Article pubs.acs.org/jpr
Proteome Profiling of Mitotic Clonal Expansion during 3T3-L1 Adipocyte Differentiation Using iTRAQ-2DLC-MS/MS Yan Jiang,†,§ Liang Guo,† Li-Qi Xie,*,‡ You-You Zhang,† Xiao-Hui Liu,‡ Yang Zhang,‡ Hao Zhu,† Peng-Yuan Yang,‡ Hao-Jie Lu,‡ and Qi-Qun Tang*,†,‡ †
Key Laboratory of Molecular Medicine, the Ministry of Education, Department of Biochemistry and Molecular Biology, Fudan University Shanghai Medical College, Shanghai 200032, People’s Republic of China § Department of Forensic Medicine, Fudan University Shanghai Medical College, Shanghai 200032, People’s Republic of China ‡ Institute of Stem Cell Research and Regenerative Medicine, Institutes of Biomedical Sciences, Fudan University, Shanghai 200032, People’s Republic of China S Supporting Information *
ABSTRACT: Mitotic clonal expansion (MCE) is one of the important events taking place at the early stage during 3T3-L1 adipocyte differentiation. To investigate the mechanism underlying this process, we carried out a temporal proteomic analysis to profile the dynamic changes in MCE. Using 8-plexiTRAQ-2DLC-MS/MS analysis, 3152 proteins were quantified during the initial 28 h of 3T3-L1 adipogenesis. Functional analysis was performed on 595 proteins with maximum or minimum quantities at 20 h of adipogenic induction that were potentially involved in MCE, which identified PI3K/AKT/ mTOR as the most relevant pathway. Among the 595 proteins, PKM2 (Pyruvate kinase M2), a patterned protein identified as a potential target gene of C/EBPβ in our previous work, was selected for further investigation. Network analysis suggested positive correlations among C/EBPβ, PIN1, and PKM2, which may be related with the PI3K-AKT pathway. Knockdown of PKM2 with siRNA inhibited both MCE and adipocyte differentiation of 3T3-L1 cells. Moreover, PKM2 was down-regulated at both the mRNA level and the protein level upon the knockdown of C/EBPβ. And overexpressed PKM2 can partially restore MCE, although it did not restore terminal adipocyte differentiation, which was inhibited by siC/EBPβ. Thus, PKM2, potentially regulated by C/EBPβ, is involved in MCE during adipocyte differentiation. The dynamic proteome changes quantified here provide a promising basis for revealing molecular mechanism regulating adipogenesis. KEYWORDS: 3T3-L1 preadipocyte, mitotic clonal expansion, proteomics, iTRAQ
■
INTRODUCTION Excessive accumulation of adipocytes can result in obesity, which is a major risk factor related to the development of type II diabetes, cardiovascular disease, cancer, and sleep-disordered breathing.1 The excessive energy increases adipocyte number through promoting stem cells commitment to the adipocyte lineage followed by preadipocytes differentiate into adipocytes.2 As a result, the molecular mechanisms that regulate the preadipocyte differentiation are worth careful investigation. The 3T3-L1 cell line is successfully used as an in vitro model for monitoring preadipocytes differentiation into adipocytes. Stimulated with a hormonal cocktail consisting of insulin, dexamethasone, and isobutylmethyxanthine, 3T3-L1 preadipocyte synchronously reenters the cell cycle. After two rounds of MCE, the growth-arrested 3T3-L1 cells express genes that give rise to the adipocyte phenotype.3 Numerous experimental observations confirmed that MCE is one of the key events taking place during the early stage of adipogenesis, and the first 28 h is a critical time for finishing the first round of MCE.3−5 © 2014 American Chemical Society
The MCE involves a transcriptional cascade, among which the CCAAT/enhancer-binding proteins (C/EBPs) and Peroxisome Proliferator-Activated receptor γ (PPARγ) are considered to play an essential role.6 C/EBP β and C/EBP δ are expressed very early in the program, while C/EBPα and PPARγ are stimulated much later. Besides, some other factors, such as Krupel-like factors (KLFs), c-myc, Nur77, and cell-cycle proteins, are also involved at the early stage of adipogenesis.7−9 Furthermore, recent studies have demonstrated that the expression of histone H4 and histone demethylase Kdm4b are closely correlated with the above events, and both the histone H4 gene promoter (hist4h4) and Kdm4b promoter possess functional C/EBP-binding sites.10,11 Despite the important role of C/EBPβ and related factors, the precise mechanism by which the preadipocyte reenters the cell cycle and undergoes MCE is not fully understood. Received: August 26, 2013 Published: January 22, 2014 1307
dx.doi.org/10.1021/pr401292p | J. Proteome Res. 2014, 13, 1307−1314
Journal of Proteome Research
Article
Protein Extraction and 8-plex iTRAQ Labeling
In recent years, various high-throughput technologies, such as gene expression microarray and proteomic approaches, were successively adopted in adipogenesis studies. The omics-scale profiling enables a global view on biological processes and molecular networks. Many genes potentially involved in the regulation of early adipocytes differentiation were identified from gene expression profiling, and some important transcriptional regulators, including KLF4, Egr2(Krox20), Nr4al, etc., were certified by subsequent functional studies.7,12,13 Although proteins are the main component of the physiological metabolic pathways, proteomic approaches are much less used for identifying proteins during adipogenesis. Early proteome analysis of adipogensis mainly applied one- or two-dimensional gel electrophoreses for separation and tandem mass spectrometry for protein identification.14−17 On account of higher throughput, stable isotope labeling combined with LC-MS/MS analysis is used for profiling adipocyte differentiation in recent studies.18−22 Among these methods, isobaric tags for relative and absolute quantification (iTRAQ) achieve sensitive and accurate protein quantification by using reporter ion pairs in the low mass range of MS2 spectra for quantitation. And the multiplexing technique enables quantification of up to 8 different samples in a single MS based experiment. In this study, we employed iTRAQ-8plex to monitor the temporal dynamics of protein expression throughout the first 28 h of 3T3-L1 adipocytes differentiation after hormone cocktail stimulation. Altogether, 3152 nonredundant proteins were confidently quantified, and 595 of them were considered to be related to MCE during adipogenesis by vector mode analysis. Functional analysis indicates an important role of PKM2 during the early stage of 3T3-L1 adipocyte differentiation, and subsequent molecular-biological experiments verified its function in this process.
■
Collected 3T3-L1 cells of 8 time points were washed three times with phosphate-buffered saline (PBS) to remove cell culture medium, and then lysed in buffer containing 7 M urea, 2 M thiourea, 1 mM phenylmethanesulfonyl fluoride (PMSF), and protease inhibitors cocktails, respectively. The cell lysates were sonicated in ice cold water and spun for 30 min at 4 °C, and then centrifuged at 12,000g for 40 min at 4 °C to collect the supernatant. Protein concentration was determined through Bradford assay. 120 μg of proteins from each time point was subjected to ice acetone precipitation overnight. After centrifugation, the pellet was resuspended by 20 μL of 500 mm triethylammonium bicarbonate (TEAB); denaturant was added as cosolvent. Subsequently, the resuspended proteins were reduced, alkylated, and digested with trypsin according to the manufacturer’s protocol (Applied Biosystems, Framingham, MA, USA). Samples were iTRAQ labeled as follows: 0 h, 113; 4 h, 114; 8 h, 115; 12 h, 116; 16 h, 117; 20 h, 118; 24 h, 119; 28 h, 121. The labeled peptide samples were then pooled and lyophilized in a vacuum concentrator prior to SCX fractionation. SCX-RPLC Separation and Mass Spectrometric Analysis
The peptide mixtures were resuspended in 80 μL buffer A and fractioned using a 5 μm, 2.1 mm × 100 mm Polysulfethyl column (The Nest Group, Southborough, USA) at a constant flow rate of 0.2 mL/min. Buffer A consisted of 10 mM KH2PO4 and 25% acetonitrile, pH 2.6. Buffer B is 10 mM KH2PO4, 25% acetonitrile, and 350 mM KCl, pH 2.6. The 60-min gradient starts with 100% A for 5 min, followed by a linear gradient from 5% B to 25% B for 35 min, to 80% B for 5 min, maintained 80% B for 5 min, and finally 100% A for 10 min. The wavelength of the UV detector was set at 280 nm. A total of 20 SCX fractions were collected, and every fraction was desalted with a C18 cartridge (Sep-Pak C18 1 cc Vac Cartridge, waters) and dried in a vacuum concentrator for subsequent nano-LC-MS/MS analysis. The dried fraction of iTRAQ-labeled peptides was redissolved in 50 μL of 0.1% formic acid and 5% acetonitrile. To confirm the sample pretreatment and separation is qualified for proteome analysis, 20 μL of sample was subjected to 20AD HPLC (Shimadzu, Japan) coupled with Q-STAQ XL (Applied Biosystems, Foster City, USA) for LC-MS/MS analysis. The peptides were separated by a 65 min linear gradient of 5% to 36.5% acetonitrile in 0.1% formic acid at a flow rate of 0.3 μL/ min. The mass spectrometer was set to perform data acquisition in the positive ion mode, with a selected mass range of 400−1800 m/z. The top three precursor peaks were selected for CID fragmentation, with a MS/MS fragment ion scan range of 100−2000 m/z. After the confirmation, 20 μL of them was injected into the NanoLC-1D Plus HPLC (AB SCIEX, Eksigent Technologies, Dublin, CA) coupled online with a TripleTOF 5600 (AB SCIEX, Framingham, USA). The peptide mixture was separated on a ZORBAX 300SB-C18 column (5 μm particle size, 0.1 mm × 150 mm length, and 300 Å pore size, Agilent, Palo Alto, USA) with a 85 min linear gradient of 5% to 36.5% acetonitrile in 0.1% formic acid. The flow rate was 0.3 μL/min. The mass range was set as 400−1800 m/z. The top 15 precursor peaks were selected for CID fragmentation. Three technical replicates were processed.
EXPERIMENTAL SECTION
Cell Culture and Induction of Differentiation
3T3-L1 preadipocytes were propagated and maintained as described.11 To induce the differentiation, 2-day postconfluent 3T3-L1 preadipocytes (designated 0 day) were fed DMEM containing 10% fetal bovine serum (FBS), 1 μg/mL insulin, 1 μM dexamethasone, and 0.5 mM 3-isobutyl-1-methylxanthine (MIX) until day 2. The adipocyte phenotype begins on day 3 and reaches maximum by day 8. For proteome analysis, 3T3-L1 cells were harvested at 0, 4, 8, 12, 16, 20, 24, and 28 h after hormonal induction. Oil Red O Staining
Cells were washed three times with PBS and then fixed for 5 min with 3.7% formaldehyde. Oil red O (0.5% in isopropanol) was diluted with water (3:2), filtered through a 0.45 μm filter, and incubated with the fixed cells for 1 h at room temperature. After that, cells were washed with water, and the stained fat droplets in the cells were visualized by light microscopy and photographed. Flow Cytometric Analysis
Cells were trypsinized and fixed with 2% (wt/vol) paraformaldehyde in 1× PBS. Then they were treated with 0.5 mg/mL RNase A for 1 h at room temperature and incubated with 0.1 mg/mL propidium iodide (Sigma, St. Louis, MO, USA) for 45 min at 37 °C. Cells were further analyzed with use of a fluorescence-activated cell sorter (FACS).
Data Analysis and Functional Interpretation
Protein identification and quantification for iTRAQ experiments was carried out using ProteinPilot 4.2 software (Applied 1308
dx.doi.org/10.1021/pr401292p | J. Proteome Res. 2014, 13, 1307−1314
Journal of Proteome Research
Article
(downstream). RT-qPCR data were normalized to the 0 h time point of control RNAi-treated cells.
Biosystems; MDS-Sciex). Database search was performed against a target-decoy database constructed based on a SwissProt mouse. Only proteins identified with at least 95% confidence, and a ProtScore of 1.3, were reported. iTRAQ reporter intensities of these peptides were referenced to obtain relative quantifications. The median and global distribution of the quantitative result for each labeling channel was visualized by box-plot. Principal component analysis (PCA) was used to evaluate differences among test groups. The first two principal components whose cumulative variance contribution rate was over 85% were selected to make the PCA diagram. Two vectors (1,2,3,4,4,4) and (1,2,3,4,3,2), were set to distinguish proteins with differential expression. The Pearson correlation coefficient was used as the threshold. When the absolute value of the Pearson correlation coefficient was >0.8 and p < 0.05, the corresponding protein was identified to have positive or negative correlation with the two vectors. In addition, IPA software (http://www.ingenuity.com) was used to complete function, pathway, and network analysis.
■
RESULTS AND DISCUSSION
Dynamic Changes of Protein Expression during the Early Stage of 3T3-L1 Preadipocytes Differentiation
The postconfluent 3T3-L1 preadipocytes that are growtharrested can be induced by MDI to reenter the cell cycle,
RNA Interference
Synthetic RNAi oligonucleotides specific for regions in the PKM2 and C/EBPβ mRNAs were designed and synthesized by Invitrogen (Carlsbad, CA, USA) Stealth RNAi. The silencing effects of several RNAi oligonucleotides were screened and tested initially for their ability to knock down the expression of these genes by RT-qPCR. The sequences (5′ to 3′) for successful RNAi knockdown were the following: GCCACAGAAAGCTTTGCAT for PKM2; CCCTGCGGAACTTGTTCAAGCAGCT for C/EBPβ. Stealth RNAi Negative Control Duplexes with a similar GC content were used as a negative control. 3T3-L1 cells were transfected at ∼50% confluence with RNAi oligonucleotides using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions.
Figure 1. Four dynamic expression modes during the early 28 h of preadipocytes differentiation. The x-axis units indicate the time points, and y-axis units indicate the normalized quantitative ratios (by dividing the sum of all six ratios). The relative quantities in 20 h were set as maximum or minimum, with the others (A) first rise then flat, (B) first drop then flat, (C) first rise then drop, and (D) first drop then rise.
undergo several rounds of MCE, and then differentiate into cells having the morphological and biochemical characteristics of adipocytes.3 The FACS result shows that the percentage of S phase cells after MDI stimulation were 4.99% in 4 h, 2.54% in 8 h, 3.21% in 12 h, 17.2% in 16 h, 44.8% in 20 h, 24.4% in 24 h, and 9.77% in 28 h after MDI stimulation (Supporting Information Figure 1), which indicates that the G1/S transition begins at 16 h and reaches a peak at 20 h (S-phase) after adipogenic induction. In line with previous studies,3−5 most of the 3T3-L1 cells undergo one round of MCE in the first 28 h postinduction. To investigate the mechanism regulating the cell cycle re-entry of preadipocytes, 3T3-L1 cells induced for 0−28 h were selected for further analysis. Using iTRAQ-2DLC-MS/MS, a comparative study was performed to analyze the dynamic changes of protein expression throughout the early 28 h of 3T3-L1 preadipocytes differentiation. The iTRAQ, a multiplex quantitative proteomics technique, enables comprehensive and detailed examination of dynamic protein expression during adipogenesis. Proteins harvested at 0, 4, 8, 12, 16, 20, 24, and 28 h after hormone stimulation were purified and labeled by 8-plex iTRAQ reagents, and then mixed together and analyzed by 2DLC-MS/MS. A total of 3152 nonredundant proteins were quantified with high confidence (Supporting Information Table 1). The average quantified proteins were 1702 for three replicated Triple TOF 5600 analysis, which almost doubled the quantified proteins of 994 in QSTAR XL analysis. Many proteins, which had been reported to play important roles in preadipocytes differentiation, such as C/EBPβ, CDKN1B(P27), RUNX2, COL1A1, MCM3, MTOR, PIN1, and APOA1, were quantified.6,10,11,23−28 According to the intensities of report ions, these proteins exhibited various dynamics changes during the early stage of preadipocytes differentiation
Western Blot Assay
Equal amounts of cell protein samples were separated by SDSPAGE on a 10% acrylamide gel and transferred to PVDF membranes, which were blocked with 5% milk (w/v) in TBST for 2 h at room temperature. Membranes were incubated overnight at 4 °C with primary antibody. Western blot bands were visualized using peroxidase-conjugated secondary antibody and ECL (Amersham-Pharmacia Biotech, Piscataway, NJ). Band densities were quantified with the Phoretix 2D Expression program (Nonlinear Dynamics, Durham, NC). RNA Isolation and Real-Time Quantitative PCR
Total RNAs were isolated using Trizol (Invitrogen) according to the manufacturer’s instruction. First-strand cDNAs were synthesized using the PrimeScript reverse transcriptase and Random primers (Takara Bio, Otsu, Japan). Real-time quantitative PCR (RT-qPCR) was performed using primers as described. Power SYBR Green PCR Mastermix (Applied Biosystems, Carlsbad, CA, USA) and the PRISM 7300 instrument (Applied Biosystems) were used. Analysis was performed using the standard curve method and normalization of all genes of interest to the control gene 18S rRNA. Primers pairs for RT-qPCR were as follows: mouse 18S, 5′CGCCGCTAGAGGTGAAATTCT-3′ (upstream) and 5′CATTCTTGGCAAATGCTTTCG-3′ (downstream); mouse Pkm2, 5′-GTGGCTCGGCTGAATTTCTCT-3′ (upstream) and 5′-CACCGCAACAGGACGGTAG-3′ (downstream); mouse C/EBPβ, 5′-ACGACTTCCTCTCCGACCTCT-3′ (upstream) and 5′-CGAGGCTCACGTAACCGTAGT-3′ 1309
dx.doi.org/10.1021/pr401292p | J. Proteome Res. 2014, 13, 1307−1314
Journal of Proteome Research
Article
Figure 2. Interaction network of the focus proteins associated with adipogenesis. The intensity of the node color indicates the protein expression differences after 20 h of hormone induction: green means down-regulated; red means up-regulated.
Figure 3. Dynamic expression of PKM2 during differentiation of 3T3-L1 preadipocytes. Two days after reaching confluence (0 h), 3T3-L1 preadipocytes were induced to differentiate into adipocytes using the standard differentiation protocol. The expression profiles of PKM2 during 0− 28 h after the induction were monitored by iTRAQ-2DLC-MS/MS (A), RT-qPCR (B), and Western-blotting (C), respectively. The expression of PKM2 is significantly elevated after induction of differentiation.
Information Figure 4). The spatial distribution of five testing time point, 12, 16, 20, 24, and 28 h, is relatively concentrated in PCA analysis, and the data of 0, 4, and 8 h were away from other time points (Supporting Information Figure 5). Maybe, after 4−8 h hormone stimulation, only a part of the 3T3-L1 cells has entered into MCE, which makes the quantitative data of the two time points have large differences from others in PCA analysis. Therefore, in the subsequent protein screening and biological analysis, only six testing points, 0, 12, 16, 20, 24, and 28 h, were used for investigation.
(Supporting Information Figure 2). For example, APOA1 declined steadily after hormone stimulation, while RUNX2, P27, and PIN1 showed a transient increase followed by a decrease. Before further functional study, we performed a western-blotting analysis on three proteins, C/EBPβ, PKM2, and MCM3. Protein expression profiles detected by iTRAQ2DLC-MS/MS and western-blotting are plotted together (Supporting Information Figure 3). Except a few differences at early time points, the two different mechanism methods showed identical quantitative changing tendency. To visualize a global view of how the samples and proteins relate to each other, box-plot analysis and PCA analysis were carried out. The width and median of boxes was similar among eight samples, which demonstrated that most data were at the same range and could be compared one by one (Supporting
Key Factors in MCE during Preadipocytes Differentiation
According to the FACS result, 3T3-L1 preadipocytes began entering the G1/S check point at about 16 h, and S-phase cells peaked at 20 h after hormone induction. Therefore, proteins that exhibited significant expression changes at 16 h ∼ 20 h may 1310
dx.doi.org/10.1021/pr401292p | J. Proteome Res. 2014, 13, 1307−1314
Journal of Proteome Research
Article
Figure 4. Pkm2 is required for MCE during 3T3-L1 preadipocyte differentiation. 3T3-L1 preadipocytes were transfected with Pkm2 siRNA (siPkm2); two days after reaching confluence, cells were induced to differentiation. (A) Cell lysates were harvested at 20 h, and the expression of Pkm2 was detected by Western blotting. (B) Cell numbers were determined at times indicated after induction (data normalized to 0 h time point). (C) The percentages of apoptotic (Apop) and necrotic (Nec) cells were determined after acridine orange/ethidium bromide co-staining by fluorescence microscopy on day 2. Acridine orange stained cells were evaluated for morphological characteristics of apoptosis, and cells staining positive for ethidium bromide were considered as necrotic. (D) DNA content was analyzed by propidium iodide staining and flow cytometry at 0 and 20 h time points. (E) On day 8 after induction, cells were stained with Oil red O. The preadipocytes adipogenesis was inhibited by PKM2 knock down.
iTRAQ-2DLC-MS/MS data, the changes in protein abundance and mRNA expression level can be correlated efficiently. Altogether, 17 genes were detected by all three platforms (Supporting Information Figure 6). Among them, PKM2 and RRP1B were in accordance with our designed modes, which implicates important functions of the two proteins in MCE. To further interpret our finding in a biological context, C/ EBPβ, CDKN1B, PKM2, RRP1B, and RUNX2 were selected as focused proteins to build the protein−protein interaction network with other patterned proteins. A close relationship between the focused proteins and PI3K-AKT/mTOR pathway related proteins was observed. As show in Supporting Information Figure 7, proteins related to the PI3K-AKT/ mTOR pathway, such as PIK3R1, MTOR, NPM1, ILK, FN1, EIF4EBP1, HSPA8, CDC37, PPP3CA, and STIP1, were found to play pivotal roles in the network, which indicated the important roles of this pathway in the preadipocytes differentiation process. For in-depth analysis of interactions between focus proteins, a subnetwork with the shortest path to describe the focused proteins’ interactions was constructed (Figure 2). CDKN1B, PI3K complex, and C/EBPβ show a vital role in the subnetworks. As shown in the subnetwork, CDKN1B is downregulated during preadipocytes differentiation, and the decline of CDKN1B was reported to be essential for initiating MCE.30 C/EBPβ, which shows comprehensive interactions with various kinases, has positive correlation tendency with PI3K complex, PIK3R1, PIN1, PKM2, MCM3, and MCM7. PIN1 (peptidylprolyl cis/trans isomerase, NIMA-interacting 1), was detected to be overexpressed in many human cancers, and its target proteins mainly function in regulation of the G0, G1/S check point.26,27 The subnetwork suggested that positive correlations in the preadipocytes differentiation process might exist among C/EBPβ, PIN1, and PKM2, and this might be related to the PI3K-AKT pathway, which deserved further study.
be relevant to the regulation of MCE. Setting the relative quantities in 20 h as maximum or minimum, four dynamic expression modes during the early 28 h of preadipocytes differentiation were designed accordingly: (A) first rise then flat, (B) first drop then flat, (C) first rise then drop, and (D) first drop then rise (Figure 1). A total of 595 proteins quantified by iTRAQ-2DLC-MS/MS analysis were in accordance with these modes (we named them patterned proteins, Supporting Information Table 2), in which 190 proteins met A, 265 proteins met B, 103 proteins met C, and 118 proteins met D (Figure 1). And there was overlap between A and C, B and D. The functional enrichment of GO biological processes and pathway enrichment analysis of the 595 patterned proteins was performed by IPA. The enriched functions of patterned proteins were mainly involved in embryonic development, multiple diseases (hepatic diseases, cardiovascular diseases, tumors, etc), skeletal and muscular development, as well as cardiovascular development. The result indicated that these patterned proteins are related to reproductive development and dysfunctional physiological processes such as cell death and abnormal proliferation. Pathway enrichment analysis identified PI3K/AKT/mTOR as the most relevant pathway. Based on previous research,10 RUNX2 blocked 3T3-L1 adipocyte differentiation by inhibiting MCE through the induction of CDKN1B expression. We speculated that the regulation of 3T3-L1 adipocyte differentiation by RUNX2 and CDKN1B may be associated with PI3K-AKT pathways. The expression and activation of C/EBPβ is essential for MCE and terminal adipocyte differentiation of 3T3-L1 preadipocytes.29 However, the mechanism by which C/EBPβ promotes MCE at the early stage of preadipocytes differentiation remains poorly understood. In our previous study, we have applied a promoter-wide ChIP-on-chip and gene expression microarrays to identify the target genes of C/EBPβ in 3T3-L1 cells harvested at 20 h after hormonal induction.11 By comparing gene chip data and 1311
dx.doi.org/10.1021/pr401292p | J. Proteome Res. 2014, 13, 1307−1314
Journal of Proteome Research
Article
Figure 5. Pkm2 was identified as a C/EBPβ target gene. (A) Growth-arrested 3T3-L1 preadipocytes were induced to differentiation. At 0 and 20 h postinduction, ChIP-qPCR was performed to show the binding of C/EBPβ to the promoters of Pkm2. Data normalized to the IgG controls at each time point. One region of the insulin gene serves as a negative control. (B, C, D) 3T3-L1 preadipocytes were transfected with siC/EBPβ, and after postconfluence, cells were induced to differentiation. The effect of knocking down C/EBPβ on the expression of C/EBPβ and Pkm2 was detected by RT-qPCR (B) and Western blotting (C), respectively. (D) On day 8 after induction, cells were stained with Oil red O. (E, F, G) Ectopic expression of PKM2 partially restored MCE but did not restore terminal adipocyte differentiation, which was inhibited by siC/EBPβ. 3T3-L1 preadipocytes were infected with empty vector or with retroviruses expressing PKM2. Then cells were transfected with the indicated siRNAs. After postconfluence, cells were induced to differentiation. (E) Cells were harvested at 20 h to detect the expression of the indicated genes by Western blotting. (F) At 20 h, the DNA content of the cells was analyzed by propidium iodide staining and flow cytometry. The percentages of the S phase were shown. *p < 0.05. (G) On day 8 after induction, cells were stained with Oil red O.
Role of PKM2 in MCE during 3T3-L1 Preadipocytes Differentiation
(siPKM2) was transfected into 3T3-L1 preadipocytes. Western blotting results confirmed the efficiency and specificity of PKM2 knockdown (Figure 4A). Compared with the negative control group, the cell numbers in the siPKM2 transfected group were significantly lower at 24, 48, and 96 h after introduction (Figure 4B). And the percentages of apoptotic and necrotic cells were determined to show the effect of siPKM2 on cell death. As shown in Figure 4C, no difference in the percentages of apoptotic (Apop) and necrotic (Nec) cells was detected between siNC-treated cells and siPKM2-treated cells, thereby precluding the possibility that the reduction of cell number by siPKM2 was due to cell death. FACS showed that knockdown of PKM2 resulted in a significant reduction in the percentage of the cell population in the S phase with a concomitant increase in the percentage of the cell population in the G1 phase (Figure 4D). In addition, not only MCE was inhibited after PKM2 was knocked down, the terminal differentiation of 3T3-L1 cells was also suppressed, as indicated by Oil Red O staining (Figure 4E). Taken together, these results indicate that PKM2 is essential for 3T3-L1 preadipocyte MCE and terminal differentiation. C/EBPβ, a key transcriptional activator of C/EBPα and PPARγ genes, is critical for MCE during adipogenesis.35−38 When subjected to the same differentiation protocol used to induce adipogenesis with 3T3-L1 preadipocytes, a subset of mouse embryo fibroblasts (MEFs) undergoes MCE and
PKM2 is a rate-limiting glycolytic enzyme that catalyzes the conversion of phosphoenolpyruvate (PEP) and ADP to pyruvate and ATP. Because of its critical role in aerobic glycolysis of tumor cells (the Warburg effect), PKM2 has generated much interest in recent years.31 When PKM2 is replaced by PKM1 in human cancer cells, the Warburg effect, including increased glucose uptake, increased lactate production, and decreased O2 consumption, can be reversed.32 Besides its contribution to anabolic metabolism that promotes cancer cell proliferation and tumor growth, PKM2 was also reported to regulate cell cycle and promote oncogene expression.33,34 In the present quantitative proteomics study, the expression of PKM2 was continuously elevated during 3T3-L1 preadipocyte early differentiation (Figure 3A). The protein quantity of PKM2 was remarkably increased by 3.4 times after 20 h of stimulation. RTqPCR and western-blotting further verified that the expression of PKM2 was significantly elevated at 4, 8, 12, 16, 20, 24, and 28 h both at the mRNA level (Figure 3B) and at the protein level (Figure 3C). And the change of protein expression slightly lags behind mRNA, as shown in Figure 3. The phenomenon indicated that PKM2 did play a role in 3T3-L1 preadipocye differentiation. To investigate whether PKM2 is involved in regulating MCE during 3T3-L1 preadipocyte differentiation, PKM2 siRNA 1312
dx.doi.org/10.1021/pr401292p | J. Proteome Res. 2014, 13, 1307−1314
Journal of Proteome Research
■
terminal differentiation into adipocytes, while MEFs from C/ EBPβ (−/−) mice neither undergo MCE nor differentiate into adipocytes.29 We have identified PKM2 as a potential C/EBPβ target gene by utilizing promoter wide chromatin immunoprecipitation (ChIP)-on-chip analysis combined with gene expression microarrays in a previous study.11 As shown in Figure 5A, ChIP-qPCR confirmed that the PKM2 promoter fragment was significantly enriched by the C/EBPβ antibody at 20 h after adipogenic induction. To examine the relationship between C/EBPβ and PKM2, C/EBPβ siRNA (siC/EBPβ) was transfected into 3T3-L1 preadipocytes to suppress C/EBPβ expression. RT-qPCR and Western blotting results revealed that PKM2 was down-regulated at both the mRNA level (Figure 5B) and the protein level (Figure 5C) upon the suppression of C/EBPβ expression. And 3T3-L1 preadipocytes adipogenesis was inhibited, as indicated by Oil Red O staining (Figure 5D). These results suggest that PKM2 is regulated by C/EBPβ in 3T3-L1 preadipocytes differentiation. Furthermore, PKM2 was overexpressed following silencing of C/EBPβ (Figure 5E). Ectopic expression of PKM2 partially restored MCE, which was inhibited by siC/EBPβ (Figure 5F). Nonetheless, ectopic expression of PKM2 did not restore siC/EBPβ-mediated inhibition of terminal adipocyte differentiation (Figure 5G). This is understandable, because C/EBPβ is directly involved in the transactivation of adipogenic master genes (PPARγ and C/EBPα), a process that could not be rescued simply by ectopic expression of PKM2 upon C/EBPβ depletion. Anyway, these data highlight that PKM2 is an important downstream effector of C/EBPβ in the process of MCE.
■
Article
ASSOCIATED CONTENT
S Supporting Information *
Figures showing DNA replication, reporter ions MS/MS spectrograms, Western-blotting results, box-plot analysis, PCA analysis, Venn diagrams of comparison of various profiles, and an interaction network of patterned proteins, and tables showing 595 proteins according to four dynamic expression modes and quantitative information of all 3152 proteins. This material is available free of charge via the Internet at http:// pubs.acs.org.
■
AUTHOR INFORMATION
Corresponding Authors
*L.-Q.X.: tel, +86 21 54237535; fax, +86 21 54237961; e-mail, [email protected]. *Q.-Q.T.: tel, +86 21 54237198; fax, +86 21 54237290; e-mail, [email protected]. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS This research is supported by National Key Basic Research Project Grants 2011CB910201 and 2013CB530601, the State Key Program of National Natural Science Foundation 31030048C120114; National Natural Science Foundation Grants 31000603, 31370027, and 21105015, and Shanghai Leading Academic Discipline Project B110 and 985 Project 985 III-YFX0302. We thank AB SCIEX Company for proteome data analysis technical help.
■
CONCLUSIONS
REFERENCES
(1) Haslam, D. W.; James, W. P. Obesity. Lancet 2005, 366 (9492), 1197−209. (2) Shepherd, P. R.; Gnudi, L.; Tozzo, E.; Yang, H.; Leach, F.; Kahn, B. B. Adipose cell hyperplasia and enhanced glucose disposal in transgenic mice overexpressing GLUT4 selectively in adipose tissue. J. Biol. Chem. 1993, 268 (30), 22243−6. (3) Tang, Q. Q.; Otto, T. C.; Lane, M. D. Mitotic clonal expansion: a synchronous process required for adipogenesis. Proc. Natl. Acad. Sci. U. S. A. 2003, 100 (1), 44−9. (4) Reichert, M.; Eick, D. Analysis of cell cycle arrest in adipocyte differentiation. Oncogene 1999, 18 (2), 459−66. (5) Yeh, W. C.; Bierer, B. E.; McKnight, S. L. Rapamycin inhibits clonal expansion and adipogenic differentiation of 3T3-L1 cells. Proc. Natl. Acad. Sci. U. S. A. 1995, 92 (24), 11086−90. (6) Tang, Q. Q.; Lane, M. D. Activation and centromeric localization of CCAAT/enhancer-binding proteins during the mitotic clonal expansion of adipocyte differentiation. Genes Dev. 1999, 13 (17), 2231−41. (7) Birsoy, K.; Chen, Z.; Friedman, J. Transcriptional regulation of adipogenesis by KLF4. Cell Metab. 2008, 7 (4), 339−47. (8) Cornelius, P.; MacDougald, O. A.; Lane, M. D. Regulation of adipocyte development. Annu. Rev. Nutr. 1994, 14, 99−129. (9) Fumoto, T.; Yamaguchi, T.; Hirose, F.; Osumi, T. Orphan nuclear receptor Nur77 accelerates the initial phase of adipocyte differentiation in 3T3-L1 cells by promoting mitotic clonal expansion. J. Biochem. 2007, 141 (2), 181−92. (10) Zhang, Y. Y.; Li, X.; Qian, S. W.; Guo, L.; Huang, H. Y.; He, Q.; Liu, Y.; Ma, C. G.; Tang, Q. Q. Transcriptional activation of histone H4 by C/EBPbeta during the mitotic clonal expansion of 3T3-L1 adipocyte differentiation. Mol. Biol. Cell 2011, 22 (13), 2165−74. (11) Guo, L.; Li, X.; Huang, J. X.; Huang, H. Y.; Zhang, Y. Y.; Qian, S. W.; Zhu, H.; Zhang, Y. D.; Liu, Y.; Liu, Y.; Wang, K. K.; Tang, Q. Q. Histone demethylase Kdm4b functions as a co-factor of C/EBPbeta to
Using iTRAQ-2DLC-MS/MS technology, we successfully acquired a comprehensive and detailed dynamic proteome expression involved in the initial 28 h during 3T3-L1 adipocytes differentiation. Altogether, 3152 nonredundant proteins were confidently quantified, and 595 of them were consistent with four dynamic expression modes, designed by setting protein amount at 20 h (S phase) as maximum or minimum. Those proteins were likely to be involved in MCE during adipogenesis. Among them, two patterned proteins, PKM2 and RRP1B, were identified in all three high-throughput data, including (ChIP)-on-chip analysis, gene expression microarrays, and iTRAQ-2DLC-MS/MS. Functional analysis suggested that positive correlations may exist in C/EBPβ, PIN1, and PKM2, which may be correlated with the PI3K-AKT-mTOR pathway. Knockdown of PKM2 expression by RNA interference (RNAi) repressed MCE and terminal differentiation of 3T3-L1 preadipocytes, suggesting PKM2 is required for MCE during 3T3-L1 preadipocytes differentiation. Furthermore, knockdown of C/EBPβ can down-regulated PKM2 expression and inhibited 3T3-L1 preadipocytes adipogenesis. And overexpressed PKM2 can partially restore MCE, although it did not restore terminal adipocyte differentiation, which was inhibited by siC/EBPβ. All these molecular-biological experiments indicated that the expression of PKM2 is regulated by C/ EBPβ and is involved in MCE during adipocyte differentiation. In sum, the patterned proteins identified here provide a promising basis for revealing molecular mechanisms that regulate preadipocyte differentiation. 1313
dx.doi.org/10.1021/pr401292p | J. Proteome Res. 2014, 13, 1307−1314
Journal of Proteome Research
Article
promote mitotic clonal expansion during differentiation of 3T3-L1 preadipocytes. Cell Death Differ. 2012, 19 (12), 1917−27. (12) Soukas, A.; Socci, N. D.; Saatkamp, B. D.; Novelli, S.; Friedman, J. M. Distinct transcriptional profiles of adipogenesis in vivo and in vitro. J. Biol. Chem. 2001, 276 (36), 34167−74. (13) Fu, M.; Sun, T.; Bookout, A. L.; Downes, M.; Yu, R. T.; Evans, R. M.; Mangelsdorf, D. J. A Nuclear Receptor Atlas: 3T3-L1 adipogenesis. Mol. Endocrinol. 2005, 19 (10), 2437−50. (14) Kratchmarova, I.; Kalume, D. E.; Blagoev, B.; Scherer, P. E.; Podtelejnikov, A. V.; Molina, H.; Bickel, P. E.; Andersen, J. S.; Fernandez, M. M.; Bunkenborg, J.; Roepstorff, P.; Kristiansen, K.; Lodish, H. F.; Mann, M.; Pandey, A. A proteomic approach for identification of secreted proteins during the differentiation of 3T3-L1 preadipocytes to adipocytes. Mol. Cell. Proteomics 2002, 1 (3), 213−22. (15) Adachi, J.; Kumar, C.; Zhang, Y.; Mann, M. In-depth analysis of the adipocyte proteome by mass spectrometry and bioinformatics. Mol. Cell. Proteomics 2007, 6 (7), 1257−73. (16) Welsh, G. I.; Griffiths, M. R.; Webster, K. J.; Page, M. J.; Tavare, J. M. Proteome analysis of adipogenesis. Proteomics 2004, 4 (4), 1042−51. (17) Atiar Rahman, M.; Kumar, S. G.; Lee, S. H.; Hwang, H. S.; Kim, H. A.; Yun, J. W. Proteome analysis for 3T3-L1 adipocyte differentiation. J. Microbiol. Biotechnol. 2008, 18 (12), 1895−902. (18) Molina, H.; Yang, Y.; Ruch, T.; Kim, J.-W.; Mortensen, P.; Otto, T.; Nalli, A.; Tang, Q.-Q.; Lane, M. D.; Chaerkady, R. Temporal profiling of the adipocyte proteome during differentiation using a fiveplex SILAC based strategy. J. Proteome Res. 2008, 8 (1), 48−58. (19) Zhong, J.; Krawczyk, S. A.; Chaerkady, R.; Huang, H.; Goel, R.; Bader, J. S.; Wong, G. W.; Corkey, B. E.; Pandey, A. Temporal profiling of the secretome during adipogenesis in humans. J. Proteome Res. 2010, 9 (10), 5228−38. (20) Newton, B. W.; Cologna, S. M.; Moya, C.; Russell, D. H.; Russell, W. K.; Jayaraman, A. Proteomic analysis of 3T3-L1 adipocyte mitochondria during differentiation and enlargement. J. Proteome Res. 2011, 10 (10), 4692−702. (21) Choi, S.; Cho, K.; Kim, J.; Yea, K.; Park, G.; Lee, J.; Ryu, S. H.; Kim, J.; Kim, Y. H. Comparative proteome analysis using aminereactive isobaric tagging reagents coupled with 2D LC/MS/MS in 3T3-L1 adipocytes following hypoxia or normoxia. Biochem. Biophys. Res. Commun. 2009, 383 (1), 135−140. (22) Ye, F.; Zhang, H.; Yang, Y. X.; Hu, H. D.; Sze, S. K.; Meng, W.; Qian, J.; Ren, H.; Yang, B. L.; Luo, M. Y.; Wu, X.; Zhu, W.; Cai, W. J.; Tong, J. B. Comparative proteome analysis of 3T3-L1 adipocyte differentiation using iTRAQ-coupled 2D LC-MS/MS. J. Cell. Biochem. 2011, 112 (10), 3002−14. (23) Patel, Y. M.; Lane, M. D. Mitotic clonal expansion during preadipocyte differentiation: calpain-mediated turnover of p27. J. Biol. Chem. 2000, 275 (23), 17653−60. (24) Wu, Y.; Zhou, S.; Smas, C. M. Downregulated expression of the secreted glycoprotein follistatin-like 1 (Fstl1) is a robust hallmark of preadipocyte to adipocyte conversion. Mech. Dev. 2010, 127 (3), 183− 202. (25) Tremblay, F.; Gagnon, A.; Veilleux, A.; Sorisky, A.; Marette, A. Activation of the mammalian target of rapamycin pathway acutely inhibits insulin signaling to Akt and glucose transport in 3T3-L1 and human adipocytes. Endocrinology 2005, 146 (3), 1328−37. (26) Bao, L.; Kimzey, A.; Sauter, G.; Sowadski, J. M.; Lu, K. P.; Wang, D. G. Prevalent overexpression of prolyl isomerase Pin1 in human cancers. Am. J. Pathol. 2004, 164 (5), 1727−37. (27) Rizzolio, F.; Caligiuri, I.; Lucchetti, C.; Fratamico, R.; Tomei, V.; Gallo, G.; Agelan, A.; Ferrari, G.; Toffoli, G.; Klein-Szanto, A. J.; Giordano, A. Dissecting Pin1 and phospho-pRb regulation. J. Cell. Physiol. 2013, 228 (1), 73−7. (28) Vanella, L.; Li, M.; Kim, D.; Malfa, G.; Bellner, L.; Kawakami, T.; Abraham, N. G. ApoA1: mimetic peptide reverses adipocyte dysfunction in vivo and in vitro via an increase in heme oxygenase (HO-1) and Wnt10b. Cell Cycle 2012, 11 (4), 706−14.
(29) Tang, Q. Q.; Otto, T. C.; Lane, M. D. CCAAT/enhancerbinding protein beta is required for mitotic clonal expansion during adipogenesis. Proc. Natl. Acad. Sci. U. S. A. 2003, 100 (3), 850−5. (30) Phelps, D. E.; Xiong, Y. Regulation of cyclin-dependent kinase 4 during adipogenesis involves switching of cyclin D subunits and concurrent binding of p18INK4c and p27Kip1. Cell Growth Differ. 1998, 9 (8), 595−610. (31) Luo, W.; Semenza, G. L. Emerging roles of PKM2 in cell metabolism and cancer progression. Trends Endocrinol. Metab. 2012, 23 (11), 560−6. (32) Christofk, H. R.; Vander Heiden, M. G.; Harris, M. H.; Ramanathan, A.; Gerszten, R. E.; Wei, R.; Fleming, M. D.; Schreiber, S. L.; Cantley, L. C. The M2 splice isoform of pyruvate kinase is important for cancer metabolism and tumour growth. Nature 2008, 452 (7184), 230−233. (33) Yang, W.; Xia, Y.; Ji, H.; Zheng, Y.; Liang, J.; Huang, W.; Gao, X.; Aldape, K.; Lu, Z. Nuclear PKM2 regulates [bgr]-catenin transactivation upon EGFR activation. Nature 2011, 480 (7375), 118−122. (34) Yang, W.; Xia, Y.; Hawke, D.; Li, X.; Liang, J.; Xing, D.; Aldape, K.; Hunter, T.; Alfred Yung, W.; Lu, Z. PKM2 phosphorylates histone H3 and promotes gene transcription and tumorigenesis. Cell 2012, 150 (4), 685−696. (35) Yeh, W. C.; Cao, Z.; Classon, M.; McKnight, S. L. Cascade regulation of terminal adipocyte differentiation by three members of the C/EBP family of leucine zipper proteins. Genes Dev. 1995, 9 (2), 168−81. (36) Christy, R. J.; Kaestner, K. H.; Geiman, D. E.; Lane, M. D. CCAAT/enhancer binding protein gene promoter: binding of nuclear factors during differentiation of 3T3-L1 preadipocytes. Proc. Natl. Acad. Sci. U. S. A. 1991, 88 (6), 2593−7. (37) Tang, Q.-Q.; Jiang, M.-S.; Lane, M. D. Repressive effect of Sp1 on the C/EBPα gene promoter: role in adipocyte differentiation. Mol. Cell. Biol. 1999, 19 (7), 4855−4865. (38) Clarke, S. L.; Robinson, C. E.; Gimble, J. M. CAAT/enhancer binding proteins directly modulate transcription from the peroxisome proliferator-activated receptor gamma 2 promoter. Biochem. Biophys. Res. Commun. 1997, 240 (1), 99−103.
1314
dx.doi.org/10.1021/pr401292p | J. Proteome Res. 2014, 13, 1307−1314
Proteome Profiling of Mitotic Clonal Expansion during 3T3-L1 Adipocyte Differentiation Using iTRAQ-2DLC-MS/MS Yan Jiang,†,§ Liang Guo,† Li-Qi Xie,*,‡ You-You Zhang,† Xiao-Hui Liu,‡ Yang Zhang,‡ Hao Zhu,† Peng-Yuan Yang,‡ Hao-Jie Lu,‡ and Qi-Qun Tang*,†,‡ †
Key Laboratory of Molecular Medicine, the Ministry of Education, Department of Biochemistry and Molecular Biology, Fudan University Shanghai Medical College, Shanghai 200032, People’s Republic of China § Department of Forensic Medicine, Fudan University Shanghai Medical College, Shanghai 200032, People’s Republic of China ‡ Institute of Stem Cell Research and Regenerative Medicine, Institutes of Biomedical Sciences, Fudan University, Shanghai 200032, People’s Republic of China S Supporting Information *
ABSTRACT: Mitotic clonal expansion (MCE) is one of the important events taking place at the early stage during 3T3-L1 adipocyte differentiation. To investigate the mechanism underlying this process, we carried out a temporal proteomic analysis to profile the dynamic changes in MCE. Using 8-plexiTRAQ-2DLC-MS/MS analysis, 3152 proteins were quantified during the initial 28 h of 3T3-L1 adipogenesis. Functional analysis was performed on 595 proteins with maximum or minimum quantities at 20 h of adipogenic induction that were potentially involved in MCE, which identified PI3K/AKT/ mTOR as the most relevant pathway. Among the 595 proteins, PKM2 (Pyruvate kinase M2), a patterned protein identified as a potential target gene of C/EBPβ in our previous work, was selected for further investigation. Network analysis suggested positive correlations among C/EBPβ, PIN1, and PKM2, which may be related with the PI3K-AKT pathway. Knockdown of PKM2 with siRNA inhibited both MCE and adipocyte differentiation of 3T3-L1 cells. Moreover, PKM2 was down-regulated at both the mRNA level and the protein level upon the knockdown of C/EBPβ. And overexpressed PKM2 can partially restore MCE, although it did not restore terminal adipocyte differentiation, which was inhibited by siC/EBPβ. Thus, PKM2, potentially regulated by C/EBPβ, is involved in MCE during adipocyte differentiation. The dynamic proteome changes quantified here provide a promising basis for revealing molecular mechanism regulating adipogenesis. KEYWORDS: 3T3-L1 preadipocyte, mitotic clonal expansion, proteomics, iTRAQ
■
INTRODUCTION Excessive accumulation of adipocytes can result in obesity, which is a major risk factor related to the development of type II diabetes, cardiovascular disease, cancer, and sleep-disordered breathing.1 The excessive energy increases adipocyte number through promoting stem cells commitment to the adipocyte lineage followed by preadipocytes differentiate into adipocytes.2 As a result, the molecular mechanisms that regulate the preadipocyte differentiation are worth careful investigation. The 3T3-L1 cell line is successfully used as an in vitro model for monitoring preadipocytes differentiation into adipocytes. Stimulated with a hormonal cocktail consisting of insulin, dexamethasone, and isobutylmethyxanthine, 3T3-L1 preadipocyte synchronously reenters the cell cycle. After two rounds of MCE, the growth-arrested 3T3-L1 cells express genes that give rise to the adipocyte phenotype.3 Numerous experimental observations confirmed that MCE is one of the key events taking place during the early stage of adipogenesis, and the first 28 h is a critical time for finishing the first round of MCE.3−5 © 2014 American Chemical Society
The MCE involves a transcriptional cascade, among which the CCAAT/enhancer-binding proteins (C/EBPs) and Peroxisome Proliferator-Activated receptor γ (PPARγ) are considered to play an essential role.6 C/EBP β and C/EBP δ are expressed very early in the program, while C/EBPα and PPARγ are stimulated much later. Besides, some other factors, such as Krupel-like factors (KLFs), c-myc, Nur77, and cell-cycle proteins, are also involved at the early stage of adipogenesis.7−9 Furthermore, recent studies have demonstrated that the expression of histone H4 and histone demethylase Kdm4b are closely correlated with the above events, and both the histone H4 gene promoter (hist4h4) and Kdm4b promoter possess functional C/EBP-binding sites.10,11 Despite the important role of C/EBPβ and related factors, the precise mechanism by which the preadipocyte reenters the cell cycle and undergoes MCE is not fully understood. Received: August 26, 2013 Published: January 22, 2014 1307
dx.doi.org/10.1021/pr401292p | J. Proteome Res. 2014, 13, 1307−1314
Journal of Proteome Research
Article
Protein Extraction and 8-plex iTRAQ Labeling
In recent years, various high-throughput technologies, such as gene expression microarray and proteomic approaches, were successively adopted in adipogenesis studies. The omics-scale profiling enables a global view on biological processes and molecular networks. Many genes potentially involved in the regulation of early adipocytes differentiation were identified from gene expression profiling, and some important transcriptional regulators, including KLF4, Egr2(Krox20), Nr4al, etc., were certified by subsequent functional studies.7,12,13 Although proteins are the main component of the physiological metabolic pathways, proteomic approaches are much less used for identifying proteins during adipogenesis. Early proteome analysis of adipogensis mainly applied one- or two-dimensional gel electrophoreses for separation and tandem mass spectrometry for protein identification.14−17 On account of higher throughput, stable isotope labeling combined with LC-MS/MS analysis is used for profiling adipocyte differentiation in recent studies.18−22 Among these methods, isobaric tags for relative and absolute quantification (iTRAQ) achieve sensitive and accurate protein quantification by using reporter ion pairs in the low mass range of MS2 spectra for quantitation. And the multiplexing technique enables quantification of up to 8 different samples in a single MS based experiment. In this study, we employed iTRAQ-8plex to monitor the temporal dynamics of protein expression throughout the first 28 h of 3T3-L1 adipocytes differentiation after hormone cocktail stimulation. Altogether, 3152 nonredundant proteins were confidently quantified, and 595 of them were considered to be related to MCE during adipogenesis by vector mode analysis. Functional analysis indicates an important role of PKM2 during the early stage of 3T3-L1 adipocyte differentiation, and subsequent molecular-biological experiments verified its function in this process.
■
Collected 3T3-L1 cells of 8 time points were washed three times with phosphate-buffered saline (PBS) to remove cell culture medium, and then lysed in buffer containing 7 M urea, 2 M thiourea, 1 mM phenylmethanesulfonyl fluoride (PMSF), and protease inhibitors cocktails, respectively. The cell lysates were sonicated in ice cold water and spun for 30 min at 4 °C, and then centrifuged at 12,000g for 40 min at 4 °C to collect the supernatant. Protein concentration was determined through Bradford assay. 120 μg of proteins from each time point was subjected to ice acetone precipitation overnight. After centrifugation, the pellet was resuspended by 20 μL of 500 mm triethylammonium bicarbonate (TEAB); denaturant was added as cosolvent. Subsequently, the resuspended proteins were reduced, alkylated, and digested with trypsin according to the manufacturer’s protocol (Applied Biosystems, Framingham, MA, USA). Samples were iTRAQ labeled as follows: 0 h, 113; 4 h, 114; 8 h, 115; 12 h, 116; 16 h, 117; 20 h, 118; 24 h, 119; 28 h, 121. The labeled peptide samples were then pooled and lyophilized in a vacuum concentrator prior to SCX fractionation. SCX-RPLC Separation and Mass Spectrometric Analysis
The peptide mixtures were resuspended in 80 μL buffer A and fractioned using a 5 μm, 2.1 mm × 100 mm Polysulfethyl column (The Nest Group, Southborough, USA) at a constant flow rate of 0.2 mL/min. Buffer A consisted of 10 mM KH2PO4 and 25% acetonitrile, pH 2.6. Buffer B is 10 mM KH2PO4, 25% acetonitrile, and 350 mM KCl, pH 2.6. The 60-min gradient starts with 100% A for 5 min, followed by a linear gradient from 5% B to 25% B for 35 min, to 80% B for 5 min, maintained 80% B for 5 min, and finally 100% A for 10 min. The wavelength of the UV detector was set at 280 nm. A total of 20 SCX fractions were collected, and every fraction was desalted with a C18 cartridge (Sep-Pak C18 1 cc Vac Cartridge, waters) and dried in a vacuum concentrator for subsequent nano-LC-MS/MS analysis. The dried fraction of iTRAQ-labeled peptides was redissolved in 50 μL of 0.1% formic acid and 5% acetonitrile. To confirm the sample pretreatment and separation is qualified for proteome analysis, 20 μL of sample was subjected to 20AD HPLC (Shimadzu, Japan) coupled with Q-STAQ XL (Applied Biosystems, Foster City, USA) for LC-MS/MS analysis. The peptides were separated by a 65 min linear gradient of 5% to 36.5% acetonitrile in 0.1% formic acid at a flow rate of 0.3 μL/ min. The mass spectrometer was set to perform data acquisition in the positive ion mode, with a selected mass range of 400−1800 m/z. The top three precursor peaks were selected for CID fragmentation, with a MS/MS fragment ion scan range of 100−2000 m/z. After the confirmation, 20 μL of them was injected into the NanoLC-1D Plus HPLC (AB SCIEX, Eksigent Technologies, Dublin, CA) coupled online with a TripleTOF 5600 (AB SCIEX, Framingham, USA). The peptide mixture was separated on a ZORBAX 300SB-C18 column (5 μm particle size, 0.1 mm × 150 mm length, and 300 Å pore size, Agilent, Palo Alto, USA) with a 85 min linear gradient of 5% to 36.5% acetonitrile in 0.1% formic acid. The flow rate was 0.3 μL/min. The mass range was set as 400−1800 m/z. The top 15 precursor peaks were selected for CID fragmentation. Three technical replicates were processed.
EXPERIMENTAL SECTION
Cell Culture and Induction of Differentiation
3T3-L1 preadipocytes were propagated and maintained as described.11 To induce the differentiation, 2-day postconfluent 3T3-L1 preadipocytes (designated 0 day) were fed DMEM containing 10% fetal bovine serum (FBS), 1 μg/mL insulin, 1 μM dexamethasone, and 0.5 mM 3-isobutyl-1-methylxanthine (MIX) until day 2. The adipocyte phenotype begins on day 3 and reaches maximum by day 8. For proteome analysis, 3T3-L1 cells were harvested at 0, 4, 8, 12, 16, 20, 24, and 28 h after hormonal induction. Oil Red O Staining
Cells were washed three times with PBS and then fixed for 5 min with 3.7% formaldehyde. Oil red O (0.5% in isopropanol) was diluted with water (3:2), filtered through a 0.45 μm filter, and incubated with the fixed cells for 1 h at room temperature. After that, cells were washed with water, and the stained fat droplets in the cells were visualized by light microscopy and photographed. Flow Cytometric Analysis
Cells were trypsinized and fixed with 2% (wt/vol) paraformaldehyde in 1× PBS. Then they were treated with 0.5 mg/mL RNase A for 1 h at room temperature and incubated with 0.1 mg/mL propidium iodide (Sigma, St. Louis, MO, USA) for 45 min at 37 °C. Cells were further analyzed with use of a fluorescence-activated cell sorter (FACS).
Data Analysis and Functional Interpretation
Protein identification and quantification for iTRAQ experiments was carried out using ProteinPilot 4.2 software (Applied 1308
dx.doi.org/10.1021/pr401292p | J. Proteome Res. 2014, 13, 1307−1314
Journal of Proteome Research
Article
(downstream). RT-qPCR data were normalized to the 0 h time point of control RNAi-treated cells.
Biosystems; MDS-Sciex). Database search was performed against a target-decoy database constructed based on a SwissProt mouse. Only proteins identified with at least 95% confidence, and a ProtScore of 1.3, were reported. iTRAQ reporter intensities of these peptides were referenced to obtain relative quantifications. The median and global distribution of the quantitative result for each labeling channel was visualized by box-plot. Principal component analysis (PCA) was used to evaluate differences among test groups. The first two principal components whose cumulative variance contribution rate was over 85% were selected to make the PCA diagram. Two vectors (1,2,3,4,4,4) and (1,2,3,4,3,2), were set to distinguish proteins with differential expression. The Pearson correlation coefficient was used as the threshold. When the absolute value of the Pearson correlation coefficient was >0.8 and p < 0.05, the corresponding protein was identified to have positive or negative correlation with the two vectors. In addition, IPA software (http://www.ingenuity.com) was used to complete function, pathway, and network analysis.
■
RESULTS AND DISCUSSION
Dynamic Changes of Protein Expression during the Early Stage of 3T3-L1 Preadipocytes Differentiation
The postconfluent 3T3-L1 preadipocytes that are growtharrested can be induced by MDI to reenter the cell cycle,
RNA Interference
Synthetic RNAi oligonucleotides specific for regions in the PKM2 and C/EBPβ mRNAs were designed and synthesized by Invitrogen (Carlsbad, CA, USA) Stealth RNAi. The silencing effects of several RNAi oligonucleotides were screened and tested initially for their ability to knock down the expression of these genes by RT-qPCR. The sequences (5′ to 3′) for successful RNAi knockdown were the following: GCCACAGAAAGCTTTGCAT for PKM2; CCCTGCGGAACTTGTTCAAGCAGCT for C/EBPβ. Stealth RNAi Negative Control Duplexes with a similar GC content were used as a negative control. 3T3-L1 cells were transfected at ∼50% confluence with RNAi oligonucleotides using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions.
Figure 1. Four dynamic expression modes during the early 28 h of preadipocytes differentiation. The x-axis units indicate the time points, and y-axis units indicate the normalized quantitative ratios (by dividing the sum of all six ratios). The relative quantities in 20 h were set as maximum or minimum, with the others (A) first rise then flat, (B) first drop then flat, (C) first rise then drop, and (D) first drop then rise.
undergo several rounds of MCE, and then differentiate into cells having the morphological and biochemical characteristics of adipocytes.3 The FACS result shows that the percentage of S phase cells after MDI stimulation were 4.99% in 4 h, 2.54% in 8 h, 3.21% in 12 h, 17.2% in 16 h, 44.8% in 20 h, 24.4% in 24 h, and 9.77% in 28 h after MDI stimulation (Supporting Information Figure 1), which indicates that the G1/S transition begins at 16 h and reaches a peak at 20 h (S-phase) after adipogenic induction. In line with previous studies,3−5 most of the 3T3-L1 cells undergo one round of MCE in the first 28 h postinduction. To investigate the mechanism regulating the cell cycle re-entry of preadipocytes, 3T3-L1 cells induced for 0−28 h were selected for further analysis. Using iTRAQ-2DLC-MS/MS, a comparative study was performed to analyze the dynamic changes of protein expression throughout the early 28 h of 3T3-L1 preadipocytes differentiation. The iTRAQ, a multiplex quantitative proteomics technique, enables comprehensive and detailed examination of dynamic protein expression during adipogenesis. Proteins harvested at 0, 4, 8, 12, 16, 20, 24, and 28 h after hormone stimulation were purified and labeled by 8-plex iTRAQ reagents, and then mixed together and analyzed by 2DLC-MS/MS. A total of 3152 nonredundant proteins were quantified with high confidence (Supporting Information Table 1). The average quantified proteins were 1702 for three replicated Triple TOF 5600 analysis, which almost doubled the quantified proteins of 994 in QSTAR XL analysis. Many proteins, which had been reported to play important roles in preadipocytes differentiation, such as C/EBPβ, CDKN1B(P27), RUNX2, COL1A1, MCM3, MTOR, PIN1, and APOA1, were quantified.6,10,11,23−28 According to the intensities of report ions, these proteins exhibited various dynamics changes during the early stage of preadipocytes differentiation
Western Blot Assay
Equal amounts of cell protein samples were separated by SDSPAGE on a 10% acrylamide gel and transferred to PVDF membranes, which were blocked with 5% milk (w/v) in TBST for 2 h at room temperature. Membranes were incubated overnight at 4 °C with primary antibody. Western blot bands were visualized using peroxidase-conjugated secondary antibody and ECL (Amersham-Pharmacia Biotech, Piscataway, NJ). Band densities were quantified with the Phoretix 2D Expression program (Nonlinear Dynamics, Durham, NC). RNA Isolation and Real-Time Quantitative PCR
Total RNAs were isolated using Trizol (Invitrogen) according to the manufacturer’s instruction. First-strand cDNAs were synthesized using the PrimeScript reverse transcriptase and Random primers (Takara Bio, Otsu, Japan). Real-time quantitative PCR (RT-qPCR) was performed using primers as described. Power SYBR Green PCR Mastermix (Applied Biosystems, Carlsbad, CA, USA) and the PRISM 7300 instrument (Applied Biosystems) were used. Analysis was performed using the standard curve method and normalization of all genes of interest to the control gene 18S rRNA. Primers pairs for RT-qPCR were as follows: mouse 18S, 5′CGCCGCTAGAGGTGAAATTCT-3′ (upstream) and 5′CATTCTTGGCAAATGCTTTCG-3′ (downstream); mouse Pkm2, 5′-GTGGCTCGGCTGAATTTCTCT-3′ (upstream) and 5′-CACCGCAACAGGACGGTAG-3′ (downstream); mouse C/EBPβ, 5′-ACGACTTCCTCTCCGACCTCT-3′ (upstream) and 5′-CGAGGCTCACGTAACCGTAGT-3′ 1309
dx.doi.org/10.1021/pr401292p | J. Proteome Res. 2014, 13, 1307−1314
Journal of Proteome Research
Article
Figure 2. Interaction network of the focus proteins associated with adipogenesis. The intensity of the node color indicates the protein expression differences after 20 h of hormone induction: green means down-regulated; red means up-regulated.
Figure 3. Dynamic expression of PKM2 during differentiation of 3T3-L1 preadipocytes. Two days after reaching confluence (0 h), 3T3-L1 preadipocytes were induced to differentiate into adipocytes using the standard differentiation protocol. The expression profiles of PKM2 during 0− 28 h after the induction were monitored by iTRAQ-2DLC-MS/MS (A), RT-qPCR (B), and Western-blotting (C), respectively. The expression of PKM2 is significantly elevated after induction of differentiation.
Information Figure 4). The spatial distribution of five testing time point, 12, 16, 20, 24, and 28 h, is relatively concentrated in PCA analysis, and the data of 0, 4, and 8 h were away from other time points (Supporting Information Figure 5). Maybe, after 4−8 h hormone stimulation, only a part of the 3T3-L1 cells has entered into MCE, which makes the quantitative data of the two time points have large differences from others in PCA analysis. Therefore, in the subsequent protein screening and biological analysis, only six testing points, 0, 12, 16, 20, 24, and 28 h, were used for investigation.
(Supporting Information Figure 2). For example, APOA1 declined steadily after hormone stimulation, while RUNX2, P27, and PIN1 showed a transient increase followed by a decrease. Before further functional study, we performed a western-blotting analysis on three proteins, C/EBPβ, PKM2, and MCM3. Protein expression profiles detected by iTRAQ2DLC-MS/MS and western-blotting are plotted together (Supporting Information Figure 3). Except a few differences at early time points, the two different mechanism methods showed identical quantitative changing tendency. To visualize a global view of how the samples and proteins relate to each other, box-plot analysis and PCA analysis were carried out. The width and median of boxes was similar among eight samples, which demonstrated that most data were at the same range and could be compared one by one (Supporting
Key Factors in MCE during Preadipocytes Differentiation
According to the FACS result, 3T3-L1 preadipocytes began entering the G1/S check point at about 16 h, and S-phase cells peaked at 20 h after hormone induction. Therefore, proteins that exhibited significant expression changes at 16 h ∼ 20 h may 1310
dx.doi.org/10.1021/pr401292p | J. Proteome Res. 2014, 13, 1307−1314
Journal of Proteome Research
Article
Figure 4. Pkm2 is required for MCE during 3T3-L1 preadipocyte differentiation. 3T3-L1 preadipocytes were transfected with Pkm2 siRNA (siPkm2); two days after reaching confluence, cells were induced to differentiation. (A) Cell lysates were harvested at 20 h, and the expression of Pkm2 was detected by Western blotting. (B) Cell numbers were determined at times indicated after induction (data normalized to 0 h time point). (C) The percentages of apoptotic (Apop) and necrotic (Nec) cells were determined after acridine orange/ethidium bromide co-staining by fluorescence microscopy on day 2. Acridine orange stained cells were evaluated for morphological characteristics of apoptosis, and cells staining positive for ethidium bromide were considered as necrotic. (D) DNA content was analyzed by propidium iodide staining and flow cytometry at 0 and 20 h time points. (E) On day 8 after induction, cells were stained with Oil red O. The preadipocytes adipogenesis was inhibited by PKM2 knock down.
iTRAQ-2DLC-MS/MS data, the changes in protein abundance and mRNA expression level can be correlated efficiently. Altogether, 17 genes were detected by all three platforms (Supporting Information Figure 6). Among them, PKM2 and RRP1B were in accordance with our designed modes, which implicates important functions of the two proteins in MCE. To further interpret our finding in a biological context, C/ EBPβ, CDKN1B, PKM2, RRP1B, and RUNX2 were selected as focused proteins to build the protein−protein interaction network with other patterned proteins. A close relationship between the focused proteins and PI3K-AKT/mTOR pathway related proteins was observed. As show in Supporting Information Figure 7, proteins related to the PI3K-AKT/ mTOR pathway, such as PIK3R1, MTOR, NPM1, ILK, FN1, EIF4EBP1, HSPA8, CDC37, PPP3CA, and STIP1, were found to play pivotal roles in the network, which indicated the important roles of this pathway in the preadipocytes differentiation process. For in-depth analysis of interactions between focus proteins, a subnetwork with the shortest path to describe the focused proteins’ interactions was constructed (Figure 2). CDKN1B, PI3K complex, and C/EBPβ show a vital role in the subnetworks. As shown in the subnetwork, CDKN1B is downregulated during preadipocytes differentiation, and the decline of CDKN1B was reported to be essential for initiating MCE.30 C/EBPβ, which shows comprehensive interactions with various kinases, has positive correlation tendency with PI3K complex, PIK3R1, PIN1, PKM2, MCM3, and MCM7. PIN1 (peptidylprolyl cis/trans isomerase, NIMA-interacting 1), was detected to be overexpressed in many human cancers, and its target proteins mainly function in regulation of the G0, G1/S check point.26,27 The subnetwork suggested that positive correlations in the preadipocytes differentiation process might exist among C/EBPβ, PIN1, and PKM2, and this might be related to the PI3K-AKT pathway, which deserved further study.
be relevant to the regulation of MCE. Setting the relative quantities in 20 h as maximum or minimum, four dynamic expression modes during the early 28 h of preadipocytes differentiation were designed accordingly: (A) first rise then flat, (B) first drop then flat, (C) first rise then drop, and (D) first drop then rise (Figure 1). A total of 595 proteins quantified by iTRAQ-2DLC-MS/MS analysis were in accordance with these modes (we named them patterned proteins, Supporting Information Table 2), in which 190 proteins met A, 265 proteins met B, 103 proteins met C, and 118 proteins met D (Figure 1). And there was overlap between A and C, B and D. The functional enrichment of GO biological processes and pathway enrichment analysis of the 595 patterned proteins was performed by IPA. The enriched functions of patterned proteins were mainly involved in embryonic development, multiple diseases (hepatic diseases, cardiovascular diseases, tumors, etc), skeletal and muscular development, as well as cardiovascular development. The result indicated that these patterned proteins are related to reproductive development and dysfunctional physiological processes such as cell death and abnormal proliferation. Pathway enrichment analysis identified PI3K/AKT/mTOR as the most relevant pathway. Based on previous research,10 RUNX2 blocked 3T3-L1 adipocyte differentiation by inhibiting MCE through the induction of CDKN1B expression. We speculated that the regulation of 3T3-L1 adipocyte differentiation by RUNX2 and CDKN1B may be associated with PI3K-AKT pathways. The expression and activation of C/EBPβ is essential for MCE and terminal adipocyte differentiation of 3T3-L1 preadipocytes.29 However, the mechanism by which C/EBPβ promotes MCE at the early stage of preadipocytes differentiation remains poorly understood. In our previous study, we have applied a promoter-wide ChIP-on-chip and gene expression microarrays to identify the target genes of C/EBPβ in 3T3-L1 cells harvested at 20 h after hormonal induction.11 By comparing gene chip data and 1311
dx.doi.org/10.1021/pr401292p | J. Proteome Res. 2014, 13, 1307−1314
Journal of Proteome Research
Article
Figure 5. Pkm2 was identified as a C/EBPβ target gene. (A) Growth-arrested 3T3-L1 preadipocytes were induced to differentiation. At 0 and 20 h postinduction, ChIP-qPCR was performed to show the binding of C/EBPβ to the promoters of Pkm2. Data normalized to the IgG controls at each time point. One region of the insulin gene serves as a negative control. (B, C, D) 3T3-L1 preadipocytes were transfected with siC/EBPβ, and after postconfluence, cells were induced to differentiation. The effect of knocking down C/EBPβ on the expression of C/EBPβ and Pkm2 was detected by RT-qPCR (B) and Western blotting (C), respectively. (D) On day 8 after induction, cells were stained with Oil red O. (E, F, G) Ectopic expression of PKM2 partially restored MCE but did not restore terminal adipocyte differentiation, which was inhibited by siC/EBPβ. 3T3-L1 preadipocytes were infected with empty vector or with retroviruses expressing PKM2. Then cells were transfected with the indicated siRNAs. After postconfluence, cells were induced to differentiation. (E) Cells were harvested at 20 h to detect the expression of the indicated genes by Western blotting. (F) At 20 h, the DNA content of the cells was analyzed by propidium iodide staining and flow cytometry. The percentages of the S phase were shown. *p < 0.05. (G) On day 8 after induction, cells were stained with Oil red O.
Role of PKM2 in MCE during 3T3-L1 Preadipocytes Differentiation
(siPKM2) was transfected into 3T3-L1 preadipocytes. Western blotting results confirmed the efficiency and specificity of PKM2 knockdown (Figure 4A). Compared with the negative control group, the cell numbers in the siPKM2 transfected group were significantly lower at 24, 48, and 96 h after introduction (Figure 4B). And the percentages of apoptotic and necrotic cells were determined to show the effect of siPKM2 on cell death. As shown in Figure 4C, no difference in the percentages of apoptotic (Apop) and necrotic (Nec) cells was detected between siNC-treated cells and siPKM2-treated cells, thereby precluding the possibility that the reduction of cell number by siPKM2 was due to cell death. FACS showed that knockdown of PKM2 resulted in a significant reduction in the percentage of the cell population in the S phase with a concomitant increase in the percentage of the cell population in the G1 phase (Figure 4D). In addition, not only MCE was inhibited after PKM2 was knocked down, the terminal differentiation of 3T3-L1 cells was also suppressed, as indicated by Oil Red O staining (Figure 4E). Taken together, these results indicate that PKM2 is essential for 3T3-L1 preadipocyte MCE and terminal differentiation. C/EBPβ, a key transcriptional activator of C/EBPα and PPARγ genes, is critical for MCE during adipogenesis.35−38 When subjected to the same differentiation protocol used to induce adipogenesis with 3T3-L1 preadipocytes, a subset of mouse embryo fibroblasts (MEFs) undergoes MCE and
PKM2 is a rate-limiting glycolytic enzyme that catalyzes the conversion of phosphoenolpyruvate (PEP) and ADP to pyruvate and ATP. Because of its critical role in aerobic glycolysis of tumor cells (the Warburg effect), PKM2 has generated much interest in recent years.31 When PKM2 is replaced by PKM1 in human cancer cells, the Warburg effect, including increased glucose uptake, increased lactate production, and decreased O2 consumption, can be reversed.32 Besides its contribution to anabolic metabolism that promotes cancer cell proliferation and tumor growth, PKM2 was also reported to regulate cell cycle and promote oncogene expression.33,34 In the present quantitative proteomics study, the expression of PKM2 was continuously elevated during 3T3-L1 preadipocyte early differentiation (Figure 3A). The protein quantity of PKM2 was remarkably increased by 3.4 times after 20 h of stimulation. RTqPCR and western-blotting further verified that the expression of PKM2 was significantly elevated at 4, 8, 12, 16, 20, 24, and 28 h both at the mRNA level (Figure 3B) and at the protein level (Figure 3C). And the change of protein expression slightly lags behind mRNA, as shown in Figure 3. The phenomenon indicated that PKM2 did play a role in 3T3-L1 preadipocye differentiation. To investigate whether PKM2 is involved in regulating MCE during 3T3-L1 preadipocyte differentiation, PKM2 siRNA 1312
dx.doi.org/10.1021/pr401292p | J. Proteome Res. 2014, 13, 1307−1314
Journal of Proteome Research
■
terminal differentiation into adipocytes, while MEFs from C/ EBPβ (−/−) mice neither undergo MCE nor differentiate into adipocytes.29 We have identified PKM2 as a potential C/EBPβ target gene by utilizing promoter wide chromatin immunoprecipitation (ChIP)-on-chip analysis combined with gene expression microarrays in a previous study.11 As shown in Figure 5A, ChIP-qPCR confirmed that the PKM2 promoter fragment was significantly enriched by the C/EBPβ antibody at 20 h after adipogenic induction. To examine the relationship between C/EBPβ and PKM2, C/EBPβ siRNA (siC/EBPβ) was transfected into 3T3-L1 preadipocytes to suppress C/EBPβ expression. RT-qPCR and Western blotting results revealed that PKM2 was down-regulated at both the mRNA level (Figure 5B) and the protein level (Figure 5C) upon the suppression of C/EBPβ expression. And 3T3-L1 preadipocytes adipogenesis was inhibited, as indicated by Oil Red O staining (Figure 5D). These results suggest that PKM2 is regulated by C/EBPβ in 3T3-L1 preadipocytes differentiation. Furthermore, PKM2 was overexpressed following silencing of C/EBPβ (Figure 5E). Ectopic expression of PKM2 partially restored MCE, which was inhibited by siC/EBPβ (Figure 5F). Nonetheless, ectopic expression of PKM2 did not restore siC/EBPβ-mediated inhibition of terminal adipocyte differentiation (Figure 5G). This is understandable, because C/EBPβ is directly involved in the transactivation of adipogenic master genes (PPARγ and C/EBPα), a process that could not be rescued simply by ectopic expression of PKM2 upon C/EBPβ depletion. Anyway, these data highlight that PKM2 is an important downstream effector of C/EBPβ in the process of MCE.
■
Article
ASSOCIATED CONTENT
S Supporting Information *
Figures showing DNA replication, reporter ions MS/MS spectrograms, Western-blotting results, box-plot analysis, PCA analysis, Venn diagrams of comparison of various profiles, and an interaction network of patterned proteins, and tables showing 595 proteins according to four dynamic expression modes and quantitative information of all 3152 proteins. This material is available free of charge via the Internet at http:// pubs.acs.org.
■
AUTHOR INFORMATION
Corresponding Authors
*L.-Q.X.: tel, +86 21 54237535; fax, +86 21 54237961; e-mail, [email protected]. *Q.-Q.T.: tel, +86 21 54237198; fax, +86 21 54237290; e-mail, [email protected]. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS This research is supported by National Key Basic Research Project Grants 2011CB910201 and 2013CB530601, the State Key Program of National Natural Science Foundation 31030048C120114; National Natural Science Foundation Grants 31000603, 31370027, and 21105015, and Shanghai Leading Academic Discipline Project B110 and 985 Project 985 III-YFX0302. We thank AB SCIEX Company for proteome data analysis technical help.
■
CONCLUSIONS
REFERENCES
(1) Haslam, D. W.; James, W. P. Obesity. Lancet 2005, 366 (9492), 1197−209. (2) Shepherd, P. R.; Gnudi, L.; Tozzo, E.; Yang, H.; Leach, F.; Kahn, B. B. Adipose cell hyperplasia and enhanced glucose disposal in transgenic mice overexpressing GLUT4 selectively in adipose tissue. J. Biol. Chem. 1993, 268 (30), 22243−6. (3) Tang, Q. Q.; Otto, T. C.; Lane, M. D. Mitotic clonal expansion: a synchronous process required for adipogenesis. Proc. Natl. Acad. Sci. U. S. A. 2003, 100 (1), 44−9. (4) Reichert, M.; Eick, D. Analysis of cell cycle arrest in adipocyte differentiation. Oncogene 1999, 18 (2), 459−66. (5) Yeh, W. C.; Bierer, B. E.; McKnight, S. L. Rapamycin inhibits clonal expansion and adipogenic differentiation of 3T3-L1 cells. Proc. Natl. Acad. Sci. U. S. A. 1995, 92 (24), 11086−90. (6) Tang, Q. Q.; Lane, M. D. Activation and centromeric localization of CCAAT/enhancer-binding proteins during the mitotic clonal expansion of adipocyte differentiation. Genes Dev. 1999, 13 (17), 2231−41. (7) Birsoy, K.; Chen, Z.; Friedman, J. Transcriptional regulation of adipogenesis by KLF4. Cell Metab. 2008, 7 (4), 339−47. (8) Cornelius, P.; MacDougald, O. A.; Lane, M. D. Regulation of adipocyte development. Annu. Rev. Nutr. 1994, 14, 99−129. (9) Fumoto, T.; Yamaguchi, T.; Hirose, F.; Osumi, T. Orphan nuclear receptor Nur77 accelerates the initial phase of adipocyte differentiation in 3T3-L1 cells by promoting mitotic clonal expansion. J. Biochem. 2007, 141 (2), 181−92. (10) Zhang, Y. Y.; Li, X.; Qian, S. W.; Guo, L.; Huang, H. Y.; He, Q.; Liu, Y.; Ma, C. G.; Tang, Q. Q. Transcriptional activation of histone H4 by C/EBPbeta during the mitotic clonal expansion of 3T3-L1 adipocyte differentiation. Mol. Biol. Cell 2011, 22 (13), 2165−74. (11) Guo, L.; Li, X.; Huang, J. X.; Huang, H. Y.; Zhang, Y. Y.; Qian, S. W.; Zhu, H.; Zhang, Y. D.; Liu, Y.; Liu, Y.; Wang, K. K.; Tang, Q. Q. Histone demethylase Kdm4b functions as a co-factor of C/EBPbeta to
Using iTRAQ-2DLC-MS/MS technology, we successfully acquired a comprehensive and detailed dynamic proteome expression involved in the initial 28 h during 3T3-L1 adipocytes differentiation. Altogether, 3152 nonredundant proteins were confidently quantified, and 595 of them were consistent with four dynamic expression modes, designed by setting protein amount at 20 h (S phase) as maximum or minimum. Those proteins were likely to be involved in MCE during adipogenesis. Among them, two patterned proteins, PKM2 and RRP1B, were identified in all three high-throughput data, including (ChIP)-on-chip analysis, gene expression microarrays, and iTRAQ-2DLC-MS/MS. Functional analysis suggested that positive correlations may exist in C/EBPβ, PIN1, and PKM2, which may be correlated with the PI3K-AKT-mTOR pathway. Knockdown of PKM2 expression by RNA interference (RNAi) repressed MCE and terminal differentiation of 3T3-L1 preadipocytes, suggesting PKM2 is required for MCE during 3T3-L1 preadipocytes differentiation. Furthermore, knockdown of C/EBPβ can down-regulated PKM2 expression and inhibited 3T3-L1 preadipocytes adipogenesis. And overexpressed PKM2 can partially restore MCE, although it did not restore terminal adipocyte differentiation, which was inhibited by siC/EBPβ. All these molecular-biological experiments indicated that the expression of PKM2 is regulated by C/ EBPβ and is involved in MCE during adipocyte differentiation. In sum, the patterned proteins identified here provide a promising basis for revealing molecular mechanisms that regulate preadipocyte differentiation. 1313
dx.doi.org/10.1021/pr401292p | J. Proteome Res. 2014, 13, 1307−1314
Journal of Proteome Research
Article
promote mitotic clonal expansion during differentiation of 3T3-L1 preadipocytes. Cell Death Differ. 2012, 19 (12), 1917−27. (12) Soukas, A.; Socci, N. D.; Saatkamp, B. D.; Novelli, S.; Friedman, J. M. Distinct transcriptional profiles of adipogenesis in vivo and in vitro. J. Biol. Chem. 2001, 276 (36), 34167−74. (13) Fu, M.; Sun, T.; Bookout, A. L.; Downes, M.; Yu, R. T.; Evans, R. M.; Mangelsdorf, D. J. A Nuclear Receptor Atlas: 3T3-L1 adipogenesis. Mol. Endocrinol. 2005, 19 (10), 2437−50. (14) Kratchmarova, I.; Kalume, D. E.; Blagoev, B.; Scherer, P. E.; Podtelejnikov, A. V.; Molina, H.; Bickel, P. E.; Andersen, J. S.; Fernandez, M. M.; Bunkenborg, J.; Roepstorff, P.; Kristiansen, K.; Lodish, H. F.; Mann, M.; Pandey, A. A proteomic approach for identification of secreted proteins during the differentiation of 3T3-L1 preadipocytes to adipocytes. Mol. Cell. Proteomics 2002, 1 (3), 213−22. (15) Adachi, J.; Kumar, C.; Zhang, Y.; Mann, M. In-depth analysis of the adipocyte proteome by mass spectrometry and bioinformatics. Mol. Cell. Proteomics 2007, 6 (7), 1257−73. (16) Welsh, G. I.; Griffiths, M. R.; Webster, K. J.; Page, M. J.; Tavare, J. M. Proteome analysis of adipogenesis. Proteomics 2004, 4 (4), 1042−51. (17) Atiar Rahman, M.; Kumar, S. G.; Lee, S. H.; Hwang, H. S.; Kim, H. A.; Yun, J. W. Proteome analysis for 3T3-L1 adipocyte differentiation. J. Microbiol. Biotechnol. 2008, 18 (12), 1895−902. (18) Molina, H.; Yang, Y.; Ruch, T.; Kim, J.-W.; Mortensen, P.; Otto, T.; Nalli, A.; Tang, Q.-Q.; Lane, M. D.; Chaerkady, R. Temporal profiling of the adipocyte proteome during differentiation using a fiveplex SILAC based strategy. J. Proteome Res. 2008, 8 (1), 48−58. (19) Zhong, J.; Krawczyk, S. A.; Chaerkady, R.; Huang, H.; Goel, R.; Bader, J. S.; Wong, G. W.; Corkey, B. E.; Pandey, A. Temporal profiling of the secretome during adipogenesis in humans. J. Proteome Res. 2010, 9 (10), 5228−38. (20) Newton, B. W.; Cologna, S. M.; Moya, C.; Russell, D. H.; Russell, W. K.; Jayaraman, A. Proteomic analysis of 3T3-L1 adipocyte mitochondria during differentiation and enlargement. J. Proteome Res. 2011, 10 (10), 4692−702. (21) Choi, S.; Cho, K.; Kim, J.; Yea, K.; Park, G.; Lee, J.; Ryu, S. H.; Kim, J.; Kim, Y. H. Comparative proteome analysis using aminereactive isobaric tagging reagents coupled with 2D LC/MS/MS in 3T3-L1 adipocytes following hypoxia or normoxia. Biochem. Biophys. Res. Commun. 2009, 383 (1), 135−140. (22) Ye, F.; Zhang, H.; Yang, Y. X.; Hu, H. D.; Sze, S. K.; Meng, W.; Qian, J.; Ren, H.; Yang, B. L.; Luo, M. Y.; Wu, X.; Zhu, W.; Cai, W. J.; Tong, J. B. Comparative proteome analysis of 3T3-L1 adipocyte differentiation using iTRAQ-coupled 2D LC-MS/MS. J. Cell. Biochem. 2011, 112 (10), 3002−14. (23) Patel, Y. M.; Lane, M. D. Mitotic clonal expansion during preadipocyte differentiation: calpain-mediated turnover of p27. J. Biol. Chem. 2000, 275 (23), 17653−60. (24) Wu, Y.; Zhou, S.; Smas, C. M. Downregulated expression of the secreted glycoprotein follistatin-like 1 (Fstl1) is a robust hallmark of preadipocyte to adipocyte conversion. Mech. Dev. 2010, 127 (3), 183− 202. (25) Tremblay, F.; Gagnon, A.; Veilleux, A.; Sorisky, A.; Marette, A. Activation of the mammalian target of rapamycin pathway acutely inhibits insulin signaling to Akt and glucose transport in 3T3-L1 and human adipocytes. Endocrinology 2005, 146 (3), 1328−37. (26) Bao, L.; Kimzey, A.; Sauter, G.; Sowadski, J. M.; Lu, K. P.; Wang, D. G. Prevalent overexpression of prolyl isomerase Pin1 in human cancers. Am. J. Pathol. 2004, 164 (5), 1727−37. (27) Rizzolio, F.; Caligiuri, I.; Lucchetti, C.; Fratamico, R.; Tomei, V.; Gallo, G.; Agelan, A.; Ferrari, G.; Toffoli, G.; Klein-Szanto, A. J.; Giordano, A. Dissecting Pin1 and phospho-pRb regulation. J. Cell. Physiol. 2013, 228 (1), 73−7. (28) Vanella, L.; Li, M.; Kim, D.; Malfa, G.; Bellner, L.; Kawakami, T.; Abraham, N. G. ApoA1: mimetic peptide reverses adipocyte dysfunction in vivo and in vitro via an increase in heme oxygenase (HO-1) and Wnt10b. Cell Cycle 2012, 11 (4), 706−14.
(29) Tang, Q. Q.; Otto, T. C.; Lane, M. D. CCAAT/enhancerbinding protein beta is required for mitotic clonal expansion during adipogenesis. Proc. Natl. Acad. Sci. U. S. A. 2003, 100 (3), 850−5. (30) Phelps, D. E.; Xiong, Y. Regulation of cyclin-dependent kinase 4 during adipogenesis involves switching of cyclin D subunits and concurrent binding of p18INK4c and p27Kip1. Cell Growth Differ. 1998, 9 (8), 595−610. (31) Luo, W.; Semenza, G. L. Emerging roles of PKM2 in cell metabolism and cancer progression. Trends Endocrinol. Metab. 2012, 23 (11), 560−6. (32) Christofk, H. R.; Vander Heiden, M. G.; Harris, M. H.; Ramanathan, A.; Gerszten, R. E.; Wei, R.; Fleming, M. D.; Schreiber, S. L.; Cantley, L. C. The M2 splice isoform of pyruvate kinase is important for cancer metabolism and tumour growth. Nature 2008, 452 (7184), 230−233. (33) Yang, W.; Xia, Y.; Ji, H.; Zheng, Y.; Liang, J.; Huang, W.; Gao, X.; Aldape, K.; Lu, Z. Nuclear PKM2 regulates [bgr]-catenin transactivation upon EGFR activation. Nature 2011, 480 (7375), 118−122. (34) Yang, W.; Xia, Y.; Hawke, D.; Li, X.; Liang, J.; Xing, D.; Aldape, K.; Hunter, T.; Alfred Yung, W.; Lu, Z. PKM2 phosphorylates histone H3 and promotes gene transcription and tumorigenesis. Cell 2012, 150 (4), 685−696. (35) Yeh, W. C.; Cao, Z.; Classon, M.; McKnight, S. L. Cascade regulation of terminal adipocyte differentiation by three members of the C/EBP family of leucine zipper proteins. Genes Dev. 1995, 9 (2), 168−81. (36) Christy, R. J.; Kaestner, K. H.; Geiman, D. E.; Lane, M. D. CCAAT/enhancer binding protein gene promoter: binding of nuclear factors during differentiation of 3T3-L1 preadipocytes. Proc. Natl. Acad. Sci. U. S. A. 1991, 88 (6), 2593−7. (37) Tang, Q.-Q.; Jiang, M.-S.; Lane, M. D. Repressive effect of Sp1 on the C/EBPα gene promoter: role in adipocyte differentiation. Mol. Cell. Biol. 1999, 19 (7), 4855−4865. (38) Clarke, S. L.; Robinson, C. E.; Gimble, J. M. CAAT/enhancer binding proteins directly modulate transcription from the peroxisome proliferator-activated receptor gamma 2 promoter. Biochem. Biophys. Res. Commun. 1997, 240 (1), 99−103.
1314
dx.doi.org/10.1021/pr401292p | J. Proteome Res. 2014, 13, 1307−1314
