Neuropharmacology 97 (2015) 171e181

Contents lists available at ScienceDirect

Neuropharmacology journal homepage: www.elsevier.com/locate/neuropharm

Mu opioid receptor modulation in the nucleus accumbens lowers voluntary wheel running in rats bred for high running motivation Gregory N. Ruegsegger a, *, Ryan G. Toedebusch a, Matthew J. Will b, c, Frank W. Booth a, d, e, f a

Department of Biomedical Sciences, University of Missouri, Columbia, MO, United States Department of Psychological Sciences, University of Missouri, Columbia, MO, United States Christopher Bond Life Sciences Center, University of Missouri, Columbia MO, United States d Department of Medical Pharmacology and Physiology, University of Missouri, Columbia, MO, United States e Department of Nutrition and Exercise Physiology, University of Missouri, Columbia, MO, United States f Dalton Cardiovascular Research Center, University of Missouri, Columbia, MO, United States b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 12 February 2015 Received in revised form 24 April 2015 Accepted 19 May 2015 Available online 1 June 2015

The exact role of opioid receptor signaling in mediating voluntary wheel running is unclear. To provide additional understanding, female rats selectively bred for motivation of low (LVR) versus high voluntary running (HVR) behaviors were used. Aims of this study were 1) to identify intrinsic differences in nucleus accumbens (NAc) mRNA expression of opioid-related transcripts and 2) to determine if nightly wheel running is differently influenced by bilateral NAc injections of either the mu-opioid receptor agonist DAla2, NMe-Phe4, Glyo5-enkephalin (DAMGO) (0.25, 2.5 mg/side), or its antagonist, naltrexone (5, 10, 20 mg/side). In Experiment 1, intrinsic expression of Oprm1 and Pdyn mRNAs were higher in HVR compared to LVR. Thus, the data imply that line differences in opioidergic mRNA in the NAc could partially contribute to differences in wheel running behavior. In Experiment 2, a significant decrease in running distance was present in HVR rats treated with 2.5 mg DAMGO, or with 10 mg and 20 mg naltrexone between hours 0e1 of the dark cycle. Neither DAMGO nor naltrexone had a significant effect on running distance in LVR rats. Taken together, the data suggest that the high nightly voluntary running distance expressed by HVR rats is mediated by increased endogenous mu-opioid receptor signaling in the NAc, that is disturbed by either agonism or antagonism. In summary, our findings on NAc opioidergic mRNA expression and mu-opioid receptor modulations suggest HVR rats, compared to LVR rats, express higher running levels mediated by an increase in motivation driven, in part, by elevated NAc opioidergic signaling. © 2015 Elsevier Ltd. All rights reserved.

Keywords: mu opioid receptor Nucleus accumbens Selective breeding Physical activity Mesolimbic DAMGO

1. Introduction Understanding the neuro-molecular control of voluntary behavior is of great importance. In particular, added insight into how the brain encourages energetically demanding behavior such

Abbreviations: DAMGO, D-Ala2; NMe-Phe4, Glyo5-enkephalin; G, generation; HVR, high voluntary runner; LVR, low voluntary runner; HVRrun, HVR 14 week-old 9 week runners; LVRrun, LVR 14 week-old 9 week runners; HVRnon-run, HVR 14-weekold non-runners; LVRnon-run, LVR 14 week-old non-runners; NAc, nucleus accumbens; VTA, ventral tegmental area. * Corresponding author. Department of Biomedical Sciences, University of Missouri-Columbia, E102 Veterinary Medicine Bldg. 1600 E. Rollins, Columbia, MO 65211, United States. Tel.: þ1 573 882 6652; fax: þ1 573 884 6890. E-mail address: [email protected] (G.N. Ruegsegger). http://dx.doi.org/10.1016/j.neuropharm.2015.05.022 0028-3908/© 2015 Elsevier Ltd. All rights reserved.

as voluntary physical activity is of utmost importance for the following reasons. Data obtained with accelerometers suggest about 50% of children and greater than 90% of Americans over age 12 fail to meet US physical activity guidelines (Troiano et al., 2008). Further, lifetime physical inactivity is associated with increased risk of chronic disease and reduced lifespan, cognitive dysfunction, depression, and anxiety (Booth et al., 2012). Thus, measures should be undertaken to understand the genetic mechanisms that control exercise motivation. In a study following 772 pairs of same-sex twins, den Hoed et al. (2013) concluded that factors promoting daily physical activity and sedentary behavior are 35e47 and 31% heritable, respectively. Others concurvoluntary wheel running behavior in rodents is influenced by genetics (Lightfoot et al., 2004, 2008; Roberts et al., 2013; Swallow et al., 1998).

172

G.N. Ruegsegger et al. / Neuropharmacology 97 (2015) 171e181

Although detailed mechanisms describing the neurobiology of wheel running motivation are incomplete, substantial evidence suggests the rat mesolimbic dopaminergic pathway, specifically the nucleus accumbens (NAc), plays an important role in determining voluntary running behavior in rodents (Knab et al., 2009, 2012; Knab and Lightfoot, 2010). Since the early characterization as the neural interface between the limbic ‘motivation’ and motor systems (Mogenson et al., 1980), the NAc and its associated circuitry has been shown to mediate many motivated behaviors such as drug self-administration (Yao et al., 2006), food intake (Baldo et al., 2013), and voluntary running (Novak et al., 2012). For example, mice selectively bred to run high nightly distances display altered dopaminergic profiles compared to control lines (Mathes et al., 2010; Rhodes and Garland, 2003; Rhodes et al., 2001), and data from other rodent studies suggest genetic background (Knab et al., 2009), as well as running wheel status (Greenwood et al., 2011), influence striatal dopaminergic signaling. The interface between the limbic and motor systems appears to occur in the basal ganglia of striatal GABA/opioidergic neurons that receive dopaminergic projections from the ventral tegmental area (VTA) (Depue and Collins, 1999). Striatal GABAergic medium spiny neurons in the striatonigral “direct” pathway express the opioid dynoprphin and D1-like dopamine receptors (Gerfen and Young, 1988). On the other hand, neurons in the striatopallidal “indirect” pathway express enkephalin and D-2 like dopamine receptors (Schiffmann et al., 1991). The two pathways are thought to serve opposing roles for processing reward with direct pathway activation promoting reward and indirect pathway activation reducing reward (Kravitz et al., 2012). Therefore, alterations in opioidergic signaling activity may modulate the degree of reward associated with physical activity (Gerfen and Young, 1988). Importantly, the preferences for wheel running and locomotor activity differ in response to naloxone (Vargas-Perez et al., 2008). Further, Novak et al. have concluded that innate general cage activity is not equivalent to wheel running activity (Novak et al., 2012). Together, more recent findings suggest that the limbic system is involved in processing motivational signals that correlate with wheel running (Wang and Tsien, 2011). While substantial evidence suggests endogenous opioid signaling in the NAc regulates behavior associated with both drug (Matthes et al., 1996) and natural rewards (Bakshi and Kelley, 1993; Will et al., 2003; Zhang and Kelley, 1997), minimal attention has been focused on the relationship between voluntary running and opioids. Findings suggest opioidergic signaling influences voluntary wheel running. Specifically, mice selected for high wheel running had decreased kappa opioid receptor (Oprk1) mRNA expression in the dorsal striatum compared to non-selected mice (Mathes et al., 2010), and 6 weeks of wheel running up-regulated delta opioid receptor (Oprd1) mRNA expression in the NAc (Greenwood et al., 2011). Likewise, intraperitoneal injection of the non-specific opioid receptor antagonist naloxone has been shown to suppress wheel running (Sisti and Lewis, 2001). To further study the genetic contributions influencing voluntary exercise, we recently developed a selectively bred rat model for both low (LVR) and high (HVR) nightly wheel running behavior (Roberts et al., 2013). Given the above implications that the opioiddopamine system in the NAc might have on voluntary running, we hypothesized HVR rats would have increased opioid signaling compared to LVR rats. In Experiment 1, we sought to examine opioid signaling mRNA expression in the NAc of 14-week old LVR versus HVR rats with either a) no running wheel access, or b) 9weeks of voluntary wheel running. We next performed (Experiment 2) intra-accumbens administration of the mu opioid agonist D-Ala2, NMe-Phe4, Glyo5-enkephalin (DAMGO) or the opioid receptor antagonist naltrexone to determine if directly activating or

blocking opioid signaling in the NAc impacts voluntary wheel running distance. 2. Materials and methods 2.1. Animals and experimental procedures Female rats from the 11the13th generations (G) of an artificial selection experiment for the production of a complex polygenic model of either high or low voluntary wheel running were used, thus a limitation of our study as we cannot analyze sex differences. Female rats were employed for this study due to the fact that females usually run further than males (Jones et al., 1990; Pitts, 1984). Further rationale for usage of female rats is that their body mass plateaus, minimizing the effect of continued body mass growth past 1 years of age in male rats; our recent papers have been using female rats; and our usage of female rats balances the predominance of male rodents in the literature. However, an interesting characteristic of females is their exhibition of voluntary running distance varying with their 4-day estrous cycle (i.e., running distance peak every 4th night), with peak running occurring at proestrus (Anantharaman-Barr and Decombaz, 1989). The major characteristics of our HVR and LVR lines have been previously described (Roberts et al., 2013). In brief, the founding population consisted of outbred Wistar rats (Charles River Raleigh, Raleigh, NC). Thirteen families were bred for high voluntary wheel running (HVR lines) and thirteen families were bred for low voluntary wheel running (LVR lines), using the selective strategies of Britton and Koch (Koch and Britton, 2001). In each generation rats were provided access to running wheels (circumference: 1.062 m) (Tecniplast 2154, Tecniplast, Italy) and running distance and time were monitored from 28 to 34 days of age using Sigma Sport BC 800 bicycle computers (Cherry Creek Cyclery, Foster Falls, VA). Within each HVR and LVR family the highest (HVR) or lowest (LVR) running distance, respectively, male and female were chosen as breeders based upon running distance during nights 5 and 6 of the selection period, based upon Garland (Swallow et al., 1998). Rats were maintained in a 12:12-h light/dark cycle at 21e22  C, and food (Formulab Diet 5008, Purina) and water were provided ad libitum throughout the entirety of the experiment for all rats. The authors used laboratory animals following the National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023, revised 1978). The Institutional Animal Care and Use Committee at the University of MissourieColumbia approved all animal experiments. All efforts were made to minimize animals suffering and to reduce the number of animals used. 2.2. Experiment 1 G 11-12 female HVR (n ¼ 16) and LVR (n ¼ 16) rats were weaned at 21 days of age, and at 5 weeks of age rats were either provided access to a voluntary running wheel or remained housed without running wheels. Thus, four experimental groups were used: HVR or LVR without running wheels (HVRnon-run, LVRnon-run), or HVR or LVR with running wheels (HVRrun, LVRrun) (n ¼ 8 per group). Regardless of wheel status, all rats were individually housed. These respective treatments were maintained for 9 weeks. Nightly voluntary wheel running distance and time were monitored using Sigma Sport BC 800 bicycle computers (Cherry Creek Cyclery, Foster Falls, VA). Following the 9-week study duration, rats were sacrificed between 1700 and 1900, which is up to two hours prior to the dark cycle, with carbon dioxide asphyxiation. This sacrificial point was chosen as a basal observational time-point in order to avoid acute running-induced differences in mRNA expression that could likely exist upon the onset of the dark cycle. Similarly, because female rats have a running rhythm that is influenced by estrogen, rats were sacrificed on the night of proestrus, as determined with vaginal cytology. 2.2.1. RNA isolation and cDNA synthesis During sacrifices, brains were quickly removed and NAc tissue was extracted using a 2 mm-thick punch tool and brain sectioning apparatus (Braintree Scientific, Braintree, MA). Tissue plugs from 2 mm-thick coronal brain slices, which were identified as being NAc per a rat brain atlas published by Paxinos and Watson (Paxinos and Watson, 1998), were placed in 400 mL of ice-cold TRIzol reagent (Invitrogen, Carlsbad, CA) and stored at 80  C until processing. During tissue processing, samples were lysed in Tri Reagent using RNase-free stainless steel beads and shaken twice at 20 Hz for 1 min using a high-speed shaking apparatus (Tissuelyser LT, Qiagen, Valencia, CA). RNA was then separated according to manufacturer's instructions (TRIzol, Invitrogen, Carlsbad, CA). RNA was quantified using Nanodrop 1000 (Thermo Scientific), and the lack of RNA degradation was verified using a 1% agarose gel. One mg of RNA was DNase treated using DNase I (Thermo Scientific, Glen Burnie, MD) and reverse transcribed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Carlsbad, CA). 2.2.2. qRT-PCR for nucleus accumbens mRNA expression patterns Gene-specific primers were constructed using PrimerExpress3.0 software (Applied Biosystems) (Table 1), and efficiency curves were produced for all primers. Primer efficiencies ranged between 90 and 110% for all genes. Twenty-five nanograms of cDNA from each sample were assayed in duplicate for the target genes shown in Table 1 using SYBR Green Mastermix (Applied Biosystems, Carlsbad, CA).

G.N. Ruegsegger et al. / Neuropharmacology 97 (2015) 171e181

173

Table 1 Primer sequences for gene expression analyzed by qRT-PCR. Gene

Forward (50 e30 )

Reverse (50 e30 )

Accession no.

18S Oprm1 Oprd1 Oprk1 Penk Pdyn Drd1 Drd2 Drd5

GCCGCTAGAGGTGAAATTCTTG CGATTCCAGAAACCACATTTCA TGGTATGCACGCTCCAGTTC GCAATTCGCGATCGGAGC GAAGACAGGACTCCCCAAGG AGGATGGGGATCAGGTAGGG TCTCCTGGGCAATACCCTTGT GTCCTGGTACGATGACGATCTG CAACTCAATTGGCACAGAGACAA

CATTCTTGGCAAATGCTTTCG TGTTCGTGTAACCCAAAGCAAT GAACACGCAGATCTTGGTCACA TCCGCGGAAAATCTGGATGG GCATTCTGTCTTCCTGGAGGT CTTAAGCTTGGGGCGAATGC GGACCTCAGGTGTCGAAACC CCTTCCCTTCTGACCCATTG TTGGACAGCAGGCCCTCTT

NR_046237.1 NM_013071.2 NM_012617.1 NM_017167.2 NM_017139.1 NM_019374.3 NM_012546.2 NM_012547.1 NM_012768.1

mRNA expression values were quantified using the 2DDCt method, whereby DCT ¼ 18S Ct e gene of interest Ct, and then normalized to HVRnon-run values. The range of fold changes was calculated from the standard error of the DDCt values. 2.3. Experiment 2 At the completion of experiment mentioned above, an additional set of G13 female HVR and LVR rats were used to determine if intra-accumbens injection of the selective mu-opioid receptor agonist DAMGO (0.25, 2.5 mg/0.5 ml) and antagonist naltrexone (5, 10, 20 mg/0.5 ml) influences voluntary running behavior. Rats were weaned at 21 days of age, and provided access to voluntary running wheels at 5 weeks of age. After 6 days of running, rats in the HVR line that met a running threshold of 30 total km and rats in the LVR line that did not exceed a running threshold of 4 total km were used in the intra-accumbens injection experiment (n ¼ 9 HVR and n ¼ 8 LVR, respectively). The threshold has been used previously (Roberts et al., 2012), and ensures the existence of high and low running phenotypes for HVR and LVR, respectively. One HVR and one LVR rat failed to meet the criteria and were removed from the study. 2.3.1. Surgery and injection protocol After meeting the 6-day running threshold selection criteria described, rats were acclimated to running wheels for 3 weeks prior to the surgical procedure of inserting brain cannulae (by 3 weeks voluntary running distances had plateaued for all rats). On the day of the surgery, animals (200e250 g) were anesthetized with an intraperitoneal injection of a mixture of ketamine (87 mg/kg) and xylazine (13 mg/ kg). The heads of the animals were shaved, and animals were positioned in a stereotaxic frame (David Kopf Instruments, Tunjunga, CA) and 10-mm, 23-gauge guide cannulae were bilaterally positioned 2.5 mm above the NAc using the coordinates as follows (in mm relative to Bregma): anteroposterior (AP) 1.30, mediolateral (ML) ± 1.85 mm, dorsoventral (DV) 4.63 mm (Whishaw et al., 1977). These coordinates were chosen to target the same region analyzed in Experiment 1, which had included both shell and core regions of the nucleus accumbens. Skull screws and dental cement were used to secure guide cannulae and 10-mm, 30-gauge stylets were inserted into the guide cannulae to prevent occlusions. Following surgery, animals were warmed on a 32  C heating pad for one-two hours and topical Neosporin was applied around the surgical area. Following initial recovery, rats were placed back into their home cages with running wheels and monitored for up to 8 days to ensure running patterns returned to pre-surgical values. Note that the running pattern of each rat was monitored for several weeks to determine a voluntary running periodicity and to establish anticipated high running nights for drug injections. During the day prior to proestrus of the estrous cycle, which is the night of peak running distance (Anantharaman-Barr and Decombaz, 1989), injections took place 30 min prior to the start of the dark cycle, when some rats were beginning to wake up. Running distance and food intake were immediately recorded. To perform the injections, rats were gently hand-restrained for 90 s and 10-mm Hamilton syringes were mounted to an infusion pump (Harvard Apparatus, Holliston, MA). 12.5-mm, 30-gauge injector cannulae were connected to the Hamilton syringes with PE-10 tubing that was used to deliver one of the following solutions in a counterbalanced order: a) sterile saline, b), DAMGO dissolved in sterile saline (Sigma, St. Louis, MO), and c) naltrexone dissolved in sterile saline (Sigma, St. Louis, MO) at a rate of 0.32 ml/min. The injectors remained in place for 60 s following the injection completion to ensure that saline/drug was properly infused, and upon completion of the injections, rats were returned to their home cages to monitor nightly wheel running. Drug concentrations were determined from a pilot study using HVR rats (n ¼ 2), which suggested the selected doses influenced wheel running (unpublished data). We acknowledge the select doses of DAMGO may make interpretations of changes in wheel running difficult given that these doses have been shown increase food intake, however the selected doses of naltrexone have been previously shown to be subthreshold doses that do not impact food intake (Will et al., 2006). To determine the effect of DAMGO on wheel running in the absence of food, additional bilateral injections of 0.25 and 2.5 mg/0.5 ml DAMGO, with food temporarily removed during hours 0e2, was performed in HVR (n ¼ 4) and LVR (n ¼ 7) rats. Due to the

outwardly acute effects that the drugs were exerting, analysis of running data was only performed during hours 0e2 (1900e2100) of the dark cycle. We chose this timeframe because running patterns are more homogeneous among rats during this, as period compared to later time periods when some rats had long periods of not running so that they ran much less over the timeframe than rats that maintained running (data not shown). On the night of injection, food hopper weights were recorded at the times 1900, 2000, and 2100 h (immediately prior, and 1 and 2 h, respectively, into the dark cycle). Following the methods of Rhodes and Garland (2003), each rat functioned as its own control, and to ensure no handling or residual drug effects were present, the following precautions were taken: a) saline injections were performed prior to each drug schedule in order to minimize the injection and handling effects on running distances, b) running distances during the night following each injection were compared across injection and pre-injection to determine if a treatment residually influenced running behavior, and c) saline was injected at the end of each drug schedule and compared to previous saline injections to ensure animals did not increase their running during the drug schedule. 2.3.2. Verification of cannulae placement The methods of Parker et al. (2010) were used to determine cannulae placement. In brief, the day following the final saline injection, rats were sacrificed via carbon dioxide asphyxiation and transcardially perfused with 4% paraformaldehyde diluted in 0.1 M phosphate buffer. After removal, brains were stored in 4% paraformaldehyde overnight at 4  C. Subsequently, brains were placed in 30% sucrose in 0.01 M phosphate buffer at 4  C until they sank in the sucrose solution (48e72 h). Brains were then frozen until processing. During processing, brains were mounted in OCT media, frozen for 20 min in a cryostat sectioning apparatus, and sectioned in the coronal plane to slices 40-mm thick. Sections containing tracks from injectors were mounted on charged microscopy slides, stained with cresyl violet, and examined using a light microscope to determine if correct cannulae placement had been made. The endpoint of each injector was mapped on a rat brain atlas (Paxinos and Watson, 1998) as presented in Fig 1. 2.4. Statistical analysis All analytical procedures were performed using SigmaPlot 12.0 (Systat Software, Inc., Chicago, IL). All values are presented as mean ± SE. Significance for all analyses was set with an alpha value of 0.05. Outcome measures for between-group and within-group comparisons were analyzed using a two-way analysis of variance (ANOVA) [Line (HVR vs. LVR)  Activity (Run vs. Sed)]. Within group variables (i.e. hour to hour running and food consumption data on injection night, etc.) were analyzed using one-way repeated measures ANOVAs. Significant main effects were followed by Holm-Sidak post hoc comparisons. Student's t-test was used to compare between-line differences in running distance, time, and velocity. Deviations to these statistical analyses are reported in figure legends.

3. Results 3.1. Experiment 1: opioidergic expression differences between HVR and LVR rats 3.1.1. Running distance, bodyweight, and food intake For the entirety of the study, HVR rats ran on average roughly 9fold greater distance (21.22 ± 0.74 km vs. 2.28 ± 0.40 km; p < 0.001), 6-fold greater time (344.52 ± 13.29 min. vs. 56.45 ± 9.25 min; p < 0.001), and 1.5-fold greater velocity (61.73 ± 1.25 m/min vs. 41.91 ± 2.45; p < 0.001 m/min), as compared to LVR rats (Fig. 2). At the time of sacrifice, bodyweights of HVR were significantly less than LVR within both the non-run (p ¼ 0.002) and run (p < 0.001) conditions (Fig. 3a). Likewise, bodyweight was less in the

174

G.N. Ruegsegger et al. / Neuropharmacology 97 (2015) 171e181

(F1,28 ¼ 4.341, p ¼ 0.046) in the HVR compared to LVR line (Fig. 4a). Post-hoc analysis revealed significantly increased Pdyn in only HVRnon-run compared to LVRnon-run (p ¼ 0.027) (Fig. 4d). No differences existed between the HVR and LVR lines for Oprd1 (F1,28 ¼ 3.417, p ¼ 0.075), and Oprk1 (F1,28 ¼ 0.665, p ¼ 0.42) (Fig. 4bec). A main-effect of wheel access was present for Penk (F1,28 ¼ 8.879, p ¼ 0.006). Intriguingly, post-hoc analysis revealed proenkephalin (Penk) expression was greater in LVRrun compared to HVRrun (p ¼ 0.006), and greater in LVRrun (p ¼ 0.010) compared to LVRnon-run (Fig. 4e). Additionally, we observed increased expression of dopamine D1 receptor (Drd1) (F1,28 ¼ 8.001, p ¼ 0.009), dopamine D2 receptor (Drd2) (F1,28 ¼ 6.585, p ¼ 0.016), and dopamine D5 receptor (Drd5) (F1,28 ¼ 11.037, p ¼ 0.003) in the HVRnon-run compared to LVRnon-run (Table 2). 3.2. Experiment 2: NAc DAMGO or naltrexone injection 3.2.1. Wheel running response to drug injections Data demonstrating running patterns during the 2-h period of the dark cycle following injection of either a control vehicle saline (Sal), 0.25 or 2.5 mg per side of DAMGO (mu-opioid receptor agonist), or 5, 10, or 20 mg per side of naltrexone (opioid receptor antagonist) is shown in Fig. 5. An overall ANOVA showed a significant effect of treatment on running distance during hours 0e1 (1900e2000) of the dark cycle in HVR rats (F5,40 ¼ 4.007, p ¼ 0.005). Post-hoc analysis revealed wheel running was decreased compared to Sal (0.64 ± 0.19 km) following 2.5 mg DAMGO administration (0.09 ± 0.03 km; p ¼ 0.011), and following 10 mg naltrexone (0.14 ± 0.06 km; p ¼ 0.037) and 20 mg naltrexone (0.11 ± 0.06 km; p ¼ 0.015) administration (Fig. 5a). No significant differences were found during the 0e1 h period in LVR rats (F5,35 ¼ 1.161, p ¼ 0.348), possibly due to low running distance (Fig. 5b). Between hours 1e2, an overall ANOVA showed a no significant effect of treatment on running distance in HVR (F5,40 ¼ 1.363, p ¼ 0.259) or LVR (F5,35 ¼ 1.266, p ¼ 0.300) rats (Fig. 5c,d). Temporary food removal during hours 0-2 of the dark cycle did not impact wheel running following injection of either DAMGO dose in HVR or LVR rats (p > 0.05 for both lines over the 0e1 and 1e2 intervals) (Fig. 6). HVR and LVR rats did not demonstrate any enhancement or decrement in running distances (i.e. repeated injection effects) when comparing the second saline control injection (pre-drug injection) running distance with a final saline running distance following the completion of all drug injections (p > 0.05, data not shown). Body masses of HVR were significantly less than LVR at the time of surgery (215 g vs. 238 g) and of sacrifice (236 g vs. 277 g), respectively (p < 0.05). Fig. 1. Coronal section of rat brain, as per Paxinos and Watson (1998), which shows the cannulae location as determined by cresyl violet staining (with position of each section given in mm relative to Bregma). Gray dots rep resent the location of injector tips. Due to tissue damage during staining, cannulae placement was not determined for one HVR rat.

wheel groups at sacrifice in the HVR (p ¼ 0.017), but not LVR, line (p ¼ 0.40) (Fig. 3a). For the complete study duration average food intakes did not differ between HVRnon-run, as compared to LVRnon-run (20.6 ± 0.9 g/day vs. 20.1 ± 0.7 g/day, respectively; p ¼ 0.567). In contrast, food intake was greater in HVRrun compared to LVRrun (25.3 ± 0.5 vs. 18.9 ± 0.8; p < 0.001) (Fig 3b). Wheel access increased food intake in the HVR line (p < 0.001) but not LVR line (p ¼ 0.72). 3.1.2. NAc mRNA expression NAc opioid-related transcripts are presented in Fig. 4. Significant line effects happened for transcript expressions of mu opioid receptor (Oprm1) (F1,28 ¼ 24.389, p < 0.001) and prodynorphin (Pdyn)

3.2.2. Food intake Data demonstrating food intake following injection of either Sal, 0.25 or 2.5 mg per side of DAMGO, or 5, 10, or 20 mg per side of naltrexone is shown in Fig. 7. An overall ANOVA showed a significant effect of treatment between hours 0e1 into the dark cycle in HVR (F5,40 ¼ 3.797, p ¼ 0.007) and LVR (F5,35 ¼ 4.078, p ¼ 0.005) rats. Post-hoc analysis revealed HVR rats consumed more food following 0.25 mg (1.76 ± 0.15 g; p ¼ 0.01) and 2.5 mg DAMGO (2.83 ± 0.72 g; p ¼ 0.025) administration compared to Sal (1.10 ± 0.15 g) (Fig 7a), and LVR rats consumed more food following 0.25 mg DAMGO (2.69 ± 0.80 g; p ¼ 0.021) compared to Sal (0.59 ± 0.10 g), however no difference in LVR food intake was present following 2.5 mg DAMGO injection (p ¼ 0.14) (Fig 7b). An overall ANOVA showed a significant effect of treatment between hours 1e2 for HVR rats (F5,40 ¼ 2.562, p ¼ 0.042). Administration of 0.25 mg (1.81 ± 0.24; p ¼ 0.033) and 2.5 mg DAMGO (2.30 ± 0.25 g; p < 0.05) increased food intake compared to Sal (1.21 ± 0.12 g) in HVR rats (Fig. 7c). For LVR rats, no differences in food intake were

G.N. Ruegsegger et al. / Neuropharmacology 97 (2015) 171e181

175

Fig. 2. Average distance, time, and velocity (±SE) for HVR (n ¼ 8) and LVR (n ¼ 8) rats over 9 weeks. (a) Average distance (km/day) for HVR and LVR. (b) Average time (min/day) for HVR and LVR. (c) Average velocity (m/min) for HVR and LVR rats. Symbols: *, p < 0.001 compared to HVR.

Fig. 3. (a) Average bodyweight (±SE) for HVR (n ¼ 8) and LVR (n ¼ 8) rats after 9 weeks of intervention. (b) Average food intake (g/day) (±SE) over the entirety of the 9-week study. Symbols: * represent significant differences between groups (p < 0.05).

observed following any drug injection compared to Sal between hours 1e2 (F5,35 ¼ 1.133, p ¼ 0.361) (Fig. 7d). An overall ANOVA showed significant effect of treatment for the complete interval between hours 0e2 in HVR (F5,40 ¼ 5.530, p < 0.001) and LVR (F5,35 ¼ 7.902, p < 0.001) rats. Food intake was increased following injection of 0.25 mg DAMGO in HVR (p ¼ 0.002) and LVR (p ¼ 0.002) rats, and of 2.5 mg DAMGO in HVR (p < 0.001) and LVR (p ¼ 0.036) rats. 4. Discussion The two-fold aims of the present study were to analyze opioidergic signaling transcript differences in the NAc of rats selectively bred for high or low voluntary wheel running distances, and to assess how activating, or blocking, NAc opioid signaling impacts this behavior. We report for the first time that 1) HVR rats express more Oprm1 and Pdyn mRNAs than LVR rats in the NAc, 2) the mu opioid receptor transcript in the NAc implies that its protein could be involved in the network for voluntary running motivation in rat lines selectively bred for high running distances, 3) drug doses which decreased running in HVR rats did not significantly alter running in LVR rats, and 4) the influences of opioids on wheel running were observed during both the presence and absence of food. Given that both lines were injected with the same drug doses, the findings suggest differences exist between HVR and LVR in mu opioid receptor activation and downstream signaling in the NAc. To our knowledge, no other polygenic rodent line exists for low motivation for physical activity. Given that human physical activity is polygenic (Lippi et al., 2008), we believe that our unique model of low voluntary running may more closely mimic the large proportion of the US population with low levels of physical activity (Troiano et al., 2008).

4.1. Experiment 1: opioidergic expression differences between HVR and LVR rats Selective breeding can be defined as the intentional mating of two animals in an attempt to produce offspring with desirable characteristics or for the elimination of a trait. Using the aforementioned approach, the phenotype of voluntary running distance was enriched to be higher in one line and lower in a second line. The next step would be to determine what genotype (using the transcriptome) was enriched. Several lines of research suggest that opioids may influence the distance of voluntary wheel running (Greenwood et al., 2011; Mathes et al., 2010; Werme et al., 2002). Our lab has previously shown differences in Oprd1 transcript expression in the NAc between 34 day-old HVR and LVR rats (Roberts et al., 2013, 2014). In the current experiment, we sought to further investigate potential opioidergic signaling differences between the HVR and LVR lines 1) in earlier vs. later generations (G8 vs. G11-13); 2) in older animals (34 days-old vs. ~100 days-old); and 3) with greater time access to running wheels (~1 week vs. 9 weeks). We hypothesized that HVR rats would have transcriptomic patterns suggestive of heightened rewarding opioid signaling compared to LVR rats. In the present study, we observed a roughly 4-fold higher intrinsic expression of Oprm1 mRNA in HVR compared to LVR rats. The interaction of mu opioid receptors within the mesolimbic dopamine system appears critical for the rewarding effects of several drugs of abuse (Cornish et al., 2005; Vaccarino et al., 1985). Mu opioid receptor agonism in the NAc has also been shown to increase dopamine in the NAc (Di Chiara and Imperato, 1988). Thus, it is possible that elevated NAc Oprm1 expression may further promote wheel running by sensitizing HVR rats to natural reward, as described in wild-type rats by Greenwood et al. (2011). They

176

G.N. Ruegsegger et al. / Neuropharmacology 97 (2015) 171e181

Fig. 4. Relative mRNA expression for the NAc transcripts a) Oprm1 b) Oprd1 c) Oprk1 d) Pdyn and e) Penk. Values are mean ± SE. mRNA expression values are presented as 2DDCT whereby DCT ¼ 18S CT  gene of interest CT. Expression values were normalized to 1.0 for HVRnon-run. Symbols: * denotes significant statistical differences between groups (p < 0.05) (n ¼ 8 per group). Table 2 Dopaminergic NAc qRT-PCR results.

Drd1 Drd2 Drd5

HVR non-run

HVR run

LVR non-run

LVR run

1.00 ± 0.12 1.00 ± 0.20 1.00 ± 0.21

1.04 ± 0.17 0.94 ± 0.11 1.28 ± 0.27

0.55 ± 0.08*y 0.54 ± 0.08*y 0.66 ± 0.08*y

0.69 ± 0.14*y 0.70 ± 0.13 0.39 ± 0.07*yz

Values are mean ± SE. mRNA expression values are presented as 2DDCT whereby DCT ¼ 18S CT e gene of interest CT. Expression values were normalized to 1.0 for HVRnon-run. Symbols: * denotes significant statistical difference from HVRnon-run, y denotes significant statistical difference from HVRrun, z denotes significant statistical difference from LVRnon-run (p < 0.05) (n ¼ 8 per group).

reported 6 weeks of wheel running altered gene transcription for several factors involved with dopaminergic neurotransmission in the mesolimbic reward pathway.

Differences in Oprm1 mRNA between HVR and LVR were not observed in a previous study using earlier generations and younger rats. Another contributing factor to this change could be explained by the fact that running distances for each line have continued to evolve over this period. In particular, the HVR have significantly trended to a higher running distance. A slight upward increase in wheel running distance is coincidental with the increase in Oprm1. Additionally, Pomc mRNA in the arcuate nucleus was unchanged between the HVR and LVR lines, suggesting the upregulation of Oprm1 mRNA was not likely compensatory for low endogenous ligand concentration (unpublished observation). The lack of change observed in Oprd1 and Oprk1 mRNA in the same rats also suggests that many of the potential rewarding effects of opioidergic signaling observed in the HVR line could be dictated by the mu opioid receptor. Given our previous results suggesting Oprd1 mRNA is more greatly expressed in LVR than HVR rats (Roberts et al.,

G.N. Ruegsegger et al. / Neuropharmacology 97 (2015) 171e181

177

Fig. 5. Dark cycle running distances following injections that occurred 30 min prior to the lights going off for HVR (n ¼ 9) and LVR (n ¼ 8) rats. Panels depict running distances on injection nights between hours 0e1 of the dark cycle for (a) HVR and (b) LVR rats; and between hours 1e2 of the dark cycle for (c) HVR and (d) LVR rats. Data is presented as mean ± SE. Symbols: * denotes drug < saline (p < 0.05) within the HVR and LVR lines.

2013), it is somewhat surprising Oprd1 mRNA expression was unaltered between HVR and LVR, however the reasons explained above as well as differences in methodology (RNA-seq vs. qRT-PCR) may explain the inconsistency between experiments. We caution however, the potential contribution of the delta and kappa receptors to wheel running motivation should not be overlooked. Voluntary running altered additional opioid mRNAs not previously reported in the NAc with this treatment. Nine weeks of wheel running increased the endogenous opioid polypeptide hormone Penk, which via proteolytic cleavage produces the enkephalin peptides. Penk mRNA was higher in the LVRrun group compared to both the HVRrun and LVRnon-run groups. Enkephalin (Enk) projections from the ventral striatum have been shown to inhibit motivation-based locomotion (Haber, 2011), and low Penk mRNA in LVRnon-run is indicative of increased dopaminergic tone (Nikoshkov et al., 2008). Werme et al. (2002) found that running wheel access for 30 days reduces DFosB in NAc enkephalin-containing neurons, and selective overexpression of DFosB in striatal enkephalincontaining neurons decreased running. In rats selectively bred for high (HCR) and low running capacity (LCR), which also display high and low wheel running behavior, HCR rats expressed less Enk mRNA than LCR rats in the NAc; however this expression pattern was not altered after three weeks of wheel running (Monroe et al., 2014). The selection criteria for HCR and LCR was forced running during a treadmill test (Koch and Britton, 2001); thus differing from the selection criteria for voluntary running in our current study. The decreased Penk mRNA in HVRrun compared to LVRrun rats is consistent with the above findings supporting the inverse

association between striatal enkephalin and running distance. The increased Penk mRNA in LVRrun compared to LVRnon-run also suggests that LVR rats may find access to running wheels less rewarding. Future studies employing animal transgenic models should be employed to further elucidate the effects of Enk or opioidergic ligands on physical activity motivation. The opioid polypeptide hormone Pdyn transcript had a similar intrinsic pattern to Oprm1 mRNA. Non-running HVR rats had higher Pdyn mRNA than did LVR rats. Previous findings provide insight into the potential functioning of this difference. Werme et al. (2002) observed that 30 days of wheel access increased DFosB in NAc dynorphin-containing neurons. Further, DFosB overexpression in striatal dynorphin-containing neurons increased running, suggesting that dynorphin may regulate the incentive motivation or reward associated with wheel running (Werme et al., 2002). Multiple findings indicate lesioning of dopaminergic neurons decreases dynorphin expression in striatal neurons, and this effect is mediated by the D1-receptor (Engber et al., 1992; Gerfen et al., 1990, 1991). Our finding that Pdyn mRNA expression is intrinsically different between the HVR and LVR lines is consistent with the increased Drd1 mRNA expression observed in our HVR line, and our previous findings from D1-like receptor agonist and antagonist injections suggesting the longer running distance expressed by HVR rats may be due to optimal D1-like receptor signaling in the NAc (Roberts et al., 2012). Together, these results imply the striatonigral “direct” pathway influences wheel running behavior, and the contributions of opioidergic signaling to wheel running could be mediated by dopamine.

178

G.N. Ruegsegger et al. / Neuropharmacology 97 (2015) 171e181

Fig. 6. Dark cycle running distances following DAMGO injection with concurrent temporary food removal during hours 0e2 of the dark cycle for HVR (n ¼ 4) and LVR (n ¼ 7) rats. Panels show running distances on injection nights between hours 0e1 of the dark cycle for (a) HVR and (b) LVR rats; and between hours 1e2 of the dark cycle for (c) HVR and (d) LVR rats. Data is presented as mean ± SE. Student's t-test was used to compare running behavior between the free food access and 2 h temporary food removal for each DAMGO dose within each line. The temporary food removal had no significant effect on running for either DAMGO dose for both the HVR and LVR lines.

4.2. Experiment 2: NAc DAMGO or naltrexone injection To test for support of the inference from Experiment 1, pharmacological manipulation of the mu opioid receptor was performed in Experiment 2. To our knowledge, this report is the first to analyze wheel running following intra-accumbens injection of a mu opioid receptor agonist or antagonist. Given our observed responses in voluntary wheel running distances after injections, we deduced that HVR rats possess heightened sensitivity to mu opioid receptor modulation versus LVR rats following local administration of either DAMGO or naltrexone into the NAc. This result also suggests that the most recent generations (G11-13) of HVR rats demonstrating increased Oprm1 mRNA expression may have had heightened sensitivity to the incentive nature or reward associated with running by opioidergic signaling, thus potentially explaining the trend for a small incremental increase in wheel running distance as mentioned above. In line with this theory, the most recent generations of LVR rats were less sensitive to thermal stimulation than HVR rats, implying inherent differences in opioid signaling (unpublished observation). The limited studies investigating wheel-running behavior following administration of opioid agonists and antagonists have utilized systemic injection methods, making comparisons with the present study of localized injection into the NAc problematic because of systemic versus local pharmacological effects. Our study also extends previous findings on opioid action and wheel running by localizing a brain site of action for opioid agonist and antagonist modification of wheel running distance to the NAc. However, our study does not rule out the numerous other brain locations

expressing Oprm1 and other opioid receptors from influencing wheel running behavior. Paradoxically, bilateral injection of the mu opioid receptor agonist DAMGO and antagonist naltrexone produced a unidirectional change (decrease) in running behavior following injection into the NAc of HVR rats rather than a bidirectional change or single unidirectional effect of DAMGO that we initially hypothesized. Further, the same drugs did not impact running in LVR rats, although the possibility of a “floor effect” not allowing a statistical decline for the LVR with such a low basal running distance must be considered given the low baseline LVR running distances. A similar explanation for a different voluntary running phenomenon exists. Rhodes et al. (2003) observed that the positive correlation between running distance and neurogenesis disappeared in mice selectively bred for high speeds of wheel running “because of a possible ceiling effect for exercise-induced neurogenesis”. The finding is in agreement with other published wheel running studies in rodents and hamsters demonstrating that both opioid antagonists and agonists initially suppress running behavior (Schnur, 1985; Schnur and Barela, 1984; Schnur et al., 1983; Sisti and Lewis, 2001). Intriguingly, in three of these reports, repeated administration or recovery from the opioid agonist morphine later increased running to hyperactive levels (Schnur, 1985; Schnur et al., 1983; Sisti and Lewis, 2001). Given our variation in drug and dosages and narrow analysis timeframe compared to previous literature, as well as NAc specific injection approach, it is likely these factors could have contributed to the lack of a hyperactive running phase observed in the current study. The non-specific effects of naltrexone may have also influenced conclusions drawn for this data, given that

G.N. Ruegsegger et al. / Neuropharmacology 97 (2015) 171e181

179

Fig. 7. Food intake on injection night between 0 and 1 h of the dark cycle for (a) HVR (n ¼ 9) and (b) LVR (n ¼ 8) rats, and between 1 and 2 h of the dark cycle for (c) HVR and (d) LVR rats. Data is presented as mean ± SE. Symbols: * denotes drug > saline (p < 0.05) within the HVR and LVR lines.

naltrexone binds to all three opioid receptors, yet the highest affinity being for the mu receptor (Magnan et al., 1982). Several investigations discovered that administration of either a dopamine D1 receptor agonist or antagonist reduces voluntary wheel running (Roberts et al., 2012), or cocaine-seeking behavior (Alleweireldt et al., 2003; Khroyan et al., 2000). Likewise, mu receptor knockout mice display reduced cocaine self-administration (Mathon et al., 2005), thus the reduced running observed after mu opioid receptor modulation could be driven by downstream changes in dopamine signaling. In summary, the literature and our results allow us to speculate that heightened mu opioid receptor signaling in HVR rats, compared to LVR rats, could be a critical mediator leading to increased motivation for physical activity, and that either activating or blocking this pathway in the NAc may interfere with the natural signaling and behavioral running-distance baseline. Consistent with previous results, we observed an increase in chow intake in the initial hours following intra-accumbens DAMGO administration (Bakshi and Kelley, 1993). During this time period we also observed a decrease in wheel running in HVR rats. This result is consistent with studies demonstrating the inverse relationship between wheel running and feeding behaviors during acute periods (Finger, 1965; Looy and Eikelboom, 1989; Mueller et al., 1997). In contrast, injection of the selected naltrexone doses did not impact food intake, yet wheel running in HVR rats was decreased with the 10 and 20 mg naltrexone doses, suggesting opioidergic signaling differences may also independently modify wheel running and feeding behavior. To further

characterize this relationship, the same treatments were performed in the absence of food access. Again, the same decrease in running from baseline in HVR (n ¼ 4) or LVR (n ¼ 7) rats following 0.25 and 2.5 mg DAMGO administration was observed. Together, the suggestion is made that opioids may influence running behavior independent of changes in feeding behavior. We speculate that disconnect in opioidergic regulation of feeding and running may be due to downstream dopamine signaling influences. Will et al. (2006) reported that pretreatment with dopamine D-1 and D-2 antagonists did not impair DAMGO induced free feeding. Baldo and Kelley (2007) conclude dopamine is a stronger mediator of tasks requiring varying degrees of effort and motivation to seek reward, such as instrumental food-seeking behaviors, rather than free feeding behavior. Together with our findings, this implies opioidergic influences on wheel running behavior may require dopamine transmission while opioidergic regulation of feeding does not. Future studies aimed at inhibiting dopamine signaling with concurrent NAc opioid stimulation should be performed to address integrated opioid and dopamine influences on wheel running. A limitation of our study is the lack of explicit distinction between the NAc shell and core. Analysis of a limited number of available animals to begin to answer this question did not reveal significant differences between the shell versus core injection on running behavior. Likewise, anterior vs. posterior injection location did not impact wheel running, however most cannula placements were clustered in the anterior half of the NAc.

180

G.N. Ruegsegger et al. / Neuropharmacology 97 (2015) 171e181

5. Conclusions To our knowledge, this is the first study investigating wheel running behavior following opioidergic signaling modification in the NAc in rats selectively bred for high or low wheel running motivation. We hypothesized that agonism of the mu opioid receptor would reduce the amount of running necessary to achieve optimal opioid signaling levels in HVR rats, and thus decrease running in HVR to a greater extent than in LVR rats given the higher Oprm1 mRNA expression in the NAc of HVR versus LVR rats. Mu opioid receptor modulating drug dosages that lowered running in HVR did not significantly alter running behavior in LVR rats. These observations suggest that the greater running distance expressed by HVR rats, compared to LVR rats, may be due to higher mu opioid receptor mRNA expression, activation, and downstream signaling. Similarly, mu opioid receptor agonism and antagonism impacted feeding similarly between the HVR and LVR lines, implying that opioids govern wheel running and feeding behavior in part by separate mechanisms. Thus, future efforts could be directed to further characterize opioidergic signaling impact on voluntary running such as determining how the mesolimbic dopaminergic system and interconnected brain regions (i.e., hypothalamus and VTA) influence opioid signaling in the NAc. Taken together the data encourage future investigation into how the complex integrative interactions between opioidergic and dopaminergic pathways in the NAc impact voluntary wheel running. Given the epidemic levels of obesity and physical inactivity, significant efforts should be taken to further discover the neurobiology underlying the motivation for physical activity. Author contributions GNR: tissue collection, specimen processing, data procurement and analysis and writing of the manuscript RGT: assisted in data procurement, data analysis, and writing of the manuscript MJW: assisted in data analysis and writing of the manuscript FWB: provided funding, designed all aspects of the study, and assisted in writing of the manuscript Acknowledgements and disclosures The authors disclose no conflicts of interest. Funds for this project were obtained by the College of Veterinary Medicine at the University of Missouri Development Office and the University of Missouri Life Science Predoctoral Fellowship Program. We would like to thank Statistics Professor Richard Madsen for his assistance in the statistical approaches for this study. References Alleweireldt, A.T., Kirschner, K.F., Blake, C.B., Neisewander, J.L., 2003. D1-receptor drugs and cocaine-seeking behavior: investigation of receptor mediation and behavioral disruption in rats. Psychopharmacology (Berl) 168, 109e117. Anantharaman-Barr, H.G., Decombaz, J., 1989. The effect of wheel running and the estrous cycle on energy expenditure in female rats. Physiol. Behav. 46, 259e263. Bakshi, V.P., Kelley, A.E., 1993. Feeding induced by opioid stimulation of the ventral striatum: role of opiate receptor subtypes. J. Pharmacol. Exp. Ther. 265, 1253e1260. Baldo, B.A., Kelley, A.E., 2007. Discrete neurochemical coding of distinguishable motivational processes: insights from nucleus accumbens control of feeding. Psychopharmacology (Berl) 191, 439e459. Baldo, B.A., Pratt, W.E., Will, M.J., Hanlon, E.C., Bakshi, V.P., Cador, M., 2013. Principles of motivation revealed by the diverse functions of neuropharmacological and neuroanatomical substrates underlying feeding behavior. Neurosci. Biobehav. Rev. 37, 1985e1998. Booth, F.W., Roberts, C.K., Laye, M.J., 2012. Lack of exercise is a major cause of chronic diseases. Compr. Physiol. 2, 1143e1211. Cornish, J.L., Lontos, J.M., Clemens, K.J., McGregor, I.S., 2005. Cocaine and heroin (‘speedball’) self-administration: the involvement of nucleus accumbens

dopamine and mu-opiate, but not delta-opiate receptors. Psychopharmacology (Berl) 180, 21e32. den Hoed, M., Brage, S., Zhao, J.H., Westgate, K., Nessa, A., Ekelund, U., Spector, T.D., Wareham, N.J., Loos, R.J., 2013. Heritability of objectively assessed daily physical activity and sedentary behavior. Am. J. Clin. Nutr. 98, 1317e1325. Depue, R.A., Collins, P.F., 1999. Neurobiology of the structure of personality: dopamine, facilitation of incentive motivation, and extraversion. Behav. Brain Sci. 22, 491e517 discussion 518e469. Di Chiara, G., Imperato, A., 1988. Opposite effects of mu and kappa opiate agonists on dopamine release in the nucleus accumbens and in the dorsal caudate of freely moving rats. J. Pharmacol. Exp. Ther. 244, 1067e1080. Engber, T.M., Boldry, R.C., Kuo, S., Chase, T.N., 1992. Dopaminergic modulation of striatal neuropeptides: differential effects of D1 and D2 receptor stimulation on somatostatin, neuropeptide Y, neurotensin, dynorphin and enkephalin. Brain Res. 581, 261e268. Finger, F.W., 1965. Effect of food deprivation on running-wheel activity in naive rats. Psychol. Rep. 16, 753e757. Gerfen, C.R., Engber, T.M., Mahan, L.C., Susel, Z., Chase, T.N., Monsma Jr., F.J., Sibley, D.R., 1990. D1 and D2 dopamine receptor-regulated gene expression of striatonigral and striatopallidal neurons. Science 250, 1429e1432. Gerfen, C.R., McGinty, J.F., Young 3rd, W.S., 1991. Dopamine differentially regulates dynorphin, substance P, and enkephalin expression in striatal neurons: in situ hybridization histochemical analysis. J. Neurosci. 11, 1016e1031. Gerfen, C.R., Young 3rd, W.S., 1988. Distribution of striatonigral and striatopallidal peptidergic neurons in both patch and matrix compartments: an in situ hybridization histochemistry and fluorescent retrograde tracing study. Brain Res. 460, 161e167. Greenwood, B.N., Foley, T.E., Le, T.V., Strong, P.V., Loughridge, A.B., Day, H.E., Fleshner, M., 2011. Long-term voluntary wheel running is rewarding and produces plasticity in the mesolimbic reward pathway. Behav. Brain Res. 217, 354e362. Haber, S.N., 2011. Neuroanatomy of Reward: a View from the Ventral Striatum Neurobiology of Sensation and Reward. Llc., Boca Raton FL. Jones, L.C., Bellingham, W.P., Ward, L.C., 1990. Sex differences in voluntary locomotor activity of food-restricted and ad libitum-fed rats. Implications for the maintenance of a body weight set-point. Comp. Biochem. Physiol. A Comp. Physiol. 96, 287e290. Khroyan, T.V., Barrett-Larimore, R.L., Rowlett, J.K., Spealman, R.D., 2000. Dopamine D1- and D2-like receptor mechanisms in relapse to cocaine-seeking behavior: effects of selective antagonists and agonists. J. Pharmacol. Exp. Ther. 294, 680e687. Knab, A.M., Bowen, R.S., Hamilton, A.T., Gulledge, A.A., Lightfoot, J.T., 2009. Altered dopaminergic profiles: implications for the regulation of voluntary physical activity. Behav. Brain Res. 204, 147e152. Knab, A.M., Bowen, R.S., Hamilton, A.T., Lightfoot, J.T., 2012. Pharmacological manipulation of the dopaminergic system affects wheel-running activity in differentially active mice. J. Biol. Regul. Homeost. Agents 26, 119e129. Knab, A.M., Lightfoot, J.T., 2010. Does the difference between physically active and couch potato lie in the dopamine system? Int. J. Biol. Sci. 6, 133e150. Koch, L.G., Britton, S.L., 2001. Artificial selection for intrinsic aerobic endurance running capacity in rats. Physiol. Genomics 5, 45e52. Kravitz, A.V., Tye, L.D., Kreitzer, A.C., 2012. Distinct roles for direct and indirect pathway striatal neurons in reinforcement. Nat. Neurosci. 15, 816e818. Lightfoot, J.T., Turner, M.J., Daves, M., Vordermark, A., Kleeberger, S.R., 2004. Genetic influence on daily wheel running activity level. Physiol. Genomics 19, 270e276. Lightfoot, J.T., Turner, M.J., Pomp, D., Kleeberger, S.R., Leamy, L.J., 2008. Quantitative trait loci for physical activity traits in mice. Physiol. Genomics 32, 401e408. Lippi, G., Favaloro, E.J., Guidi, G.C., 2008. The genetic basis of human athletic performance. Why are psychological components so often overlooked? J. Physiol. 586, 3017 author reply 3019e3020. Looy, H., Eikelboom, R., 1989. Wheel running, food intake, and body weight in male rats. Physiol. Behav. 45, 403e405. Magnan, J., Paterson, S.J., Tavani, A., Kosterlitz, H.W., 1982. The binding spectrum of narcotic analgesic drugs with different agonist and antagonist properties. Naunyn Schmiedeb. Arch. Pharmacol. 319, 197e205. Mathes, W.F., Nehrenberg, D.L., Gordon, R., Hua, K., Garland Jr., T., Pomp, D., 2010. Dopaminergic dysregulation in mice selectively bred for excessive exercise or obesity. Behav. Brain Res. 210, 155e163. Mathon, D.S., Lesscher, H.M., Gerrits, M.A., Kamal, A., Pintar, J.E., Schuller, A.G., Spruijt, B.M., Burbach, J.P., Smidt, M.P., van Ree, J.M., Ramakers, G.M., 2005. Increased gabaergic input to ventral tegmental area dopaminergic neurons associated with decreased cocaine reinforcement in mu-opioid receptor knockout mice. Neuroscience 130, 359e367. Matthes, H.W., Maldonado, R., Simonin, F., Valverde, O., Slowe, S., Kitchen, I., Befort, K., Dierich, A., Le Meur, M., Dolle, P., Tzavara, E., Hanoune, J., Roques, B.P., Kieffer, B.L., 1996. Loss of morphine-induced analgesia, reward effect and withdrawal symptoms in mice lacking the mu-opioid-receptor gene. Nature 383, 819e823. Mogenson, G.J., Jones, D.L., Yim, C.Y., 1980. From motivation to action: functional interface between the limbic system and the motor system. Prog. Neurobiol. 14, 69e97. Monroe, D.C., Holmes, P.V., Koch, L.G., Britton, S.L., Dishman, R.K., 2014. Striatal enkephalinergic differences in rats selectively bred for intrinsic running capacity. Brain Res. 1572, 11e17. Mueller, D.T., Loft, A., Eikelboom, R., 1997. Alternate-day wheel access: effects on feeding, body weight, and running. Physiol. Behav. 62, 905e908.

G.N. Ruegsegger et al. / Neuropharmacology 97 (2015) 171e181 Nikoshkov, A., Drakenberg, K., Wang, X., Horvath, M.C., Keller, E., Hurd, Y.L., 2008. Opioid neuropeptide genotypes in relation to heroin abuse: dopamine tone contributes to reversed mesolimbic proenkephalin expression. Proc. Natl. Acad. Sci. U. S. A. 105, 786e791. Novak, C.M., Burghardt, P.R., Levine, J.A., 2012. The use of a running wheel to measure activity in rodents: relationship to energy balance, general activity, and reward. Neurosci. Biobehav. Rev. 36, 1001e1014. Parker, K.E., McCall, J.G., Will, M.J., 2010. Basolateral amygdala opioids contribute to increased high-fat intake following intra-accumbens opioid administration, but not following 24-h food deprivation. Pharmacol. Biochem. Behav. 97, 262e266. Paxinos, G., Watson, C., 1998. The Rat Brain in Stereotaxic Coordinates, fourth ed. Academic, San Diego. Pitts, G.C., 1984. Body composition in the rat: interactions of exercise, age, sex, and diet. Am. J. Physiol. 246, R495eR501. Rhodes, J.S., Garland, T., 2003. Differential sensitivity to acute administration of Ritalin, apomorphine, SCH 23390, but not raclopride in mice selectively bred for hyperactive wheel-running behavior. Psychopharmacology (Berl) 167, 242e250. Rhodes, J.S., Hosack, G.R., Girard, I., Kelley, A.E., Mitchell, G.S., Garland Jr., T., 2001. Differential sensitivity to acute administration of cocaine, GBR 12909, and fluoxetine in mice selectively bred for hyperactive wheel-running behavior. Psychopharmacology (Berl) 158, 120e131. Rhodes, J.S., van Praag, H., Jeffrey, S., Girard, I., Mitchell, G.S., Garland Jr., T., Gage, F.H., 2003. Exercise increases hippocampal neurogenesis to high levels but does not improve spatial learning in mice bred for increased voluntary wheel running. Behav. Neurosci. 117, 1006e1016. Roberts, M.D., Brown, J.D., Company, J.M., Oberle, L.P., Heese, A.J., Toedebusch, R.G., Wells, K.D., Cruthirds, C.L., Knouse, J.A., Ferreira, J.A., Childs, T.E., Brown, M., Booth, F.W., 2013. Phenotypic and molecular differences between rats selectively bred to voluntarily run high vs. low nightly distances. Am. J. Physiol. Regul. Integr. Comp. Physiol. 304, R1024eR1035. Roberts, M.D., Gilpin, L., Parker, K.E., Childs, T.E., Will, M.J., Booth, F.W., 2012. Dopamine D1 receptor modulation in nucleus accumbens lowers voluntary wheel running in rats bred to run high distances. Physiol. Behav. 105, 661e668. Roberts, M.D., Toedebusch, R.G., Wells, K.D., Company, J.M., Brown, J.D., Cruthirds, C.L., Heese, A.J., Zhu, C., Rottinghaus, G.E., Childs, T.E., Booth, F.W., 2014. Nucleus accumbens neuronal maturation differences in young rats bred for low versus high voluntary running behaviour. J. Physiol. 592, 2119e2135. Schiffmann, S.N., Jacobs, O., Vanderhaeghen, J.J., 1991. Striatal restricted adenosine A2 receptor (RDC8) is expressed by enkephalin but not by substance P neurons: an in situ hybridization histochemistry study. J. Neurochem. 57, 1062e1067.

181

Schnur, P., 1985. Morphine tolerance and sensitization in the hamster. Pharmacol. Biochem. Behav. 22, 157e158. Schnur, P., Barela, P., 1984. Locomotor activity and opiate effects in male and female hamsters. Pharmacol. Biochem. Behav. 21, 369e374. Schnur, P., Bravo, F., Trujillo, M., Rocha, S., 1983. Biphasic effects of morphine on locomotor activity in hamsters. Pharmacol. Biochem. Behav. 18, 357e361. Sisti, H.M., Lewis, M.J., 2001. Naloxone suppression and morphine enhancement of voluntary wheel-running activity in rats. Pharmacol. Biochem. Behav. 70, 359e365. Swallow, J.G., Carter, P.A., Garland Jr., T., 1998. Artificial selection for increased wheel-running behavior in house mice. Behav. Genet. 28, 227e237. Troiano, R.P., Berrigan, D., Dodd, K.W., Masse, L.C., Tilert, T., McDowell, M., 2008. Physical activity in the United States measured by accelerometer. Med. Sci. Sports Exerc. 40, 181e188. Vaccarino, F.J., Pettit, H.O., Bloom, F.E., Koob, G.F., 1985. Effects of intracerebroventricular administration of methyl naloxonium chloride on heroin self-administration in the rat. Pharmacol. Biochem. Behav. 23, 495e498. Vargas-Perez, H., Sellings, L.H., Paredes, R.G., Prado-Alcala, R.A., Diaz, J.L., 2008. Reinforcement of wheel running in BALB/c mice: role of motor activity and endogenous opioids. J. Mot. Behav. 40, 587e593. Wang, D.V., Tsien, J.Z., 2011. Conjunctive processing of locomotor signals by the ventral tegmental area neuronal population. PLoS One 6, e16528. Werme, M., Messer, C., Olson, L., Gilden, L., Thoren, P., Nestler, E.J., Brene, S., 2002. Delta FosB regulates wheel running. J. Neurosci. 22, 8133e8138. Whishaw, I.Q., Cioe, J.D., Previsich, N., Kolb, B., 1977. The variability of the interaural line vs the stability of bregma in rat stereotaxic surgery. Physiol. Behav. 19, 719e722. Will, M.J., Franzblau, E.B., Kelley, A.E., 2003. Nucleus accumbens mu-opioids regulate intake of a high-fat diet via activation of a distributed brain network. J. Neurosci. 23, 2882e2888. Will, M.J., Pratt, W.E., Kelley, A.E., 2006. Pharmacological characterization of highfat feeding induced by opioid stimulation of the ventral striatum. Physiol. Behav. 89, 226e234. Yao, L., McFarland, K., Fan, P., Jiang, Z., Ueda, T., Diamond, I., 2006. Adenosine A2a blockade prevents synergy between mu-opiate and cannabinoid CB1 receptors and eliminates heroin-seeking behavior in addicted rats. Proc. Natl. Acad. Sci. U. S. A. 103, 7877e7882. Zhang, M., Kelley, A.E., 1997. Opiate agonists microinjected into the nucleus accumbens enhance sucrose drinking in rats. Psychopharmacology (Berl) 132, 350e360.