Multilocus Sequence Typing Scheme versus Pulsed-Field Gel Electrophoresis for Typing Mycobacterium abscessus Isolates

Updated information and services can be found at: http://jcm.asm.org/content/52/8/2881 These include: SUPPLEMENTAL MATERIAL REFERENCES

CONTENT ALERTS

Supplemental material This article cites 43 articles, 20 of which can be accessed free at: http://jcm.asm.org/content/52/8/2881#ref-list-1 Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more»

Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/

Downloaded from http://jcm.asm.org/ on August 24, 2014 by COLARADO STATE UNIV

Gabriel Esquitini Machado, Cristianne Kayoko Matsumoto, Erica Chimara, Rafael da Silva Duarte, Denise de Freitas, Moises Palaci, David Jamil Hadad, Karla Valéria Batista Lima, Maria Luiza Lopes, Jesus Pais Ramos, Carlos Eduardo Campos, Paulo César Caldas, Beate Heym and Sylvia Cardoso Leão J. Clin. Microbiol. 2014, 52(8):2881. DOI: 10.1128/JCM.00688-14. Published Ahead of Print 4 June 2014.

Multilocus Sequence Typing Scheme versus Pulsed-Field Gel Electrophoresis for Typing Mycobacterium abscessus Isolates Gabriel Esquitini Machado,a Cristianne Kayoko Matsumoto,a Erica Chimara,b Rafael da Silva Duarte,c Denise de Freitas,d Moises Palaci,e David Jamil Hadad,e Karla Valéria Batista Lima,f Maria Luiza Lopes,f Jesus Pais Ramos,g Carlos Eduardo Campos,g Paulo César Caldas,g Beate Heym,h Sylvia Cardoso Leãoa

Outbreaks of infections by rapidly growing mycobacteria following invasive procedures, such as ophthalmological, laparoscopic, arthroscopic, plastic, and cardiac surgeries, mesotherapy, and vaccination, have been detected in Brazil since 1998. Members of the Mycobacterium chelonae-Mycobacterium abscessus group have caused most of these outbreaks. As part of an epidemiological investigation, the isolates were typed by pulsed-field gel electrophoresis (PFGE). In this project, we performed a large-scale comparison of PFGE profiles with the results of a recently developed multilocus sequence typing (MLST) scheme for M. abscessus. Ninety-three isolates were analyzed, with 40 M. abscessus subsp. abscessus isolates, 47 M. abscessus subsp. bolletii isolates, and six isolates with no assigned subspecies. Forty-five isolates were obtained during five outbreaks, and 48 were sporadic isolates that were not associated with outbreaks. For MLST, seven housekeeping genes (argH, cya, glpK, gnd, murC, pta, and purH) were sequenced, and each isolate was assigned a sequence type (ST) from the combination of obtained alleles. The PFGE patterns of DraI-digested DNA were compared with the MLST results. All isolates were analyzable by both methods. Isolates from monoclonal outbreaks showed unique STs and indistinguishable or very similar PFGE patterns. Thirty-three STs and 49 unique PFGE patterns were identified among the 93 isolates. The Simpson’s index of diversity values for MLST and PFGE were 0.69 and 0.93, respectively, for M. abscessus subsp. abscessus and 0.96 and 0.97, respectively, for M. abscessus subsp. bolletii. In conclusion, the MLST scheme showed 100% typeability and grouped monoclonal outbreak isolates in agreement with PFGE, but it was less discriminative than PFGE for M. abscessus.

N

ontuberculous mycobacteria (NTM) are responsible for a broad spectrum of human diseases, such as pulmonary and disseminated infections, lymphadenopathy, and cutaneous and soft tissue infections, among others (1). The ubiquitous distribution of these organisms facilitates the contamination of medical equipment and solutions, leading to nosocomial infections and outbreaks (2–4). In recent years, there has been a significant increase in the detection of diseases caused by NTM, which can be attributed to an increase in the number of infections affecting immunocompromised patients and the number and type of invasive procedures used for cosmetic and therapeutic purposes, as well as to advances in molecular identification techniques (5). In Brazil, several outbreaks of infections by rapidly growing mycobacteria (RGM) have been detected since 1998 in patients subjected to medical invasive procedures, such as ophthalmological, laparoscopic, arthroscopic, plastic and cardiac surgeries, or cosmetic procedures, such as mesotherapy (6–10). Between 2004 and 2008, ⬎2,000 patients with surgical site infections caused by a unique strain of Mycobacterium abscessus were reported to the federal authorities in Brazil, and the problem was considered an epidemiological emergency (11). Moreover, M. abscessus is the most common RGM species isolated from pulmonary infections in some settings (12). M. abscessus sensu lato is an RGM group that includes the formerly described species M. abscessus, Mycobacterium massiliense, and Mycobacterium bolletii (13). The reunion of these three spe-

August 2014 Volume 52 Number 8

cies into a single species, that of M. abscessus, was proposed in 2009 (13) because they could not be clearly discriminated by phenotypic or molecular tests, including the gold standard, DNA-DNA hybridization. Small differences observed in the restriction profiles of a 441-bp fragment of the hsp65 gene, as analyzed by PCRrestriction enzyme analysis (PRA-hsp65) (14), in rpoB gene sequences (15), and in susceptibility to few drugs led to the division of M. abscessus in two subspecies, M. abscessus subsp. abscessus and M. abscessus subsp. bolletii, with the bolletii subspecies including former M. massiliense and M. bolletii, which share the same PRAhsp65 profile and highly similar rpoB sequences (16). This classification may well include other subgroupings that have not yet been defined. Some researchers have proposed the existence of three subspecies, based on phylogenetic trees constructed with

Received 7 March 2014 Returned for modification 14 April 2014 Accepted 9 May 2014 Published ahead of print 4 June 2014 Editor: S. A. Moser Address correspondence to Sylvia Cardoso Leão, [email protected]. Supplemental material for this article may be found at http://dx.doi.org/10.1128 /JCM.00688-14. Copyright © 2014, American Society for Microbiology. All Rights Reserved. doi:10.1128/JCM.00688-14

Journal of Clinical Microbiology

p. 2881–2891

jcm.asm.org

2881

Downloaded from http://jcm.asm.org/ on August 24, 2014 by COLARADO STATE UNIV

Departamento de Microbiologia, Imunologia e Parasitologia, Escola Paulista de Medicina, Universidade Federal de São Paulo, São Paulo, Brazila; Núcleo de Tuberculose e Micobacterioses, Instituto Adolfo Lutz, São Paulo, Brazilb; Instituto de Microbiologia Paulo de Góes, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazilc; Departamento de Oftalmologia, Escola Paulista de Medicina, Universidade Federal de São Paulo, São Paulo, Brazild; Nucleo de Doenças Infecciosas, Universidade Federal do Espírito Santo, Vitória, Espírito Santo, Brazile; Instituto Evandro Chagas, Belém, Pará, Brazilf; Centro de Referência Professor Hélio Fraga, Escola Nacional de Saúde Pública, Fiocruz, Rio de Janeiro, Brazilg; APHP, Hôpitaux Universitaires Paris Ile-de-France Ouest, Laboratoire de Microbiologie, Hôpital Ambroise Paré, BoulogneBillancourt, Franceh

Machado et al.

MATERIALS AND METHODS Mycobacterial isolates. A collection of 93 isolates of M. abscessus sensu lato were studied. Forty-five isolates were obtained during five outbreaks that occurred in eight states in Brazil and were related to mesotherapy, laparoscopic and arthroscopic surgeries, liposurgery, mammoplasty, abdominoplasty, breast implant surgery, and vaccination. Forty-eight isolates from patients not related to outbreaks were included for comparison and calculation of the discriminatory power of the MLST scheme. These isolates were obtained from respiratory (30), ophthalmological (3), and injection abscess (1) samples between 2002 and 2013 in different states from Brazil (see Table SA1 in the supplemental material). Type strains M. abscessus ATCC 19977, M. massiliense CCUG 48898, and M. bolletii CCUG 50184 were used for comparison. The original isolates were kept frozen at ⫺80°C in Middlebrook 7H9 liquid medium (BD, Sparks, MD) supplemented with oleic acid-albumin-

2882

jcm.asm.org

dextrose-catalase (OADC) (BD) and 15% glycerol. From each isolate, the isolated colonies were obtained on Middlebrook 7H10-OADC agar plates, and single colonies were used in the molecular analyses. Description of outbreaks. Outbreak 1 affected 14 patients submitted to mesotherapy, a technique involving multiple subcutaneous injections for cosmetic purposes. The outbreak occurred in a single hospital in the city of Belém, state of Pará (PA), between August and October 2004. Isolates from eight patients were obtained and identified as M. bolletii (M. abscessus subsp. bolletii under the new classification). Three different PFGE profiles were detected, indicating that it was a polyclonal outbreak (10). Isolated colonies from the same isolates were retyped by PFGE for this work, confirming the existence of three different PFGE patterns among the outbreak isolates. Outbreak 2 was a nationwide epidemic of surgical site infections related to laparoscopic and arthroscopic surgeries, which generated ⬎2,000 notifications from several states to the Brazilian federal authorities between 2004 and 2008 (10, 31–33). The study of 157 isolates from the seven states that reported the most cases showed that the infections were caused by a single strain of M. abscessus subsp. bolletii, initially identified as M. massiliense (7). This strain has a particular rpoB sequevar (GenBank accession no. EU117207), and the PFGE patterns of the typed isolates were highly similar, with differences of only 1 to 3 bands. New localized outbreaks caused by this strain occurred in the states of Amazonas (AM) and Rio Grande do Sul (RS) in 2010, when the epidemic was considered controlled. Isolates from eight states were included in this study. One to three isolates from each state were included, according to the different PFGE profiles observed, comprising a total of 16 isolates. Outbreak 3 occurred in a private clinic in the city of Vila Velha, state of Espírito Santo (ES), between February 12 and 29 July 2008. Fourteen patients subjected to liposurgery, breast implant surgery, and abdominoplasty had infections caused by M. abscessus subsp. abscessus. Nine isolates were obtained and showed indistinguishable PFGE patterns. In January 2009, a new case was detected at the same clinic. This new isolate showed a PFGE pattern that was indistinguishable from that of the previous isolates and was included in this study. Outbreak 4 occurred in the city of Campinas, state of São Paulo (SP), from 2002 to 2004, and was associated with breast implants. After the first six cases were reported, an epidemiological investigation was performed in different hospitals and 14 confirmed cases of mycobacterial infection, 14 possible cases, and one probable case were detected. Twelve of the 14 mycobacterial isolates obtained during that period were identified as Mycobacterium fortuitum, one as M. abscessus, and one as Mycobacterium porcinum (34, 35). The M. fortuitum isolates showed different molecular patterns, indicating that the outbreak was polyclonal. In 2004, the outbreak subsided until 2008, when new cases occurred in one of the studied hospitals. Most patients harbored isolates identified as M. fortuitum, showing the same molecular patterns detected in the previous period. However, three isolates were identified as M. abscessus subsp. abscessus and were included in the present study. The M. abscessus isolate from the first outbreak period (34) was not recovered. Outbreak 5 occurred in a single vaccination clinic in the city of Andradina, SP. Sixty cases were identified between January and October 2008. Infection by M. abscessus subsp. abscessus was confirmed in 18 cases, and eight isolates were typed by PFGE, showing indistinguishable patterns. Samples from water, liquid soap, syringes, needles, and vaccine vials were collected and cultivated. Several mycobacterial species were recovered from water samples, but not the particular strain that was isolated from the patients, and the sources of infection were not identified (http://www .anvisa.gov.br/divulga/newsletter/boletim_vigipos/260710/boletim _nuvig.htm). DNA extraction. A loopful of bacteria grown on Middlebrook 7H10OADC plates was suspended in 300 ␮l of TET (10 mM Tris, 1 mM EDTA, 1% Triton X-100 [pH 8.0]), boiled for 10 min, centrifuged at 14,000 ⫻ g for 2 min, and frozen at ⫺20°C for ⱖ16 h. Alternatively, the DNA was extracted using the Brazol kit (LGC Bio-

Journal of Clinical Microbiology

Downloaded from http://jcm.asm.org/ on August 24, 2014 by COLARADO STATE UNIV

data from whole-genome sequencing and single-nucleotide polymorphism (SNP) information contained in the core genomes (17–19). These studies evidenced deep genetic divisions corresponding to three different taxa, suggesting a subdivision in three subspecies, M. abscessus subsp. abscessus, M. abscessus subsp. massiliense, and M. abscessus subsp. bolletii. Recently developed schemes for multispacer sequence typing (MST) (20) and multilocus sequence analysis (MLSA) (21) confirmed the existence of three principal groups within M. abscessus sensu lato, with each containing one of the type strains (M. abscessus CIP 104536, M. massiliense CIP 108297, and M. bolletii CIP 108541). However, several reports have described isolates showing ambiguous identification by partial sequencing of different DNA targets (7, 10, 22–25), suggesting the occurrence of genetic exchange among members of the M. abscessus group and indicating that the taxonomy of M. abscessus sensu lato is far from being resolved. To avoid confusing identifications, in this work, we classified the M. abscessus isolates into one of the two accepted subspecies (16) using PRA-hsp65 and rpoB gene sequence analysis (13). Molecular typing of outbreak isolates helps epidemiological investigation and the identification of possible sources of infection (26). Ultimately, typing can contribute to outbreak control. Pulsed-field gel electrophoresis (PFGE) is usually performed when specific methods are not available for the species being studied. PFGE has good discriminatory power for separating M. abscessus subsp. abscessus and M. abscessus subsp. bolletii strains (24, 27) but is a cumbersome and time-consuming technique, requiring dedicated equipment that is not widely available. Moreover, DNA degradation associated with PFGE can occur with M. abscessus isolates (28). Schemes for MST and multilocus sequence typing (MLST) were recently developed for M. abscessus (20, 29). The MST scheme analyzes intergenic sequences, which, as a consequence of less evolutionary pressure, can show high variability (20). In the MLST scheme, single-copy housekeeping genes are sequenced, and the combination of the different gene alleles generates a sequence type (ST) and defines a strain (29). A site for the interpretation and comparison of MLST profiles is available at http: //www.pasteur.fr/recherche/genopole/PF8/mlst/Myco-abscessus .html. This study evaluated the discriminatory power of the MLST scheme developed by a group at the Institut Pasteur (29), including seven housekeeping genes, against a collection of M. abscessus isolates previously typed by PFGE, including isolates from outbreaks that occurred recently in Brazil and isolates from patients not connected to outbreaks.

MLST and PFGE of Mycobacterium abscessus

TABLE 1 Primers used for molecular identification and MLST Primer

Sequence (5= to 3=)

Position (gene)a

Reference

hsp65

Tb11 Tb12

ACCAACGATGGTGTGTCCAT CTTGTCGAACCGCATACCCT

145–164 (MAB_0650) 565–585 (MAB_0650)

14

rpoB

MycoF MycoR

GGCAAGGTCACCCCGAAGGG AGCGGCTGCTGGGTGATCATC

1100–1119 (MAB_3869c) 368–388 (MAB_3869c)

15

argH

ARGHF ARGHSR1

GACGAGGGCGACAGCTTC GTGCGCGAGCAGATGATG

1114–1131 (MAB_2342) 514–531 (MAB_2343)

23

cya

ACF ACSR1

GTGAAGCGGGCCAAGAAG AACTGGGAGGCCAGGAGC

2701–2718 (MAB_0489) 1004–1021 (MAB_0490c)

23

glpK

GLPKSF1 GLPKSFR2

AATCTCACCGGCGGTGTC GGACAGACCCACGATGGC

511–528 (MAB_0382) 1102–1119 (MAB_0382)

23

gnd

GNDF GNDSR1

GTGACGTCGGAGTGGTTGG CTTCGCCTCAGGTCAGCTC

65–83 (MAB_2412c) 930–948 (MAB_2413c)

23

murC

MURCSF1 MURCSR2

CGGACGAAAGCGACGGCT CCAAAACCCTGCTGAGCC

512–529 (MAB_2007) 1101–1118 (MAB_2007)

23

pta

PTASF1 PTASR2

GATCGGGCGTCATGCCCT ACGAGGCACTGCTCTCCC

1367–1384 (MAB_4226c) 665–682 (MAB_4226c)

21

purH

PURHSF1 PURHSR2

CGGAGGCTTCACCCTGGA CAGGCCACCGCTGATCTG

516–533 (MAB_1064) 1132–1149 (MAB_1064)

21

a

In the genome of M. abscessus ATCC 19977 (GenBank accession no. NC_010397).

tecnologia, Brazil) as follows: 100 ␮l of the bacterial suspension in TET was mixed with 300 ␮l of the Brazol reagent and agitated in a vortex for 2 min. A volume of 100 ␮l of chloroform was added, and the content of the tube was homogenized and centrifuged for 12 min at 12,000 ⫻ g and 4°C. The supernatant was mixed with the same volume of isopropanol in a new tube and incubated overnight at ⫺20°C. After centrifugation at 12,000 ⫻ g for 20 min, the supernatant was discarded. A volume of 500 ␮l of 70% ethanol was added, and the material was centrifuged for 5 min at 12,000 ⫻ g. The pellet was resuspended in 1⫻ TE (10 mM Tris 10, 1 mM EDTA [pH 8.0]) with RNase (0.4 mg/ml). Molecular identification of the isolates. (i) PRA-hsp65. A 441-bp fragment of the hsp65 gene was amplified using the primers Tb11 and Tb12 (Table 1), as described by Telenti et al. (14). The amplicons were digested in two separate tubes with BstEII and HaeIII restriction enzymes. The digestion products were visualized after electrophoresis in 3% agarose gels stained with ethidium bromide, using a 50-bp ladder as the molecular size standard. The restriction fragment sizes were estimated by visual analysis and were compared to the patterns reported at PRASITE (http://app.chuv.ch/prasite/index.html). Isolates showing the M. abscessus 1 pattern (BstEII, 235/210 bp; HaeIII, 145/70/60/55 bp) were identified as M. abscessus subsp. abscessus, and isolates showing the M. abscessus 2 pattern (BstEII, 235/210 bp; HaeIII, 200/70/60/50 bp) were identified as M. abscessus subsp. bolletii. (ii) rpoB sequencing. Region V of the rpoB gene was amplified using the MycoF and MycoR primers (Table 1) and sequenced as described by Adékambi et al. (15). The sequences were analyzed by similarity using the Basic Local Alignment Search Tool (BLAST) (http://www.ncbi.nlm.nih .gov/BLAST) against the sequences from M. abscessus ATCC 19977T, M. massiliense CCUG 48898T, and M. bolletii CCUG 50184T. The sequences showing the highest similarity with the rpoB sequence of M. abscessus ATCC 19977T led to the identification of the isolate as M. abscessus subsp. abscessus. When the rpoB sequence showed the highest similarity to the sequences from M. massiliense CCUG 48898T or M. bolletii CCUG 50184T, the isolate was identified as M. abscessus subsp. bolletii.

August 2014 Volume 52 Number 8

Multilocus sequence typing. Seven housekeeping genes were included in the MLST scheme: argH (argininosuccinate lyase), cya (adenylate cyclase), glpK (glycerol kinase), gnd (6-phosphogluconate dehydrogenase), murC (UDP N-acetylmuramate-L-Ala ligase), pta (phosphate acetyltransferase), and purH (phosphoribosylaminoimidazole carboxylase ATPase subunit). The genes were amplified using the primers depicted in Table 1. PCRs were prepared in 15 ␮l containing 1⫻ PCR buffer (75 mM Tris-HCl, 20 mM (NH4)2SO4, 0.01% [vol/vol] Tween 20 [pH 8.8]), 2 mM MgCl2, 0.4 ␮M each primer, and 2 ␮l of bacterial lysates or 0.5 to 1 ␮l of purified DNA. The obtained sequences were trimmed to the sizes indicated in the MLST site (http://www.pasteur.fr/recherche/genopole/PF8/mlst/primers _abscessus.html). Consensus sequences were constructed using the BioEdit program v.7.1.3.0 and were analyzed using the single-locus query from the MLST site (http://www.pasteur.fr/cgi-bin/genopole/PF8 /mlstdbnet.pl?page⫽oneseq&file⫽Mabscessus_profiles.xml). For each isolate, a combination of the different obtained alleles was submitted to the allelic profile query (http://www.pasteur.fr/cgi-bin /genopole/PF8/mlstdbnet.pl?page⫽profile-query&file⫽Mabscessus _profiles.xml) to obtain a sequence type (ST) number. Novel alleles and STs identified in this work were numbered and included in the MLST database. Isolates were grouped in a clonal complex (CC) when all alleles except one were identical. The efficiency of the MLST scheme was estimated through quantifying typeability, reproducibility, and discriminatory power, which were evaluated by calculating the numerical index of discrimination (D) based on Simpson’s index of diversity, as previously described (36). Pulsed-field gel electrophoresis. All isolates included in this study were previously analyzed by PFGE, according to protocols described in previous publications (7, 10, 24). With some isolates, PFGE was repeated or carried out for this work according to previously described protocols (24). The gel images were analyzed using the BioNumerics program v.5.1 (Applied Maths, Sint-Martens-Latem, Belgium). Dendrograms were pre-

jcm.asm.org 2883

Downloaded from http://jcm.asm.org/ on August 24, 2014 by COLARADO STATE UNIV

Gene

Machado et al.

TABLE 2 Isolates included in the study n

Outbreak 1 Outbreak 2

8 2 2 2 1 1 2 2 1 3 10 3 8 48

Outbreak 3 Outbreak 4 Outbreak 5 Not related to outbreaks a b

Location of isolationa

Yr of isolation

Belém, PA Belém, PA Rio de Janeiro, RJ Cuiabá, MT Vitória, ES Santo Ângelo, RS Curitiba, PR Assis, SP Carazinho, RS Manaus, AM Vila Velha, ES Campinas, SP Andradina, SP

2004 2004 2006 2006 2007 2007 2008 2008 2010 2010 2008 2008 2008

PRA-hsp65 pattern (no. of isolates) M. abscessus type 2 M. abscessus type 2

M. abscessus type 1 M. abscessus type 1 M. abscessus type 1 M. abscessus type 1 (19), M. abscessus type 2 (23), M. abscessus type 2 (6)b

AM, Amazonas; ES, Espírito Santo; MT, Mato Grosso; PA, Pará; PR, Paraná; RJ, Rio de Janeiro; RS, Rio Grande do Sul; SP, São Paulo. Ambiguous identification; rpoB sequences were more similar to that of M. abscessus subsp. abscessus.

pared using the band-based Dice unweighted-pair group method using average linkages (UPGMA) method using 1% to 2% optimization and position tolerance.

RESULTS AND DISCUSSION

Identification of isolates included in the study. The identification of the 93 isolates studied using PRA-hsp65 and rpoB sequencing in combination was congruent with all but six isolates. Forty isolates were identified as M. abscessus subsp. abscessus and 47 were identified as M. abscessus subsp. bolletii. Six isolates were not assigned to a subspecies because of divergence between the PRAhsp65 profile and the rpoB sequence analysis. They were classified as M. abscessus subsp. abscessus by rpoB sequencing and M. abscessus subsp. bolletii by PRA-hsp65 (Table 2). MLST. All genes were amplified with the isolates of the study, confirming the 100% typeability of the proposed MLST scheme. During the study, several isolates were typed two or three times, and the results were confirmed. Moreover, isolates BRA09, BRA25, BRA26, BRA28, and BRA29 were previously typed in a different laboratory and generated the same ST, indicating that MLST has good reproducibility (21). The choice of using bacterial lysates or DNA purified using a commercial kit did not seem to affect the amplification and sequencing results. In this study, amplifications were carried out without the use of the PCR kits used in the work of Macheras et al. (29). The amplification of some genes required modifications to the PCR mix. Gene murC was amplified only after adding 10% glycerol to the ultrapure water used to complete the PCR mix volume. The MgCl2 concentration was adjusted to 1.5 mM to reduce nonspecific amplifications with the glpK and argH primers. ST23 isolates generated nonspecific amplifications of the cya gene, and the sequencing performed with the forward primer was often contaminated. We located the sequence of the forward primer in the genome of isolate GO-06 (GenBank accession no. CP003699), which is an isolate from the strain that caused the Brazilian surgical site epidemics and belongs to ST23. Compared to the cya forward primer sequence (GTG AAG CGG GCC AAG AAG), the corresponding sequence of GO-06 has two mismatches (indicated by bold type) (GTG AAG CGG GCT AAA AAG) that might favor

2884 jcm.asm.org

the annealing of the forward primer to five adjacent regions that have similar sequences, which were detected with Oligo 7 Primer Analysis software (Molecular Biology Insights, Inc., CO, USA) (data not shown). Spurious annealing of the cya forward primer generated a collection of amplicons of similar sizes and explain the contamination of the sequences generated with this primer. Fortunately, sequences obtained with the cya reverse primer were used for unambiguous allele assignment of ST23 isolates. Tettelin et al. (18) observed by in silico analysis that the cya forward primer ACF would not generate amplicons with some strains and designed a new primer that was thought to be conserved across the M. abscessus group. In the MLST scheme developed by Kim et al. (37), the authors designed new primers to amplify cya and murC, but no explanation was given to justify these changes. Table 3 presents the MLST results. The pta gene showed the highest number of alleles with M. abscessus subsp. abscessus isolates. With isolates identified as M. abscessus subsp. bolletii, the genes glpK, pta, and purH showed more alleles than other genes. The argH gene showed the largest number of polymorphic sites and the highest percentage of nucleotide divergence in the observed alleles. All M. abscessus subsp. abscessus isolates showed the same glpK allele (allele 1), and no polymorphic sites were detected. Kim et al. (37) excluded the glpK gene from the MLST scheme because of the low frequency of polymorphic sites. No deletions or insertions were observed in the analyzed genes, as previously observed by Macheras et al. (29). In total, 33 STs were identified among the 93 isolates and were specific for each subspecies. Eight STs were specific to M. abscessus subsp. abscessus, 21 were specific to M. abscessus subsp. bolletii, and four were detected that were specific to the six isolates not assigned to a subspecies. Alleles from M. abscessus subsp. abscessus were not found in M. abscessus subsp. bolletii isolates and vice versa, with the exception of argH allele 3, which is specific to M. abscessus subsp. abscessus, which was observed with isolate IAL 013, which was identified as M. abscessus subsp. bolletii. The presence of alleles from one M. abscessus subspecies in isolates from another subspecies was previously observed by Macheras et al. (29).

Journal of Clinical Microbiology

Downloaded from http://jcm.asm.org/ on August 24, 2014 by COLARADO STATE UNIV

Origin

MLST and PFGE of Mycobacterium abscessus

TABLE 3 Variability in the genomic loci of the MLST scheme % nucleotide divergence among alleles

DNA fragment size (bp)

No. of alleles

No. of polymorphic sites

Minimum

Maximum

argH

abscessus bolletii

480 480

3 7

25 31

1.67 0.21

4.58 5.21

cya

abscessus bolletii

510 510

3 9

2 20

0.20 0.20

0.39 2.94

glpK

abscessus bolletii

534 534

1 10

0 15

0 0.19

0 1.87

gnd

abscessus bolletii

480 480

5 9

21 27

0.21 0.21

3.96 4.17

murC

abscessus bolletii

537 537

3 8

3 26

0.19 0.19

0.56 3.91

pta

abscessus bolletii

486 486

6 10

6 17

0.21 0.21

0.82 2.68

purH

abscessus bolletii

549 549

5 10

14 22

0.18 0.18

2.19 2.91

The six isolates not identified at the subspecies level carry M. abscessus subsp. bolletii-specific alleles, except for glpk allele 1 from isolate CRPHF 3932 and cya allele 12 from CRPHF 3452, which are specific to M. abscessus subsp. abscessus. This is a strong indication that the six isolates should be included in subspecies bolletii, thereby confirming the classification obtained by PRA-hsp65 and not that obtained by rpoB sequence analysis. The ambiguous identification of M. abscessus isolates obtained by sequence analysis of different genes was reported in several publications (22–25), suggesting the occurrence of homologous recombination after lateral gene transfer events between members of the M. abscessus group. Genetic exchange events affecting the housekeeping genes cya and glpK were observed for the first time by Macheras et al. (21, 23). We detected probable horizontal gene transfer events affecting the argH, cya, and glpK genes, and Kreutzfeldt et al. (38) observed evidence of the same events with the cya, pta, and purH genes, confirming that lateral transfer events of housekeeping genes are somewhat frequent in this group of bacteria. Comparison of MLST and PFGE patterns of outbreak isolates. This is the first large-scale comparison of M. abscessus strains typed by MLST and PFGE. The results obtained with the outbreak isolates were mostly congruent, indicating that outbreak isolates belonging to the same ST often showed indistinguishable PFGE patterns. However, there were some exceptions that will be discussed below. We showed in a previous study (10) that the eight isolates from the mesotherapy outbreak (outbreak 1) were distributed in three rpoB sequevars, all with the highest similarity to the corresponding sequence of M. bolletii CIP 108541T and three clusters by PFGE. We repeated the PFGE with isolated colonies and confirmed the three PFGE profiles, which corresponded to the three different novel STs identified in this study (Fig. 1A). All isolates from outbreak 2 showed 100% similar rpoB sequences and were included in ST23 by MLST. The PFGE patterns showed differences of 1 to 3 bands (Fig. 1B). At least one of these

August 2014 Volume 52 Number 8

bands, approximately 50 kb in length, corresponds to a plasmid that is absent in some isolates (39). Tenover et al. (40) and van Belkum et al. (26) stated that isolates differing by one to four PFGE bands could be considered closely related and therefore most likely part of the (same) outbreak. This is most likely valid in the context of habitual health care-associated outbreaks of limited duration (ⱕ6 months), which is not the case here, because surgical site infections related to this outbreak were detected from 2004 to 2010. The maintenance of rpoB sequences and MLST patterns throughout the epidemic period confirmed once more that this prolonged outbreak was caused by a unique strain. This strain may have suffered genomic changes caused by deletions, insertions, or by nucleotide substitutions in DraI restriction sites between 2004 and 2010, which caused limited band shifts in the PFGE patterns. This was not investigated here. The sequences of the MLST housekeeping genes did not change in the course of this outbreak, suggesting that MLST profiles may be more stable than PFGE patterns within M. abscessus subsp. bolletii. Interestingly, MLST and wholegenome sequencing approaches helped demonstrate that ST23 is a global strain of M. abscessus subsp. bolletii that causes pulmonary and soft tissue infections, which have been detected in Brazil, the United States, France, Germany, Malaysia, Scotland, Switzerland, and the United Kingdom (17, 29, 38). All isolates from outbreak 3 were found to belong to ST142, which was detected for the first time in this work, and displayed indistinguishable PFGE profiles, confirming that this outbreak was caused by a single strain of M. abscessus subsp. abscessus (Fig. 1C). Two STs, ST1 and ST49, were detected among the three isolates from outbreak 4. These isolates showed nonrelated PFGE profiles, indicating that PFGE was more discriminative than MLST, which detected only two different STs (Fig. 1D). These findings were expected because this polyclonal outbreak was caused by M. fortuitum, and M. abscessus was only occasionally isolated, most likely as a result of intensive laboratory analysis or due to the

jcm.asm.org 2885

Downloaded from http://jcm.asm.org/ on August 24, 2014 by COLARADO STATE UNIV

M. abscessus subspecies

Gene

Machado et al.

Downloaded from http://jcm.asm.org/ on August 24, 2014 by COLARADO STATE UNIV FIG 1 Pulsed-field gel electrophoresis (PFGE) patterns and dendrograms prepared using the BioNumerics program v.5.1 and the corresponding multilocus sequence typing (MLST) alleles and sequence types (STs) from isolates collected during the five outbreaks. (A) Outbreak 1, mesotherapy (Belém, PA, 2004). (B) Outbreak 2, laparoscopic and arthroscopic surgeries (several states, 2004 to 2010). (C) Outbreak 3, liposurgery, mammoplasty, and abdominoplasty (Vila Velha, ES, 2008 to 2009). (D) Outbreak 4, breast implant surgeries (Campinas, SP, 2004 to 2008). (E) Outbreak 5, vaccination (Andradina, SP, 2008). The states from which isolates from outbreak 2 were obtained are shown in the first column immediately to the right side of the PFGE images, with the isolate names to the right of that column. The abbreviations of the state names are as shown in Table 2. Numbers in the upper left corner in panels A, B, and D indicate percent similarity of PFGE profiles. (Some PFGE profiles from outbreak 2 were reproduced from reference 7 with permission from the publisher.)

contamination of samples or cultures. Otherwise, M. abscessus may have caused a secondary polyclonal outbreak concomitant with the major M. fortuitum outbreak. Outbreak 5 occurred in a vaccination clinic in the city of An-

2886

jcm.asm.org

dradina, SP. The epidemiologic investigation did not identify a common source of infection, but the isolates of all patients showed indistinguishable PFGE patterns and all were found to belong to ST22, which was previously detected in isolates from France and

Journal of Clinical Microbiology

MLST and PFGE of Mycobacterium abscessus

abscessus isolates not related to outbreaks. Isolates showing the same ST or belonging to a clonal complex (CC) are in boxes. (B) IAL 044 isolate, from outbreak 4, and four isolates nonrelated to outbreaks have indistinguishable PFGE patterns and belong to ST1. (C) IAL 049 isolate from outbreak 5 and IAL 063, not related to outbreaks, have indistinguishable PFGE patterns and belong to ST22. (D) Isolates from ST49 have different PFGE patterns, showing 64.99% similarity. Numbers in the upper left corner in panels A and D indicate percent similarity of PFGE profiles. (The PFGE profiles from isolates BRA25 and BRA28 were reproduced from reference 29 with permission from the publisher.)

Ireland. These results confirmed that this outbreak was caused by a single strain of M. abscessus subsp. abscessus (Fig. 1E). Comparison of MLST and PFGE patterns of isolates from patients not associated with outbreaks. Among the 48 isolates from patients not related to outbreaks, 19 were identified as M. abscessus subsp. abscessus. These isolates were found to belong to seven STs, including ST22 and especially ST1, the most frequent ST detected in this study (Fig. 2A). Half of the isolates were included in ST1, while PFGE distinguished four patterns, with 81.96% similarity, among these isolates (Fig. 2A, box 1). The high

August 2014 Volume 52 Number 8

frequency of ST1 in M. abscessus subsp. abscessus isolates was also detected by Macheras et al. (29) in isolates from France, Switzerland, Brazil, and the United States. Interestingly, isolate IAL 044 from outbreak 4 belongs to ST1, and its PFGE pattern is indistinguishable from those of four epidemiologically unrelated isolates, IAL 055, IAL 061, IAL 060, and BRA25 (Fig. 2B). The isolates IAL 063, IAL 064, and IAL 065 belong to ST22 and, together with isolate P2, which belongs to ST145, constitute a CC because they differ in the pta allele only. The PFGE patterns of these isolates are also highly similar (87.89% similarity) (Fig. 2A, box 2). The out-

jcm.asm.org 2887

Downloaded from http://jcm.asm.org/ on August 24, 2014 by COLARADO STATE UNIV

FIG 2 PFGE patterns and dendrograms prepared using the BioNumerics program v.5.1 and the corresponding MLST alleles and STs. (A) M. abscessus subsp.

Machado et al.

break 5 isolates were found to belong to ST22, and their PFGE profiles are indistinguishable from that of isolate IAL 063, which was obtained from the sputum sample of a patient in a different city and, therefore, was not epidemiologically related to the outbreak 5 isolates (Fig. 2C). Isolates EPM 25694 and EPM 13219 were found to belong to ST49, as were isolates IAL 045 and IAL 046 from outbreak 4. All ST49 isolates showed different PFGE patterns, with 64.99% overall similarity (Fig. 2D). ST49 has been detected in Malaysia and France, where it is one of the most prevalent STs (29). The D value for MLST and PFGE was calculated based on the 19 nonrelated M. abscessus subsp. abscessus isolates plus the type strain M. abscessus ATCC 19977. MLST had a D value of 0.69, which is far below the desirable value of ⱖ0.95 considered acceptable for a good typing method (26). The D value of PFGE was 0.93, showing that PFGE has a higher discriminatory capacity than MLST for M. abscessus subsp. abscessus. In a previous study, a D value of 0.97 was obtained for M. abscessus typed by PFGE, confirming the good discriminatory power of PFGE for M. abscessus (27). The 23 isolates identified as M. abscessus subsp. bolletii were distributed in 17 different STs, and ST117 and ST151 were the most common (Fig. 3). Five isolates, CRM 473, IAL 010, CRM 375, CRM 642, and B67, belong to ST117, and IAL 035 belongs to ST167, which differs from ST177 in the glpK allele, thus comprising a CC. These isolates showed three different PFGE patterns (84.93% similarity) (Fig. 3, box 1). They were obtained in four different states (Mato Grosso [MT], SP, Rio de Janeiro [RJ], and PA), and the patients were not epidemiologically related. It is possible that this is a circulating strain that has independently infected different patients. ST117 isolates were also detected in Malaysia.

2888

jcm.asm.org

Three isolates, IAL 021, IAL 028, and IAL 025, all belong to ST151, which was identified for the first time in this work, and have indistinguishable PFGE patterns (100% similarity), but no epidemiological relationship was identified between the patients carrying them (Fig. 3, box 2). They lived in different cities in the SP state, and the isolates were obtained in different years. Again, this might be a frequently occurring strain that is circulating in SP. The D values for MLST and PFGE, calculated based on the 23 epidemiologically unrelated M. abscessus subsp. bolletii isolates and the type strains M. massiliense CCUG 48898 and M. bolletii CCUG 50184, were 0.96 and 0.97, respectively, indicating that the two methods have similar discriminatory capacities for separating M. abscessus subsp. bolletii isolates. The same D value of 0.97 was obtained for PFGE in a previous study from our group, with 41 isolates showing the M. abscessus type 2 PRA-hsp65 pattern that is characteristic of M. abscessus subsp. bolletii (24). The last six isolates, for which precise subspecies identifications were not achieved by PRA-hsp65 and rpoB sequence analysis, belong to four STs. Isolates P54, CRPHF 3850, and BRA26 belong to ST34 and form a CC together with isolates CRPHF 3932 (ST170) and CRPHF 3452 (ST171). They have different PFGE patterns, with 69.25% similarity. Four ST34 isolates detected in France had rpoB sequences more similar to the rpoB sequence of M. abscessus ATCC 19977T, as did the isolates reported here. This confirms that ST34 comprises a particular group of isolates showing evidence of rpoB lateral transfer. The six isolates showed unrelated PFGE patterns, thus confirming the superior discriminatory power of PFGE for this group of isolates (Fig. 4). M. abscessus subsp. abscessus isolates formed a more uniform group by MLST. This was also evident in a previous study that evaluated a MLSA scheme with eight housekeeping genes (21).

Journal of Clinical Microbiology

Downloaded from http://jcm.asm.org/ on August 24, 2014 by COLARADO STATE UNIV

FIG 3 PFGE patterns and dendrograms prepared using the BioNumerics program v.5.1 and the corresponding MLST alleles and STs of M. abscessus subsp. bolletii isolates not related to outbreaks. Isolates showing the same ST or belonging to a clonal complex (CC) are in boxes. Numbers in the upper left corner indicate percent similarity of PFGE profiles. (Some PFGE profiles were reproduced from references 7, 24, 29, and 30 with permission from the publishers.)

MLST and PFGE of Mycobacterium abscessus

Among the three principal groups generated by MLSA, each containing one of the type strains of M. abscessus, M. massiliense, and M. bolletii, the M. abscessus branch was robust, while the M. bolletii and M. massiliense branches had relatively low bootstrap values (65 and 71%, respectively) and a diffuse appearance, particularly the M. massiliense branch. M. abscessus subsp. abscessus infections are more often respiratory than are M. abscessus subsp. bolletii infections (which are more often skin and soft tissue infections), and antibiotic treatment is more important in respiratory infection (mostly 2 or 3 antibiotics) than in skin infections (mostly macrolide treatment as monotherapy), which may imply different mutational pressures on clinical isolates from each subspecies. In conclusion, a good typing method should be capable of typing all isolates from a species, grouping isolates belonging to a single strain and discriminating between nonrelated isolates. The M. abscessus MLST scheme showed 100% typeability and grouped most isolates based on outbreak settings that were grouped by PFGE, but it was less discriminative than PFGE for M. abscessus subsp. abscessus. MLST was less discriminative than PFGE for other species, such as Salmonella enterica (41), Lactobacillus sanfranciscensis (42), Staphylococcus aureus (43), and Pseudomonas aeruginosa (44). The possibility of increasing the discriminatory power of the M. abscessus MLST scheme by including additional genes has to be evaluated in the future. The advantages of the MLST scheme cannot be overlooked. PCR and sequencing are currently available in most settings and can overcome the need to cultivate the mycobacterium. When the STs of strains responsible for monoclonal outbreaks are known, MLST can be of great help for epidemiological surveillance. Nevertheless, the implications of MLST for studies of population genetics and dynamics may be more significant than those for epidemiological investigation. We have detected strains that share MLST profiles in patients with no suspected epidemiological relationship. MLST can be used to track these strains and observe their distribution and dynamics.

2.

3.

4.

5. 6.

7.

8.

9.

10.

ACKNOWLEDGMENTS This study received financial support from Fundação de Amparo à Pesquisa do Estado de São Paulo (www.fapesp.br) (FAPESP) (grant 2011/ 18326-4). G.E.M. and C.K.M. received fellowships from FAPESP (2012/ 18038-1, 2012/07335-5, and 2013/16018-6).

REFERENCES 1. Brown-Elliott BA, Wallace RJ, Jr. 2002. Clinical and taxonomic status of pathogenic nonpigmented or late-pigmenting rapidly growing mycobac-

August 2014 Volume 52 Number 8

11.

12.

teria. Clin. Microbiol. Rev. 15:716 –746. http://dx.doi.org/10.1128/CMR .15.4.716-746.2002. Tiwari TS, Ray B, Jost KC, Jr, Rathod MK, Zhang Y, Brown-Elliott BA, Hendricks K, Wallace RJ, Jr. 2003. Forty years of disinfectant failure: outbreak of postinjection Mycobacterium abscessus infection caused by contamination of benzalkonium chloride. Clin. Infect. Dis. 36:954 –962. http://dx.doi.org/10.1086/368192. Villanueva A, Calderon RV, Vargas BA, Ruiz F, Aguero S, Zhang Y, Brown BA, Wallace RJ, Jr. 1997. Report on an outbreak of postinjection abscesses due to Mycobacterium abscessus, including management with surgery and clarithromycin therapy and comparison of strains by random amplified polymorphic DNA polymerase chain reaction. Clin. Infect. Dis. 24:1147–1153. http://dx.doi.org/10.1086/513656. Wallace RJ, Jr, Brown BA, Griffith DE. 1998. Nosocomial outbreaks/ pseudo-outbreaks caused by nontuberculous mycobacteria. Annu. Rev. Microbiol. 52:453– 490. http://dx.doi.org/10.1146/annurev.micro.52.1 .453. Tortoli E. 2009. Clinical manifestations of nontuberculous mycobacteria infections. Clin. Microbiol. Infect. 15:906 –910. http://dx.doi.org/10.1111 /j.1469-0691.2009.03014.x. Freitas D, Alvarenga L, Sampaio J, Mannis M, Sato E, Sousa L, Vieira L, Yu MC, Martins MC, Hoffling-Lima A, Belfort R, Jr. 2003. An outbreak of Mycobacterium chelonae infection after LASIK. Ophthalmology 110:276 –285. http://dx.doi.org/10.1016/S0161-6420(02)01643-3. Leão SC, Viana-Niero C, Matsumoto CK, Lima KV, Lopes ML, Palaci M, Hadad DJ, Vinhas S, Duarte RS, Lourenço MC, Kipnis A, das Neves ZC, Gabardo BM, Ribeiro MO, Baethgen L, de Assis DB, Madalosso G, Chimara E, Dalcolmo MP. 2010. Epidemic of surgical-site infections by a single clone of rapidly growing mycobacteria in Brazil. Future Microbiol. 5:971–980. http://dx.doi.org/10.2217/fmb.10.49. Sampaio JLM, Junior DN, de Freitas D, Höfling-Lima AL, Miyashiro K, Alberto FL, Leão SC. 2006. An outbreak of keratitis caused by Mycobacterium immunogenum. J. Clin. Microbiol. 44:3201–3207. http://dx.doi.org /10.1128/JCM.00656-06. Strabelli TM, Siciliano RF, Castelli JB, Demarchi LM, Leão SC, VianaNiero C, Miyashiro K, Sampaio RO, Grinberg M, Uip DE. 2010. Mycobacterium chelonae valve endocarditis resulting from contaminated biological prostheses. J. Infect. 60:467– 473. http://dx.doi.org/10.1016/j .jinf.2010.03.008. Viana-Niero C, Lima KV, Lopes ML, Rabello MC, Marsola LR, Brilhante VC, Durham AM, Leão SC. 2008. Molecular characterization of Mycobacterium massiliense and Mycobacterium bolletii in isolates collected from outbreaks of infections after laparoscopic surgeries and cosmetic procedures. J. Clin. Microbiol. 46:850 – 855. http://dx.doi.org/10.1128 /JCM.02052-07. ANVISA. 2011. Relatório descrito de investigação de casos de infecções por micobactérias não tuberculosis de crescimento rápido (MCR) no Brasil no período de 1998 a 2009. Agência Nacional de Vigilância Sanitária, Brasilia, Brazil. (In Portuguese.) http://www.anvisa.gov.br/hotsite/hotsite _micobacteria/relatorio_descrito_mcr_16_02_11.pdf. Hoefsloot W, van Ingen J, Andrejak C, Angeby K, Bauriaud R, Bemer P, Beylis N, Boeree MJ, Cacho J, Chihota V, Chimara E, Churchyard G, Cias R, Daza R, Daley CL, Dekhuijzen PN, Domingo D, Drobniewski F, Esteban J, Fauville-Dufaux M, Folkvardsen DB, Gibbons N, Gómez-

jcm.asm.org 2889

Downloaded from http://jcm.asm.org/ on August 24, 2014 by COLARADO STATE UNIV

FIG 4 PFGE patterns and dendrograms prepared using the BioNumerics program v.5.1 and the corresponding MLST alleles and STs from M. abscessus isolates not assigned to a subspecies. Numbers in the upper left corner indicate percent similarity of PFGE profiles. (Some PFGE profiles were reproduced from references 24, 29, and 30 with permission from the publishers.)

Machado et al.

13.

15.

16.

17.

18.

19.

20. 21.

22.

23.

24.

25.

2890

jcm.asm.org

26. van Belkum A, Tassios PT, Dijkshoorn L, Haeggman S, Cookson B, Fry NK, Fussing V, Green J, Feil E, Gerner-Smidt P, Brisse S, Struelens M, European Society of Clinical Microbiology and Infectious Diseases (ESCMID) Study Group on Epidemiological Markers (ESGEM). 2007. Guidelines for the validation and application of typing methods for use in bacterial epidemiology. Clin. Microbiol. Infect. 13(Suppl 3):S1–S46. http: //dx.doi.org/10.1111/j.1469-0691.2007.01732.x. 27. Sampaio JL, Viana-Niero C, de Freitas D, Höfling-Lima AL, Leão SC. 2006. Enterobacterial repetitive intergenic consensus PCR is a useful tool for typing Mycobacterium chelonae and Mycobacterium abscessus isolates. Diagn. Microbiol. Infect. Dis. 55:107–118. http://dx.doi.org/10.1016/j .diagmicrobio.2006.01.006. 28. Zhang Y, Yakrus MA, Graviss EA, Williams-Bouyer N, Turenne C, Kabani A, Wallace RJ, Jr. 2004. Pulsed-field gel electrophoresis study of Mycobacterium abscessus isolates previously affected by DNA degradation. J. Clin. Microbiol. 42:5582–5587. http://dx.doi.org/10.1128/JCM.42.12 .5582-5587.2004. 29. Macheras E, Konjek J, Roux AL, Thiberge JM, Bastian S, Leão SC, Palaci M, Sivadon-Tardy V, Gutierrez C, Richter E, Rüsch-Gerdes S, Pfyffer GE, Bodmer T, Jarlier V, Cambau E, Brisse S, Caro V, Rastogi N, Gaillard JL, Heym B. 2014. Multilocus sequence typing scheme for the Mycobacterium abscessus complex. Res. Microbiol. 165:82–90. http://dx .doi.org/10.1016/j.resmic.2013.12.003. 30. Matsumoto CK, Chimara E, Ramos JP, Campos CE, Caldas PC, Lima KV, Lopes ML, Duarte RS, Leão SC. 2012. Rapid tests for the detection of the Mycobacterium abscessus subsp. bolletii strain responsible for an epidemic of surgical-site infections in Brazil. Mem. Instit. Oswaldo Cruz, 107:969 –977. http://dx.doi.org/10.1590/S0074-02762012000800002. 31. Cardoso AM, Martins de Sousa E, Viana-Niero C, Bonfim de Bortoli F, Pereira das Neves ZC, Leão SC, Junqueira-Kipnis AP, Kipnis A. 2008. Emergence of nosocomial Mycobacterium massiliense infection in Goiás, Brazil. Microbes Infect. 10:1552–1557. http://dx.doi.org/10.1016/j.micinf .2008.09.008. 32. Duarte RS, Lourenço MC, Fonseca LdS, Leão SC, Amorim EdLT, Rocha ILL, Coelho FS, Viana-Niero C, Gomes KM, da Silva MG, Lorena NSdO, Pitombo MB, Ferreira RMC, Garcia MHdO, de Oliveira GP, Lupi O, Vilaça BR, Serradas LR, Chebabo A, Marques EA, Teixeira LM, Dalcolmo M, Senna SG, Sampaio JLM. 2009. Epidemic of postsurgical infections caused by Mycobacterium massiliense. J. Clin. Microbiol. 47: 2149 –2155. http://dx.doi.org/10.1128/JCM.00027-09. 33. Monego F, Duarte RS, Nakatani SM, Araújo WN, Riediger IN, Brockelt S, Souza V, Cataldo JI, Dias RC, Biondo AW. 2011. Molecular identification and typing of Mycobacterium massiliense isolated from postsurgical infections in Brazil. Braz. J. Infect. Dis. 15:436 – 441. http://dx.doi.org /10.1016/S1413-8670(11)70224-0. 34. Padoveze MC, Fortaleza CM, Freire MP, Brandão de Assis D, Madalosso G, Pellini AC, César ML, Pisani Neto V, Beltramelli MM, Chimara E, Ferrazoli L, da Silva Telles MA, Sampaio JL, Leão SC. 2007. Outbreak of surgical infection caused by non-tuberculous mycobacteria in breast implants in Brazil. J. Hosp. Infect. 67:161–167. http://dx.doi.org/10.1016 /j.jhin.2007.07.007. 35. Sampaio JL, Chimara E, Ferrazoli L, da Silva Telles MA, Del Guercio VM, Jericó ZV, Miyashiro K, Fortaleza CM, Padoveze MC, Leão SC. 2006. Application of four molecular typing methods for analysis of Mycobacterium fortuitum group strains causing post-mammaplasty infections. Clin. Microbiol. Infect. 12:142–149. http://dx.doi.org/10.1111/j.1469 -0691.2005.01312.x. 36. Hunter PR, Gaston MA. 1988. Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J. Clin. Microbiol. 26:2465–2466. 37. Kim SY, Kang YA, Bae IK, Yim JJ, Park MS, Kim YS, Kim SK, Chang J, Jeong SH. 2013. Standardization of multilocus sequence typing scheme for Mycobacterium abscessus and Mycobacterium massiliense. Diagn. Microbiol. Infect. Dis. 77:143–149. http://dx.doi.org/10.1016/j.diagmicrobio .2013.06.023. 38. Kreutzfeldt KM, McAdam PR, Claxton P, Holmes A, Seagar AL, Laurenson IF, Fitzgerald JR. 2013. Molecular longitudinal tracking of Mycobacterium abscessus spp. during chronic infection of the human lung. PLoS One 8:e63237. http://dx.doi.org/10.1371/journal.pone.0063237. 39. Leão SC, Matsumoto CK, Carneiro A, Ramos RT, Nogueira CL, Lima JD, Jr, Lima KV, Lopes ML, Schneider H, Azevedo VA, da Costa da Silva A. 2013. The detection and sequencing of a broad-host-range conjugative IncP-1␤ plasmid in an epidemic strain of Mycobacterium absces-

Journal of Clinical Microbiology

Downloaded from http://jcm.asm.org/ on August 24, 2014 by COLARADO STATE UNIV

14.

Mampaso E, Gonzalez R, Hoffmann H, Hsueh PR, Indra A, Jagielski T, Jamieson F, Jankovic M, Jong E, Keane J, Koh WJ, Lange B, Leao S, Macedo R, Mannsåker T, Marras TK, Maugein J, Milburn HJ, Mlinkó T, Morcillo N, Morimoto K, Papaventsis D, Palenque E, Paez-Peña M, Piersimoni C, Polanová M, Rastogi N, Richter E, et al. 2013. The geographic diversity of nontuberculous mycobacteria isolated from pulmonary samples: an NTM-NET collaborative study. Eur. Respir. J. 42: 1604 –1613. http://dx.doi.org/10.1183/09031936.00149212. Leão SC, Tortoli E, Viana-Niero C, Ueki SY, Lima KV, Lopes ML, Yubero J, Menendez MC, Garcia MJ. 2009. Characterization of mycobacteria from a major Brazilian outbreak suggests that revision of the taxonomic status of members of the Mycobacterium chelonae-M. abscessus group is needed. J. Clin. Microbiol. 47:2691–2698. http://dx.doi.org/10 .1128/JCM.00808-09. Telenti A, Marchesi F, Balz M, Bally F, Böttger EC, Bodmer T. 1993. Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis. J. Clin. Microbiol. 31:175– 178. Adékambi T, Colson P, Drancourt M. 2003. rpoB-based identification of nonpigmented and late-pigmenting rapidly growing mycobacteria. J. Clin. Microbiol. 41:5699 –5708. http://dx.doi.org/10.1128/JCM.41.12 .5699-5708.2003. Leão SC, Tortoli E, Euzéby JP, Garcia MJ. 2011. Proposal that Mycobacterium massiliense and Mycobacterium bolletii be united and reclassified as Mycobacterium abscessus subsp. bolletii comb. nov., designation of Mycobacterium abscessus subsp. abscessus subsp. nov. and emended description of Mycobacterium abscessus. Int. J. Syst. Evol. Microbiol. 61:2311– 2313. http://dx.doi.org/10.1099/ijs.0.023770-0. Bryant JM, Grogono DM, Greaves D, Foweraker J, Roddick I, Inns T, Reacher M, Haworth CS, Curran MD, Harris SR, Peacock SJ, Parkhill J, Floto RA. 2013. Whole-genome sequencing to identify transmission of Mycobacterium abscessus between patients with cystic fibrosis: a retrospective cohort study. Lancet 381:1551–1560. http://dx.doi.org/10.1016 /S0140-6736(13)60632-7. Tettelin H, Davidson RM, Agrawal S, Aitken ML, Shallom S, Hasan NA, Strong M, de Moura VC, De Groote MA, Duarte RS, Hine E, Parankush S, Su Q, Daugherty SC, Fraser CM, Brown-Elliott BA, Wallace RJ, Jr, Holland SM, Sampaio EP, Olivier KN, Jackson M, Zelazny AM. 2014. High-level relatedness among Mycobacterium abscessus subsp. massiliense strains from widely separated outbreaks. Emerg. Infect. Dis. 20:364 –371. http://dx.doi.org/10.3201/eid2003.131106. Heydari H, Wee WY, Lokanathan N, Hari R, Mohamed Yusoff A, Beh CY, Yazdi AH, Wong GJ, Ngeow YF, Choo SW. 2013. MabsBase: a Mycobacterium abscessus genome and annotation database. PLoS One 8:e62443. http://dx.doi.org/10.1371/journal.pone.0062443. Sassi M, Ben Kahla I, Drancourt M. 2013. Mycobacterium abscessus multispacer sequence typing. BMC Microbiol. 13:3. http://dx.doi.org/10 .1186/1471-2180-13-3. Macheras E, Roux AL, Bastian S, Leão SC, Palaci M, Sivadon-Tardy V, Gutierrez C, Richter E, Rüsch-Gerdes S, Pfyffer G, Bodmer T, Cambau E, Gaillard JL, Heym B. 2011. Multilocus sequence analysis and rpoB sequencing of Mycobacterium abscessus (sensu lato) strains. J. Clin. Microbiol. 49:491– 499. http://dx.doi.org/10.1128/JCM.01274-10. Kim HY, Kook Y, Yun YJ, Park CG, Lee NY, Shim TS, Kim BJ, Kook YH. 2008. Proportions of Mycobacterium massiliense and Mycobacterium bolletii strains among Korean Mycobacterium chelonae-Mycobacterium abscessus group isolates. J. Clin. Microbiol. 46:3384 –3390. http://dx.doi.org /10.1128/JCM.00319-08. Macheras E, Roux AL, Ripoll F, Sivadon-Tardy V, Gutierrez C, Gaillard JL, Heym B. 2009. Inaccuracy of single-target sequencing for discriminating species of the Mycobacterium abscessus group. J. Clin. Microbiol. 47:2596 –2600. http://dx.doi.org/10.1128/JCM.00037-09. Matsumoto CK, Chimara E, Bombarda S, Duarte RS, Leão SC. 2011. Diversity of pulsed-field gel electrophoresis patterns of Mycobacterium abscessus type 2 clinical isolates. J. Clin. Microbiol. 49:62– 68. http://dx.doi .org/10.1128/JCM.01665-10. Zelazny AM, Root JM, Shea YR, Colombo RE, Shamputa IC, Stock F, Conlan S, McNulty S, Brown-Elliott BA, Wallace RJ, Jr, Olivier KN, Holland SM, Sampaio EP. 2009. Cohort study of molecular identification and typing of Mycobacterium abscessus, Mycobacterium massiliense, and Mycobacterium bolletii. J. Clin. Microbiol. 47:1985–1995. http://dx.doi .org/10.1128/JCM.01688-08.

MLST and PFGE of Mycobacterium abscessus

sus subsp. bolletii. PLoS One 8:e60746. http://dx.doi.org/10.1371/journal .pone.0060746. 40. Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, Swaminathan B. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33:2233–2239. 41. Torpdahl M, Skov MN, Sandvang D, Baggesen DL. 2005. Genotypic characterization of Salmonella by multilocus sequence typing, pulsed-field gel electrophoresis and amplified fragment length polymorphism. J. Microbiol. Methods 63:173–184. http://dx.doi.org/10.1016/j.mimet.2005.03 .006.

42. Picozzi C, Bonacina G, Vigentini I, Foschino R. 2010. Genetic diversity in Italian Lactobacillus sanfranciscensis strains assessed by multilocus sequence typing and pulsed-field gel electrophoresis analyses. Microbiology 156:2035–2045. http://dx.doi.org/10.1099/mic.0.037341-0. 43. Xie Y, He Y, Gehring A, Hu Y, Li Q, Tu SI, Shi X. 2011. Genotypes and toxin gene profiles of Staphylococcus aureus clinical isolates from China. PLoS One 6:e28276. http://dx.doi.org/10.1371/journal.pone.0028276. 44. Johnson JK, Arduino SM, Stine OC, Johnson JA, Harris AD. 2007. Multilocus sequence typing compared to pulsed-field gel electrophoresis for molecular typing of Pseudomonas aeruginosa. J. Clin. Microbiol. 45: 3707–3712. http://dx.doi.org/10.1128/JCM.00560-07.

Downloaded from http://jcm.asm.org/ on August 24, 2014 by COLARADO STATE UNIV

August 2014 Volume 52 Number 8

jcm.asm.org 2891