American J o u r n a l of Medical Genetics 36:467-472 (1990)

Mutation Analysis of an Ashkenazi Jewish Family With Gaucher Disease in Three Successive Generations Edwin H. Kolodny, Nurit Firon, Nurit Eyal, and Mia Horowitz The Eunice Kennedy Shriuer Center, Waltham, Massachusetts (E.H.K.); The Department of Chemical Immunology, The Weizmann Institute of Science, Rehouot, Israel ( N P . , N.E., M.H.) Seven members of an Ashkenazi Jewish family with Gaucher disease in 3 successive generations were tested for the presence of the 2 common mutations known to occur in the glucocerebrosidase gene. Genomic DNA from blood or skin fibroblasts of relatives was amplified by using the PCR technique and individual mutations identified by oligonucleotides specific to the mutated sequences. Four individuals were homozygous for a mutation at amino acid 370 (370 mutation) known to occur only in type 1 disease. The other 3 affected relatives were compound heterozygotes for this mutation and for a mutation at amino acid 444 (NciI mutation) which, in the homozygous state, is associated with neurological disease. Clinical severity was more marked in the compound heterozygotes than in the homozygotes. Since the mutation is present in Ashkenazim,molecular diagnosis in families which carry the NciI mutation should prove useful in assessing their risk of the neurologic forms of Gaucher disease. KEY WORDS: mutations, polymerase chain reaction, allele specific oligonucleotides ~

INTRODUCTION Gaucher disease, first described by Gaucher [1882] as a reticuloendotheliosis, is now known to be caused by mutations in the gene for glucocerebrosidase, a lysosoma1 enzyme responsible for the metabolic breakdown of glucocerebroside. Clinical severity of the disease varies in individual patients but in all patients a distinctive type of lipid filled macrophage, the Gaucher cell, is presFkceived for publication August 7, 1989; revision received December 14,1989. Address reprint request to Edwin H. Kolodny, M.D., Shriver Center, 200 Trapelo Road, Waltham, MA 02254.

0 1990 Wiley-Liss, Inc.

ent. Almost all patients have an enlarged spleen and many have hepatomegaly and skeletal lesions. Few develop neurological signs. These are referred to as type 2 or type 3 depending, respectively, on whether the onset is in infancy or childhood and whether the disease progresses rapidly or more gradually. Most patients have a more benign course without neurological disease (type 1).Many type 1patients are of Ashkenazi Jewish ancestry [Kolodny et al., 19821. The frequency of the gene for Gaucher disease among Ashkenazi Jews is thought to be particularly high [Fried, 1973; Beighton and Sacks, 19741, according to Matoth et al. [1987] at least 4%. This probably accounts for occasional reports of Ashkenazi Jewish pedigrees with affected individuals in 2 successive generations [Bloem et al., 1936; Hsia et al., 1959; Sood and Fielding, 1971;Matoth et al., 1974, Kolodny et al., 1982;Zlotogora et al., 19861.In most of these cases, enzyme assays have confirmed an autosomal recessive pattern of transmission. Four different mutations have been identified in the gene for glucocerebrosidase. One mutation is a T+C transition in the active site [Dinur et al., 19861at amino acid residue 444 (of 497 residues in the mature protein) substituting proline for leucine and creating a new site for the restriction enzyme NciI (“NciI”mutation) [Tsuji et al., 1987; Wigderson et al., 19891. This mutated sequence occurs naturally in the glucocerebrosidasepseudogene. A second mutation, at amino acid residue 370, results from an A+G alteration producing a serine for asparagine substitution (“370” mutation) [Tsuji et al., 19881.These 2 mutations are prevalent among Gaucher patients [Firon et al., 19891. A third mutation, a h C transversion, causes a substitution of a proline residue for arginine at amino acid residue 415 and creates a recognition site for the enzyme HhaI (“HhaI”mutation) [Reiner et al., 1988; Wigderson et al., 19891. The fourth mutation was described a t amino acid residue 110, resulting from a G ; A transition substituting glycine for arginine [Graves et al., 19881.Each of the 2 latter mutations is rare and was found thus far in only one case. These mutations may be detected by amplifying the active human gene by using the polymerase chain reaction (PCR) technique and probing the amplified DNAs

468

Kolodny et al.

by hybridization with allele specific oligonucleotides (ASOs) [Firon et al., 19891. This method also permits genotyping of carriers of Gaucher disease who possess these mutations. We have used this procedure to analyze the mutations present in a n Ashkenazi Jewish family with affected members in 3 successive generations. The results obtained suggest that variations in clinical expression among the 7 members of this family with Gaucher disease could be explained by the nature of their mutant genes. MATERIALS AND METHODS Analysis of P-Glucosidase Activity White blood cells were isolated from heparinized blood as described by Kolodny and Mumford [1976]. Skin fibroblasts were grown from 3 mm punch biopsies in Dulbecco's modified Eagle medium (DMEM) supplemented with 15% fetal calf serum (Gibco), 1% glutamine, 1%sodium pyruvate, and 0.005% gentamycin at 37°C with 5%COZ. They were harvested by trypsinization one or 2 days after reaching confluency. All cell pellets were stored a t - 20°C until analysis. Acid P-glucosidase activity was assayed according to the procedure ofRaghavan et al. [19801by using 4-methylumbelliferyl-P-D-glucopyranosideas substrate (Research Products International, Mount Prospect, IL). Genomic DNA Peripheral venous blood (10-20 ml), collected into EDTA coated tubes, was mixed with a n equal volume of a solution containing 0.64 M sucrose, 20 mM Tris pH7.5, 10 mM MgClz and 2% Triton X-100. The cells were disrupted and centrifuged for 15 min at 2,600g at 4°C. The nuclear pellet was lysed with 2 ml of 24 mM EDTA, 75 mM NaC1,lO mM Tris pH 7.5 containing 0.5% SDS. Proteinase K was added to a final concentration of 150 pglml and the mixture was incubated for 12-16 h r a t 37°C. The nucleic acids were extracted twice with phenol, once with phenol-chloroform, and once with chloroform containing 1% isoamyl alcohol. Ammonium acetate was added to a final concentration of 1M followed by addition of 2 volumes of ethanol and the DNA was spooled, dried, and transferred into a tube containing 10 mM Tris pH 8.0, 1 mM EDTA. Genomic DNA from cultured cells was prepared as described by Firon et al. [1989]. DNA Amplification With Taq Polymerase Amplification with the Taq DNA polymerase (New England Biolabs, USA) was performed according to a modification of the procedure described elsewhere [Saiki e t al., 19881. A 1.036 kb region of the glucocerebrosidase gene, containing 3 of the mutations found among Gaucher patients, was amplified in a 100 p1 reaction volume containing 2 k g of genomic DNA (or 0.5 pg of plasmid DNA), 0.3 mM of each of XTPs, 0.5 pM of each oligonucleotide primer, and 10% dimethylsulfoxide in 16.6 mM ammonium sulfate, 67 mM Tris pH 8.8, 6.7 mM magnesium chloride, 10 mM DTT, 6.7 mM EDTA, and 170 pg/ml bovine serum albumin. The samples were boiled for 7 min to denature the DNA and allowed to cool at 4°C for 2 min. Two and one-half units of

Taq polymerase (New England Biolabs) were added and the samples were incubated for 5 min at 56°C followed by incubation for 2 min at 72°C. The subsequent 35 cycles consisted of a one minute denaturation step at 95"C, a 2 rnin period a t 56°C for annealing, and 3 min primer extension at 72°C. The final extension step lasted 10 min.

Slot Blot Analysis of Amplified Samples Ten microliters of the amplified samples were denatured with 0.4 M NaOH and 25 mM EDTA in a volume of 200 p,l. The samples were applied onto a Zetaprobe nylon filter (Bio-Rad),presoaked in 10 x SSC. The filters were baked for 2 h r at 80"C, rinsed in 6 x SSC and prehybridized for 30 min a t 59°C in 5 x S S P E (1xSSPE consists of 0.15 M NaC1, 10 mM sodium biphosphate, and 1 mM EDTA pH 7.4) 5xDenhardt's (50x Denhardt's = 1% polyvinyl pyrolidone, 1% bovine serum albumin, and 1%Ficoll), and 0.5% SDS and hybridized for 1h r a t 59°C in the same solution containing 8 x lo6 Cerenkov cpm of 32P-end labeled 19-mer AS0 probeb). The blots were washed twice at room temperature in 2 x SSPE containing 0.1% SDS and once for 10 min at 59°C in 5 x SSPE containing 0.1% SDS, and exposed to a n AGFA (Curix) X-ray film. To reuse the blot for hybridization with additional probes, it was washed a t room temperature in 1M NaC1,0.5 M NaOH and then in 3 M NaC1,0.5 M Tris pH 7, each time for 20-30 min. Preparation of 5'-end labeled Oligonucleotide Probes Twenty picomoles of the 19-mer synthetic oligonucleotides were end labeled with -y3'P-ATP (Amersham, 3000 Ci/nmole) for 100 min at 37°C in 15 pl containing 10 mM MgC12,lOO mM Tris pH 7.5, and 20 mM mercaptoethanol by T4 polynucleotide kinase (New England Nuclear). The labeled oligonucleotide was isolated from a 15% polyacrylamide 8 M urea gel and eluted in 1ml of 10 mM Tris pH 8.0,lmM EDTA at 37°C for 16 hr. Restriction Endonuclease Analysis Ten microliters of the amplified genomic sample was digested with 3.5 units of NciI (New England Biolabs) at 37" for 18h r in the buffer recommended by the supplier. Oligonucleotides The oligonucleotides were synthesized by Dr. Ora Goldberg, The Weizmann Institute of Science, Rehovot, Israel. RESULTS Family Pedigree The family pedigree is shown in Figure 1. The Gaucher patients are listed below: II-I. Splenomegaly was first noted in this 53-yearold man of Russian Jewish ancestry at age 21 during a bout of viral pneumonia. Six years later, he developed petechiae and because of persistent thrombocytopenia, required a splenectomy a t age 31 years. He had bypass surgery for coronary atherosclerosis at ages 41 and 49.

Mutations in a Family With Gaucher Disease I

*

r-l

11

370/NciI

T -

b 2

NCIUI I

I

111

Nclv+ I n h b 370/370

IV

1

2

(370iNciI)

370iNciI

370/370

(370/+)

3701370

370/370

370ic

Fig. 1. Pedigree of the tested family. Roman numerals refer to the generation. Genotype assignments are based on the results shown in Figure 2 and Table I. Genotypes shown in parenthesis were not determined directly but were derived from the pedigree.

He has not had bone pains, fractures, or liver enlargement. 11-4. This 67-year-oldman had a thyroidectomy for a “hot nodule”and has had occasional nosebleeds and easy bruisability. He was otherwise well until 10 years ago when splenomegaly and thrombocytopenia were discovered during a workup prior to hernia surgery. His platelet count was 40,000 when splenectomywas done 2 years later to remove a 3.6 kg spleen. He remains physically active and has not suffered any bone problems. Both of his parents are of Ashkenazi Jewish descent, his father’s family from Lithuania and his mother’s family from Poland. III-2. This 36-year-oldwoman, the daughter of 11-3, was well until age 31 when she developed pain in her right shoulder. The pain worsened and avascular necrosis of the head of the humerus was diagnosed. Follow-

469

ing a partial replacement of her right shoulder joint at age 33 years, she has shown marked improvement in the mobility of her shoulder. She bruises easily but has no other symptoms. Her spleen tip is palpable but the liver is not enlarged. 111-3. The 31-year-oldbrother of 111-2is entirely well without any history of nosebleeds, easy bruising, bone pain, or anemia. His liver and spleen are not enlarged. III-4. Another brother of 111-2is 29 years old and is also asymptomatic. He has a palpable spleen tip. IV-1. The 10-year-old son of 111-2 is a physically active youngster who bruises easily. His height and weight are normal and he is not anemic. His spleen is enlarged 4 cm below the costal margin and his liver is normal in size. IV-2. This 8-year-oldson of 111-2and brother of IV-1 also bruises easily but is otherwise well. His spleen is palpable 10 cm below the costal margin. These patients are free of any neurological disorder and there are no other known relatives with Gaucher disease. 1-1,the mother of 11-1 and 11-2, is 81 years old and has hypertension. Patients 11-2,III-1,and 111-5 are healthy.

Acid P-Glucosidase Activity Acid p-glucosidase activity in the 7 affected relatives was in the range of 10-15% of normal while carriers had levels intermediate between those of patients and normal controls (Table I). No correlation is possible in this small series between the severity of clinical manifestations in the affected persons and their levels of residual enzyme activity. Hybridization of Amplified Genomic DNA With Allele Specific Oligonucleotides DNA from 12 relatives was prepared either from whole blood or skin fibroblasts. The DNA was amplified by the PCR technique as explained under Materials and Methods. It was tested for the existence of 3 mutations,

TABLE I. Activitv of Acid B-Glucosidase and Mutations Present in Members of the Family Shown in Figure 1*

Individual 1-1 11-1 11-2 11-3 11-4 111-1 111-2 111-3 111-4 111-5 IV-1 IV-2 Normal controls Gaucher carriers Gaucher disease

Glucosidase activity (nmoleslmg proteidhr) Leukocvtes Fibroblasts 8.3 2.2 N.T. 13.1 3.3 93 374 1.5 3.3,3.8 4.4,2.0 77 11.1,14.0 4.0 56 3.4 681 k 368 2824 10.4k2.1 2.1 k 0.6

Genotvue 3701 + 3701NciI NciII + (3701+ ) 370J370 NciIJ + 3701370 3701370 3701370 3701+ 370/NciI (370/NciI)

Diagnosis Carrier Disease Carrier Carrier Disease Carrier Disease Disease Disease Carrier Disease Disease

*Symbols:370 = “370”mutation; NciI = “NciI” mutation; N.T.= not tested. Genotypes shown in parenthesis were not directly determined but were derived from pedigree analysis.

470

Kolodny et al.

namely the “NciI,”the “370,” and the “HhaI”mutations, by using AS0 hybridization. The primers used for DNA amplification correspond to nucleotides 5569 to 5588 and 6585 to 6604 of the active gene [Horowitz et al., 19891 and their sequences are 5’AACCATGATTCCCTATCTTC3’ and 5’GAGGCACATC CTTAGAGGAG3’, respectively. Results are shown in Figure 2 and Table I. (The results for the HhaI mutation are not shown since all the individuals tested were negative for this mutation.) Three of the affected individuals were heterozygous for both the “370” and “NciI” mutations while the other 4 patients were homozygous for the “370” mutation. The NciIlNciI genotype was not found in any of the individuals tested. The existence of the NciI mutation was confirmed by digestion of the amplified samples with the endonuclease NciI. The presence of an NciI cleavage site results in the conversion of the 1 kb fragment into 2 fragments of 864 and 172 nucleotides in length. As shown in Figure 3 only the 864-bp-long fragment is visible (see 877, Fig. 3). Complete digestion by NciI indicates homozygosity for the NciI mutation while partial digestion indicates heterozygosity for this mutation.

”370” mutation TACAGGAGGCTCTAGGGTA

”370“ normal TACAGGAGGITCTAGGGTA

114

JDl

m5

Ip2

m3

a2

m4

Ill

m2

I1

“Nci I” mutation AGAACGACCCGGACGCAGT

“Nci I“ normal AGAACGACCIGGACGCAGT

114

=1

114

Ull

m5

H2

m5

H2

m3

112

m3

112

m4

Jl1

m4

IIl

m2

I1

m2

I1

DISCUSSION Fig. 2. Hybridization of amplified genomic DNAs to allele specific oligonucleotides. Genomic DNAs prepared from cultured skin fiThe predilection of Gaucher disease among Ashkenazi broblasts or blood samples were amplified by using the polymerase Jews supports the notion of a high mutated gene fre- chain reaction technique. Samples ofthe amplified DNAs were fixed on quency in this population. This is strengthened by the nylon (Zeta) filters and hybridized to end labeled allele specific oligonucleotides. After appropriate washes the filters were exposed to an appearance of numerous 2 generation families with the Agfa X-ray film. disease. To our knowledge, this is the first family reported with 3 successive generations affected by Gaucher disease. In addition, a grand-uncle ofthe propositus also has the disease. NciI” genotype and their 5 Ashkenazi patients with the Two different point mutations, the “370” and “NciI,” “3701370” genotype. occur in this family. Three of the affected individuals, The NciI mutation in the homozygous state appears to 11-1, IV-1, and IV-2, were heterozygous for both muta- correlate with neurological disease [Tsuji et al., 1987; tions while 4 others were homozygous for the 370 muta- Firon et al., 19891. The only apparent exceptions, two tion. The NciUNciI genotype, which is found in type 2 5-year-old patients classified by Theophilus et al. 119891 as type 1disease, may have been too young to be certain and type 3 patients, did not occur in this family. Clinically, there appears to be a correlation between about their potential for developing neurological signs. the status of the spleen involvement in the members of Although present in this family, the NciI mutation is this family and their genotypes as determined by allele rare among Ashkenazim thus accounting for the fact specific oligonucleotide hybridization. Those individ- that the neuronopathic forms of Gaucher disease are uals with the 3701NciI genotype appear to be more af- practically non-existent among Jews (Horowitz, unfected than those with the 3701370 genotype. Patient published data). Zlotogora et al. [19861 have suggested that within 11-1required a splenectomy at age 31 and in both IV-1 and IV-2 who are children, there is significant enlarge- type 1 families, affected members of the same generament of the spleen. On the other hand, splenectomy in tion have similar clinical manifestations. In our experi11-2 was done only after he was in his sixth decade. ence, this is not always the case. In the family described Furthermore, in 2 of his 3 affected children, the spleen is here, patient 111-2has had significant bone involvement minimally enlarged and in the third, it is not enlarged. while her 2 brothers with Gaucher disease, carrying the Therefore, the spleen appears in this family to serve as a same mutation, have been entirely well. Choy [1988] marker for the 2 common type 1 genotypes with less has also reported a Gaucher type 1 family with intraserious enlargement in the case of the 3701370 genotype familial clinical variability. Currently, heterozygote detection is performed by and more significant disease in the case of the 3701NciI compound heterozygote. A similar genotype-phenotype using a n enzymatic assay for acid p-glucosidase activity. correlation was reported recently by Zimran e t al. Because of the overlap in enzyme values between carrier [1989], who found the “370lNciI” genotype in 2 of their and normal individuals and sometimes between carrier 36 Jewish patients. However, Theophilus et al. [19891 and affected patients, this assay is not totally reliable. failed to find significant clinical differences between the Amplification of genomic DNA obtained from blood and Ashkenazi Jewish patient they detected with the “3701 use of allele specific oligonucleotide hybridization

Mutations in a Family With Gaucher Disease

471

3.0 2.0k

0.5 1.5

1.0

Fig. 3. Restriction digest of amplified genomic DNAs with the enzyme NciI. Samples of the amplified genomic DNAs were digested with the restriction endonuclease NciI and electrophoresed through a 1.2% agarose gel, containing 0.5 kg/ml ethidium bromide. The arrow denotes the 864 bp fragment obtained by cleavage of the 1,036 bp amplified fragment. The small 172-bp-long fragment obtained is not visible.

should facilitate more accurate detection of carriers for the mutations causing Gaucher disease. However, it is clear to date that the prevalent mutations among Gaucher patients, namely the “NciI” and the “370” mutations, cover only about 80% of the existing alleles associated with decreased activity of p-glucosidase and Gaucher disease [Horowitz, unpublished results]. There are other rare mutations found in single families [Reiner et al., 1988; Graves et al., 19881 (Horowitz and Kolodny, unpublished results). Thus, molecular genotyping is possible for cases with the known mutations, using a combination of exclusive amplification of the glucocerebrosidase active gene and hybridization with allele specific oligonucleotides, as described in this report.

ACKNOWLEDGMENTS This work was supported by grants from the National Gaucher Foundation and the German-Israeli Foundation (to M.H.). During the period of this study, E.H.K. was the Erna and Jakob Michael Visiting Professor a t The Weizmann Institute of Science. The authors thank Marvin Natowicz, M.D., Ph.D., for the determination of leukocyte and fibroblast P-glucosidase activity of the subjects in this study. REFERENCES Beighton P, Sacks S (1974): Gaucher’s disease in Southern Africa. S Afr Med J 48:1295-1299. Bloem TF, Groen J, Postma C (1936): Gaucher’s disease. J Med N S 5517-527. Choy FY (1988): Intrafamilial clinical variability of type I Gaucher disease in a French-Canadian family. J Med Genet 25:322-325. Dinur T, Osiecki KM, Legler G, Gatt S, Desnick R J , Grabowski GA (1986): Human acid P-glucosidase: Isolation and amino acid sequence of a peptide containing the catalytic site. Proc Natl Acad Sci USA 83:1660-1664. Firon N, Eyal N, Kolodny EH, Horowitz M (1989): Genotype assignment in Gaucher disease by selective amplification of the active glucocerebrosidase gene. Am J Hum Genet 46:527-532.

Fried K (1973):Population study of chronic Gaucher’s disease. Isr J Med Sci 9:1396-1398. Gaucher P (1882):“De 1’Epithelioma Primitif de la Rate.”Thesis, Paris. Graves PN, Grabowski GA, Eisner R, Palese P, Smith FI (1988): Gaucher disease Type I: Cloning and characterization of a cDNA encoding acid P-glucosidase from an Ashkenazi Jewish patient. DNA 7:521-528. Horowitz M, Wilder S, Horowitz 2, Reiner 0, Gelbart T, Beutler E (1989): The human glucocerebrosidasegene and pseudogene: Structure and evolution. Genomics 4537-96. Hsia DY-Y, Naylor J, Bigler JA (1959):Gaucher’s disease. Report of two cases in father and son and review of the literature. N Engl J Med 261:164-169. Kolodny EH, Mumford RA (1976): Human leukocyte acid hydrolases: Characterization of eleven lysosomal enzymes and study of reaction conditions for their automated analysis. Clin Chim Acta 70:247-257. Kolodny EH, Ullman MD, Mankin HJ, Raghavan SS,Topol J , Sullivan J L (1982):Phenotypic manifestations of Gaucher disease: Clinical features in 48 biochemically verified type 1patients and comment on type 2 patients. In Desnick R, Gatt S, Grabowski G (eds): “Gaucher Disease: A Century of Delineation and Research.” New York: Alan R. Liss, Inc., pp 33-65. Matoth Y, Chazan S, Cnaan A, Gelernter I, Klibansky C (1987): Frequency of carriers of chronic (type 1)Gaucher disease in Ashkenazi Jews. Am J Med Genet 27561-565, Matoth Y, Zaiaov R, Hoffman J, Klibansky C (1974): Clinical and biochemical aspects of chronic Gaucher’s disease. Isr J Med Sci 10:1523-1529. Raghavan SS, Topol J , Kolodny E H (1980): Leukocyte P-glucosidase in homozygotes and heterozygotes for Gaucher’s disease. Am J Hum Genet 32:158-173. Reiner 0, Wigderson M, Horowitz M (1988): Characterization of the normal human glucocerebrosidase genes and a mutated form in Gaucher’s patient. In Salvayre R, Douste-Blazy L, Gatt S (eds): “Lipid Storage Disorders.” New York Plenum press, pp 29-39. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ,Higuchi R, Horn GT, Mullis KB, Erlich HA (1988): Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487-491. Sood V, Fielding J (1971): Gaucher’s disease in mother and daughter. Br Med J 1:590-591. Theophilus B, Latham T, Grabowski GA, Smith FI (1989): Gaucher disease: Molecular heterogeneity and phenotype-genotype correlations. Am J Hum Genet 45212-225.

472

Kolodny et al.

Tsuji S, Choudary PV, Martin B, Stubblefield BK, Mayor JA, Barranger JA, Ginns ET (1987): A mutation in the human glucocerebrosidase gene in neuropathic Gaucher’s disease. N Engl J Med 316:570-575. Tsuji S, Martin BM, Barranger JA, Stubblefield BR, LaMarca ME, Ginns EI (1988):Genetic heterogeneity in type I Gaucher disease: Multiple genotypes in Ashkenazi and non-Ashkenazi individuals. Proc Natl Acad Sci USA 85:2349-2352.

Wigderson M, Firon N, Horowitz Z, Wilder S, fiishberg Y, Reiner 0, Horowitz M (1989): Characterization of mutations in Gaucher patients by cDNA cloning. Am J Hum Genet 44:369-377. Zimran A, Gross E, West C, Sorge J, Kubitz M, Beutler E (1989): Prediction of severity of Gaucher’sdisease by identification of mutations a t DNA level. Lancet 2:349-352. Zlotogora J, Zaizov R, Klibansky C, Matoth Y (1986): Genetic heterogeneity in Gaucher disease. J Med Genet 23:319-322.