MOLECULAR AND CELLULAR BIOLOGY, Mar. 1991, p. 1686-1695
Vol. 11, No. 3
0270-7306/91/031686-10$02.00/0 Copyright © 1991, American Society for Microbiology
Multicomponent Differentiation-Regulated Transcription Factors in F9 Embryonal Carcinoma Stem Cells M. K. K. SHIVJI AND N. B. LA THANGUE* Laboratory of Eukaryotic Molecular Genetics, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 JAA, England Received 23 July 1990/Accepted 18 December 1990
Murine F9 embryonal carcinoma (F9 EC) stem cells have an Ela-like transcription activity that is downregulated as these cells differentiate to parietal endoderm. For the adenovirus E2A promoter, this activity requires at least two sequence-specific transcription factors, one that binds the cyclic AMP-responsive element (CRE) and the other, DRTF1, the DNA-binding activity of which is down-regulated as F9 EC cells differentiate. Here we report the characterization of several binding activities in F9 EC cell extracts, referred to as DRTF la, lb and lc, that recognize the DRTF1 cis-regulatory sequence (-70 to -50 region). These activities can be chromatographically separated but are not distinguishable by DNA sequence specificity. Activity la is a detergent-sensitive complex in which DNA binding is regulated by phosphorylation. In contrast, activities lb and lc are unaffected by these treatments but exist as multicomponent protein complexes even before DNA binding. Two sets of DNA-binding polypeptides, p50DR and p3ODR, affinity purified from F9 EC cell extracts produce complexes lb and lc. Both polypeptides appear to be present in the same DNA-bound protein complex and both directly contact DNA. These affinity-purified polypeptides activate transcription in vitro in a binding-site-dependent manner. These data indicate the in F9 EC stem cells, multicomponent differentiationregulated transcription factors contribute to the cellular Ela-like activity.
The precise temporal and spatial control of gene expression that occurs during early metazoan development is mediated in part at the transcriptional level by sequencespecific DNA-binding proteins. This is clearly the case for early Drosophila development: temporally and spatially restricted transcription factors regulate target genes which in turn influence cellular differentiation and morphogenesis (2). Analogous systems probably function during early mammalian development, and we have sought to identify the proteins responsible for such control by using the murine embryonal carcinoma (EC) stem cell system. These cells, which are the malignant stem cells of teratocarcinomas, share a number of properties with embryonic stem cells that make up the inner cell mass of the developing blastocyst (25); moreover, they differentiate into cell types similar to those that result from inner cell mass differentiation. For example, the F9 EC cell line differentiates into parietal endoderm-like cells, one of the first differentiation events of inner cell mass stem cells (10). The F9 EC stem cell line is particularly interesting because these cells possess a transcription activity that compensates for the trans-activating function of viral Ela in the adenovirus type 5 deletion mutant dl312 (14), which lacks a functional Ela gene product required to trans activate early promoters in infected differentiated cells (17). This activity, which has been described as a cellular Ela-like activity (14), is down-regulated as F9 EC stem cells differentiate to endoderm (14), and it is an attractive possibility that this activity regulates the transcription of cellular genes during early embryonic development. We have previously defined some of the F9 EC DNAbinding proteins that are required for this transcription activity. One of these DNA-binding activities, DRTF1 (for differentiation-regulated transcription factor 1), is present at *
high levels in F9 EC cells and down-regulated as these cells differentiate to parietal endoderm (23). DRTF1 binds to a DNA sequence in the adenovirus Ela-inducible E2A promoter required for transcriptional activation of the E2A promoter in F9 EC cells but not their differentiated derivatives. In this respect, DRTF1 is a cell-specific transcription factor. The DRTF1 binding site also includes a site previously shown to bind E2F, a HeLa cell transcription factor activated in an Ela-dependent fashion during adenovirus infection (9, 19, 20, 32). The relationship of DRTF1 to E2F is unclear, but we previously characterized a number of differences between F9 EC DRTF1 and infected HeLa cell E2F (23). Another transcription activity expressed in F9 EC cells binds to the cyclic AMP-responsive element (CRE) in the E2A promoter, where it functions in concert with DRTF1. Here, we provide a detailed characterization of DRTF1. We show that in F9 EC stem cells several DNA-binding activities exist that recognize the DRTF1 binding site. These activities can be distinguished from each other by several biochemical criteria but have similar sequence specificity. Two of these activities exist as multicomponent protein complexes before DNA binding, and the DNA-binding activity affinity purified from F9 EC whole cell extracts consists predominantly of two sets of polypeptides, p5ODR and p30DR, which activate transcription in vitro in a binding-sitedependent manner. These data indicate that multicomponent transcription factors are regulated during the differentiation of F9 EC stem cells. MATERIALS AND METHODS
Cells, gel retardation, and in vitro transcription. F9 EC cells were grown as adherent monolayers as previously described (21). Preparation of whole cell extracts, in vitro transcription, primer extension, and gel retardation were performed exactly as previously described (22). Recombinant plasmids and oligonucleotides. pE2Acat con-
Corresponding author. 1686
VOL . 1 l, 1991
DIFFERENTIATION-REGULATED TRANSCRIPTION FACTORS
tains the adenovirus type 5 E2A promoter (-96 to +68) and was digested with BglII and HindlIl to yield the wild-type promoter fragment. pEC17 (14) and E2A linker scanning (LS) mutants (26) were kindly supplied by J. Nevins and B. Thimmappaya, respectively. Oligonucleotides were prepared as described previously (23). Purification of p50DR and p3QDR. Whole cell extracts prepared from F9 EC cells were loaded onto a column of heparin-Sepharose (HS; 60-ml bed volume; Pharmacia) at a flow rate of 5 ml/h and washed with 5 column volumes of NEP buffer (20 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid [HEPES; pH 7.9], 20% glycerol, 100 mM KCl, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol, 12.5 mM MgCl2, 0.2% Nonidet P-40 [NP-40], 10 mM EDTA, aprotinin [0.1 ,ug/ml], trypsin inhibitor [0.1 ,ug/ml], general protease inhibitor [0.1 V.g/ml]). The column was eluted with a linear gradient of KCl (0.1 to 1.0 M) in NEP and assayed by gel retardation. Fractions containing the specific binding activity were pooled, dialyzed into 0.1 M KCl NEP and then passed over a column of phosphocellulose P11 (20-ml bed volume; Whatman) in the same buffer (activated as recommended by the manufacturer). The column was eluted with a linear gradient of KCl from 0.1 to 1.0 M (5 ml/h), and eluent fractions were assayed for binding activity. Fractions were pooled, dialyzed into 0.1 M NEP, applied to a column of BioRex 70 (20-ml bed volume; Bio-Rad), washed, and eluted with a linear gradient of KCl from 0.1 to 1.0 M. The DNA affinity column was prepared by coupling concatenated annealed oligonucleotide 71/50 to cyanogen bromide-activated Sepharose 4B (Pharmacia) as described previously (18). The pooled fractions from the BioRex 70 column were dialyzed into 0.1 M NEP and applied to the affinity column (10 ml) in the presence of sonicated salmon sperm DNA (100 pgIml) at 5 ml/h. The column was then eluted with a linear gradient (0.1 to 1.0 M KCl); the binding activity was pooled and reapplied until p50DR and p30DR were detectable by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE). A variation of this protocol involved loading the HS pool onto a 1-ml wheat germ agglutinin (WGA)-Sepharose column (Vector Laboratories) in 0.3 M KCl NEP. After washes with 5 column volumes, the bound material was eluted by loading 0.3 M KCl NEP containing 0.3 M N-acetylglucosamine (15). Photoactivated cross-linking. Reactions were performed in binding buffer with about 3 ng of probe DNA, 2.0 ,ug of salmon sperm DNA competitor, and affinity-purified protein. Preincubation for 10 min at 30°C was followed by addition of the probe for another 10 min. The reaction mixtures were then irradiated for 15 min on a UV TM20 medium-wavelength light box, treated with 2 pLg of DNase for 4 min at 37°C, and then precipitated by the addition of trichloroacetic acid to 8%. Samples were reduced and analyzed in a 10% polyacrylamide-SDS gel. Alternatively, after irradiation samples were fractionated by gel retardation. The proteinDNA complex was excised, reduced in SDS sample buffer, and electrophoresed in a 7.5% SDS-polyacrylamide gel. RESULTS Several DNA-binding activities recognize the DRTF1 site in F9 EC stem cells. The DRTF1 binding site, which lies between -70 and -50 in the E2A promoter, in a region necessary for efficient E2A transcription in F9 EC cells in vivo, binds activities the abundance of which decreases as F9 EC cells differentiate (23). When this DNA sequence (probe 71/50; Fig. la) was used in a gel retardation assay as
a
-80
E2A
-70
-60
1687
-50
TGGAGATGACGTAGTTTTCGCGCTTAAATTTGAGAAAGGGCGC
71/50
TAGTTTTCGCGCTTAAATTTGA
62/60*
TAGTTTTCGATATTAAATTTGA
63*
TAGTTTTCTCGCTTAAATTTGA
64*
TAGTTTTAGCGCTTAAATTTGA
CRE
TGGAGATGACGTAGTTTTCGCGC
CRE-M
TGGAGATGATTTAGTTTTCGCGC b
Co
w
w a c 0 0)(.
in
(0Cs
*
a:
*
D
:Competitor
Vol. 11, No. 3
0270-7306/91/031686-10$02.00/0 Copyright © 1991, American Society for Microbiology
Multicomponent Differentiation-Regulated Transcription Factors in F9 Embryonal Carcinoma Stem Cells M. K. K. SHIVJI AND N. B. LA THANGUE* Laboratory of Eukaryotic Molecular Genetics, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 JAA, England Received 23 July 1990/Accepted 18 December 1990
Murine F9 embryonal carcinoma (F9 EC) stem cells have an Ela-like transcription activity that is downregulated as these cells differentiate to parietal endoderm. For the adenovirus E2A promoter, this activity requires at least two sequence-specific transcription factors, one that binds the cyclic AMP-responsive element (CRE) and the other, DRTF1, the DNA-binding activity of which is down-regulated as F9 EC cells differentiate. Here we report the characterization of several binding activities in F9 EC cell extracts, referred to as DRTF la, lb and lc, that recognize the DRTF1 cis-regulatory sequence (-70 to -50 region). These activities can be chromatographically separated but are not distinguishable by DNA sequence specificity. Activity la is a detergent-sensitive complex in which DNA binding is regulated by phosphorylation. In contrast, activities lb and lc are unaffected by these treatments but exist as multicomponent protein complexes even before DNA binding. Two sets of DNA-binding polypeptides, p50DR and p3ODR, affinity purified from F9 EC cell extracts produce complexes lb and lc. Both polypeptides appear to be present in the same DNA-bound protein complex and both directly contact DNA. These affinity-purified polypeptides activate transcription in vitro in a binding-site-dependent manner. These data indicate the in F9 EC stem cells, multicomponent differentiationregulated transcription factors contribute to the cellular Ela-like activity.
The precise temporal and spatial control of gene expression that occurs during early metazoan development is mediated in part at the transcriptional level by sequencespecific DNA-binding proteins. This is clearly the case for early Drosophila development: temporally and spatially restricted transcription factors regulate target genes which in turn influence cellular differentiation and morphogenesis (2). Analogous systems probably function during early mammalian development, and we have sought to identify the proteins responsible for such control by using the murine embryonal carcinoma (EC) stem cell system. These cells, which are the malignant stem cells of teratocarcinomas, share a number of properties with embryonic stem cells that make up the inner cell mass of the developing blastocyst (25); moreover, they differentiate into cell types similar to those that result from inner cell mass differentiation. For example, the F9 EC cell line differentiates into parietal endoderm-like cells, one of the first differentiation events of inner cell mass stem cells (10). The F9 EC stem cell line is particularly interesting because these cells possess a transcription activity that compensates for the trans-activating function of viral Ela in the adenovirus type 5 deletion mutant dl312 (14), which lacks a functional Ela gene product required to trans activate early promoters in infected differentiated cells (17). This activity, which has been described as a cellular Ela-like activity (14), is down-regulated as F9 EC stem cells differentiate to endoderm (14), and it is an attractive possibility that this activity regulates the transcription of cellular genes during early embryonic development. We have previously defined some of the F9 EC DNAbinding proteins that are required for this transcription activity. One of these DNA-binding activities, DRTF1 (for differentiation-regulated transcription factor 1), is present at *
high levels in F9 EC cells and down-regulated as these cells differentiate to parietal endoderm (23). DRTF1 binds to a DNA sequence in the adenovirus Ela-inducible E2A promoter required for transcriptional activation of the E2A promoter in F9 EC cells but not their differentiated derivatives. In this respect, DRTF1 is a cell-specific transcription factor. The DRTF1 binding site also includes a site previously shown to bind E2F, a HeLa cell transcription factor activated in an Ela-dependent fashion during adenovirus infection (9, 19, 20, 32). The relationship of DRTF1 to E2F is unclear, but we previously characterized a number of differences between F9 EC DRTF1 and infected HeLa cell E2F (23). Another transcription activity expressed in F9 EC cells binds to the cyclic AMP-responsive element (CRE) in the E2A promoter, where it functions in concert with DRTF1. Here, we provide a detailed characterization of DRTF1. We show that in F9 EC stem cells several DNA-binding activities exist that recognize the DRTF1 binding site. These activities can be distinguished from each other by several biochemical criteria but have similar sequence specificity. Two of these activities exist as multicomponent protein complexes before DNA binding, and the DNA-binding activity affinity purified from F9 EC whole cell extracts consists predominantly of two sets of polypeptides, p5ODR and p30DR, which activate transcription in vitro in a binding-sitedependent manner. These data indicate that multicomponent transcription factors are regulated during the differentiation of F9 EC stem cells. MATERIALS AND METHODS
Cells, gel retardation, and in vitro transcription. F9 EC cells were grown as adherent monolayers as previously described (21). Preparation of whole cell extracts, in vitro transcription, primer extension, and gel retardation were performed exactly as previously described (22). Recombinant plasmids and oligonucleotides. pE2Acat con-
Corresponding author. 1686
VOL . 1 l, 1991
DIFFERENTIATION-REGULATED TRANSCRIPTION FACTORS
tains the adenovirus type 5 E2A promoter (-96 to +68) and was digested with BglII and HindlIl to yield the wild-type promoter fragment. pEC17 (14) and E2A linker scanning (LS) mutants (26) were kindly supplied by J. Nevins and B. Thimmappaya, respectively. Oligonucleotides were prepared as described previously (23). Purification of p50DR and p3QDR. Whole cell extracts prepared from F9 EC cells were loaded onto a column of heparin-Sepharose (HS; 60-ml bed volume; Pharmacia) at a flow rate of 5 ml/h and washed with 5 column volumes of NEP buffer (20 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid [HEPES; pH 7.9], 20% glycerol, 100 mM KCl, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol, 12.5 mM MgCl2, 0.2% Nonidet P-40 [NP-40], 10 mM EDTA, aprotinin [0.1 ,ug/ml], trypsin inhibitor [0.1 ,ug/ml], general protease inhibitor [0.1 V.g/ml]). The column was eluted with a linear gradient of KCl (0.1 to 1.0 M) in NEP and assayed by gel retardation. Fractions containing the specific binding activity were pooled, dialyzed into 0.1 M KCl NEP and then passed over a column of phosphocellulose P11 (20-ml bed volume; Whatman) in the same buffer (activated as recommended by the manufacturer). The column was eluted with a linear gradient of KCl from 0.1 to 1.0 M (5 ml/h), and eluent fractions were assayed for binding activity. Fractions were pooled, dialyzed into 0.1 M NEP, applied to a column of BioRex 70 (20-ml bed volume; Bio-Rad), washed, and eluted with a linear gradient of KCl from 0.1 to 1.0 M. The DNA affinity column was prepared by coupling concatenated annealed oligonucleotide 71/50 to cyanogen bromide-activated Sepharose 4B (Pharmacia) as described previously (18). The pooled fractions from the BioRex 70 column were dialyzed into 0.1 M NEP and applied to the affinity column (10 ml) in the presence of sonicated salmon sperm DNA (100 pgIml) at 5 ml/h. The column was then eluted with a linear gradient (0.1 to 1.0 M KCl); the binding activity was pooled and reapplied until p50DR and p30DR were detectable by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE). A variation of this protocol involved loading the HS pool onto a 1-ml wheat germ agglutinin (WGA)-Sepharose column (Vector Laboratories) in 0.3 M KCl NEP. After washes with 5 column volumes, the bound material was eluted by loading 0.3 M KCl NEP containing 0.3 M N-acetylglucosamine (15). Photoactivated cross-linking. Reactions were performed in binding buffer with about 3 ng of probe DNA, 2.0 ,ug of salmon sperm DNA competitor, and affinity-purified protein. Preincubation for 10 min at 30°C was followed by addition of the probe for another 10 min. The reaction mixtures were then irradiated for 15 min on a UV TM20 medium-wavelength light box, treated with 2 pLg of DNase for 4 min at 37°C, and then precipitated by the addition of trichloroacetic acid to 8%. Samples were reduced and analyzed in a 10% polyacrylamide-SDS gel. Alternatively, after irradiation samples were fractionated by gel retardation. The proteinDNA complex was excised, reduced in SDS sample buffer, and electrophoresed in a 7.5% SDS-polyacrylamide gel. RESULTS Several DNA-binding activities recognize the DRTF1 site in F9 EC stem cells. The DRTF1 binding site, which lies between -70 and -50 in the E2A promoter, in a region necessary for efficient E2A transcription in F9 EC cells in vivo, binds activities the abundance of which decreases as F9 EC cells differentiate (23). When this DNA sequence (probe 71/50; Fig. la) was used in a gel retardation assay as
a
-80
E2A
-70
-60
1687
-50
TGGAGATGACGTAGTTTTCGCGCTTAAATTTGAGAAAGGGCGC
71/50
TAGTTTTCGCGCTTAAATTTGA
62/60*
TAGTTTTCGATATTAAATTTGA
63*
TAGTTTTCTCGCTTAAATTTGA
64*
TAGTTTTAGCGCTTAAATTTGA
CRE
TGGAGATGACGTAGTTTTCGCGC
CRE-M
TGGAGATGATTTAGTTTTCGCGC b
Co
w
w a c 0 0)(.
in
(0Cs
*
a:
*
D
:Competitor
