase, as well as a third downstream gene, gltF, whose product appears to be involved in positive regulation of glutamine synthetase, i.e., the gInALG operon, as well as in negative regulation of its own gltBDF operon (2). Part of the gltBDF operon, including 430 bp of its nontranslated leader region, has been sequenced (19); sequence consensus with a &70-RNA polymerase holoenzyme-recognizable promoter, a boxA, and two ribosome-binding (ShineDalgarno) sites (25), each one followed by an initiator codon, were identified through a computer-based data bank program.

In this work, we isolated and characterized mutations which affected either one of the two Shine-Dalgarno sequences of the nontranslated gltBDF operon leader region. The present study adds knowledge regarding the functionality of such sequences. To isolate mutations affecting expression of the gltBDF operon, we constructed plasmid pLLT1 (Fig. 1). pLLT1 allowed us to estimate gltBDF operon expression by monitoring P-galactosidase made from the gltB'-'lacZ protein fusion.

CSH3 cells (16) harboring pLLT1 were mutagenized with ethyl methanesulfonate (5) and spread on plates of NNminimal agar medium (6) with 0.2% lactose, 11 mM L-glutamate, 20 ,ug of chloramphenicol ml-', and 40 ,ug of 5-bromo4-cloro-3-indolyl-3-D-galactopyranoside [Sigma Chemical Co.] ml-1. In this medium, colonies of the parental strain are initially pale blue and become more bluish when incubated for over 48 h at 37°C because of the repression in gltB'-'lacZ expression exerted by glutamate (1, 4, 23). Among mutagen*

Corresponding author. 3261

3262

NOTES

J. BACTERIOL. A

.4 N

@:t olto

R

I'

CZ

IA7

H

14

H

HH

M

.0 .5

.5

. .I3

0,

OSDIS

-3" Do

bp < /II 8BmHI

B pTZIBR

pCM4

AACACACCTTATGACAGTCAGGAATTGACTGTTTCTCTAACGACTTCCCfTTTAGCCTTAAAGATAAAATC

I

72

CATTTTAATTTCAGTCATTTAATAAAGAATTTTGCGCTAAAGCACATTTCTGTACCAATAAGCTTGCCATT

143

TGACCTGTATCAGCTTTCCCGATAAGTTGGAAATCCGCTGGAAGCTTTCTGGATGAGCAGCCTGCTCATCA

-35

214 TATTTATGCAGTAATTGAGATCCCCTCTTCACCGTATTAACCGATGCGAAAAGGACAACAAGGGGGCGAAT GC

C2GGCGCGCGTATGACACGCAAACCCCGTCGCCACGCTCTTTCTGTGCCCGTGCGCAGCGGTTCGGAAG

Bai BooHI

Hindz

A

iaI

TGGGGTTCCCGCAGAGCCTGGGq2AwqTTCACGATATGTTGTACGATAAATCCCTTGAGAGGGATAACTGT 427

Sf$ at

pTZI8Rc

pLLT 7.pLLT8

93.

GGTTTCGGCCTGATCGCCCACATAGAAGGCGAACCTAGCCACAAGGTAGTGCGTACTGCAATACACGCACT

GGCCCGCATGCAGCACCGTGGCGCGATTCTCGCCGATGGTAAAACCGGCGACGGTTGCGGCTTGCTGTTAC

'a \- e< Hincl

-B

NA

660

GGGATGCTCTTCCTGAATMAAGATCCTGAACTCGCCGCTGCCGCACGCCGCATCGTTGAAGAAGAACTGCA

6S3

CGCCGTCTGTTTATCGCCCGCCGCCGCATTGAAAAGCGTCTcGAAGc6GAcAAAGAcTTcTAcGTcTGTAG

Mt

CCTGTCGAATCTGGTGAACATCTATAAAGGTCTGTGTATGCCGACGGATCTGCCGCGCTTTTATCTGGATC

,H I

hLLTIO,pLLTIIiste

FIG. 1. Scheme of construction of the pLLT family of plasmids bearing g1tB'-protein or -operon fusions. Apr and Cmr denote locations of vector genes specifying resistance to ampicillin and chloramphenicol, respectively. The sites of the restriction endonucleases used are abbreviated as follows: B, BamHI; Bg, BglII; E, EcoRI; H, HincII; He, HaeIII; S, SmaI; and Sa, SauIlIA. To construct pLLT1, we digested pMC1817 DNA with BamHI; this resulted in two fragments of 4.5 and 3.0 kbp (3). The last fragment carrying lacZ was ligated to pRSP21 (4) previously linearized with BgIII. Nucleotide sequencing of pLLT1 showed that it carries 390 bp of the gltB regulatory region, along with 1,308 bp inside the putative gltB open reading frame fused 3' to 5' to lacZ, which lacked the first 21 nucleotides at its N terminus. The cat DNA cassette was isolated as a 780-bp fragment after digestion of pMC4 DNA (Pharmacia) with BamHI. It was ligated to double-stranded pTZ18R DNA previously linearized with BamHI to produce pTZ18Rcat. To make gltB'-cat operon fusions, pLLT7, pLLT8, and pLLT9 DNAs were independently digested with EcoRI-BamHI and then with SauIIIA. The ends of the EcoRI-SauIIIA fragments were filled up with the Klenow fragment of DNA polymerase. The resulting fragments were ligated to pTZ18Rcat DNA linearized with HincII. The resulting plasmids, pLLT10, pLLT11, and pLLT12, carried the 5' untranslated gltB regions from pLLT7 (wild type), pLLT8 (gltBl r226), and pLLT9 (gltB2r227), respectively, fused 3' to 5' to the cat reporter gene. Other constructions are outlined in the text.

(compare the repression indexes of cells carrying pRSP21 with those of cells carrying pLLT plasmids [Table 1]). The nucleotide sequence of the -1,206-bp fragment subcloned into pLLT4, pLLT5, and pLLT6 was determined (Fig. 2). The mutations were shown to affect each of the two Shine-Dalgarno (GGAGG) sequences that are complementary to the 3' end of 16S rRNA. gltBlr226, identified as an inversion of two base pairs (CG to GC), affected the first base of SD1 and its upstream adjacent base. gltB2r227 was shown to be a G-to-A transition of the first base of SD2 (Fig. 2). Only gltB2r227 significantly reduced (80%) expression of its downstream mRNA (Table 1), a characteristic of mutations affecting translation initiation (7, 8, 10, 22). Hence, SD2 seems to be the preferred site at which ribosomes initiate gltB translation. It remains to be seen whether the residual P-galactosidase activity of gltB2r227 cells is borne at mutant

96 TTGCGGACCTGCGTCTGGAATCGGCCATTTGCCTGTTCCACCAGCGCTTCTCCACTAACACCGTACCGCGC 1066 TGGCCGTGGCGCAACCGTTCCGCTATCTGGCGCATAACGGTGAAATCAACACCATCACCGGTAACCGCCAA 1137 TGGGCGTGCGCGTACTTATAAATTCCAGACACCGCTTATCCCTGACCTGCACGACGCCGCACCGTTCGTC

FIG. 2. Nucleotide sequence of the -1,206-bp gltB fragments subcloned into pLL4, pLL5, and pLL6. DNA fragments were digested with EcoRI-BamHI, electrophoresed in 7.5% acrylamide gels, electroeluted, and digested with Hinfl. The four DNA fragments that were obtained from each digestion of ca. 530, 400, 180, and 80 bp (A) were blunt ended with the Klenow fragment of DNA polymerase and ligated with pTZ18R DNA previously linearized with SmaI and dephosphorylated with alkaline phosphatase. Transformation of JM103 cells (13) was followed by plating to select Apr Lac- colonies. The fragments cloned into pTZ18R, regardless of orientation, were directly sequenced upon infection of the plasmidcarrying strains with M13KO7 bacteriophage (3) to obtain singlestranded DNA (29) by the method of Sanger et al. (21) with bacteriophage T7 sequenase (28). (B) The wild-type gltB sequence we determined was that reported by Oliver et al. (19), except for the following amendments: insertion of GC at positions 608 and 609, C insertions at positions 623, 981, and 1016, the GA-l'GC substitution at positions 714 and 715, and the C-to-A substitution at position 717. The presumptive -35 and -10 regions are overlined. SD1, SD2, and their corresponding initiator codons are underlined. The CG-.GC inversion resulting from mutation gItBlr226 at SD1 and'the G->A substitution resulting from mutation gltB2r227 at SD2 are indicated by arrows.

SD2, at wild-type SD1, or at both. Since the ,-galactosidase expressed by cells carrying pLLT5 was close to the wild type (Table 1), identification of gltBl r226 as a silent mutation affecting SD1 was fortunate. To ascertain that mutations gltBlr226 and gltB2r227 affected a posttranscriptional event, we constructed plasmids with the gltBDF regulatory region from pLLT4, pLLT5, and pLLT6 (but devoid of their Shine-Dalgarno sequences) fused upstream from a cat reporter gene carrying its own translation initiation sequences, including its own Shine-Dalgarno sequence (Fig. 1). Theoretically, all three resulting plasmids (i.e., pLLT10, pLLT11, and pLLT12) should be identical and should express, within the range of experimental error, similar chlor-

VOL. 173, 1991

NOTES

3263

TABLE 1. Effects of gltBJr226 and g1tB2r227 mutations on enzyme activities generated by plasmids carrying gltB'-protein or -operon fusions' Enzyme

Glutamate synthase ,B-Galactosidase

Cloramphenicol transacetylase

a

Strain

Sp act with growth in: Glucose-15 mM Glucose-11 mM NH4Cl L-glutamate

Relevant plasmid genotype

MX614

MX614/pRSP21 MX614 MX614/pLLT4 MX614/pLLT5 MX614/pLLT6 MX614 MX614/pLLT10 MX614/pLLT11 MX614/pLLT12

104 750 0 1,076 969 210 0 1,609 1,350 1,638

gltB+D+F+ 4((gltB'-'lacZY+A+)

(F(gltBIr226'-'lacZY+A+) (D(gltB2r227'- 'lacZY+A+)

Repression indexb