GENOMICS

(1991)

11,828-834

Mouse Proacrosin Gene: Nucleotide and Chromosomal HANNELORE *Institut

KREMLING,* SABINE KEIME,* KLAUS WILHELM,* IBRAHIM HORST HAMEISTER,t AND WOLFGANG ENGEL*

April

16, 1991;

INTRODUCI’ION

Acrosin (EC 3.4.21.10) is a serine proteinase with a specificity similar to that of trypsin (Schleuning and Fritz, 1974; Polakoski and McRorie, 1973). The protein is located in the acrosome of the sperm in a zymogen form, proacrosin. The enzyme has been predicted

Sequencedata EMBL/GenBank

All

rights

$3.00 1991 by of reproduction

0

from Data

this article have been deposited with the Libraries under Accession No. M63847.

828 Academic in any

Press, Inc. form

reserved.

revised

July 26, 1991

to be involved in the recognition and binding of the sperm to the zona pellucida of the ovum (Saling, 1981; Jones et aZ., 1988; Tiipfer-Petersen and Hentschen, 1988) and in enabling the sperm penetration through the zona pellucida (McRorie and Williams, 1974; Yanagimachi, 1981). Recently, the cDNA clones for human (Baba et al., 1989a; Adham et al., 1990), boar (Adham et al., 1989a; Baba et aZ., 1989b), and mouse (Klemm et al., 1990, Kashiwabara et al., 199Oa) proacrosin have been isolated. A prediction of the primary structure of acrosin was deduced from the corresponding nucleotide sequences and indicated that acrosin is a member of the ancestral serine proteases (Klemm et aZ., 1991) endowed with a signal peptide, the catalytic domain containing the catalytic triad (histidine, aspartic acid, serine) and a tail domain that is unique among the members of the serine protease superfamily. The high proline content and the similarity of the tail domain to DNA-associated and/ or DNA-binding proteins indicate that the peptide might be involved in gene regulation processes during mammalian fertilization (Klemm et aZ., 1991). The human proacrosin gene has been isolated and was found to contain four introns ranging from 0.2 to 4.5 kb in length (Keime et aZ., 1990). The greater part of the 5’-flanking sequence was missing in the clone. The coding sequences are distributed across five exons. Three different exons were found to code for the active-site residues His, Asp, and Ser. One exon codes for the serine active-site residue and the proacrosin-specific proline-rich domain as well. Furthermore, the proacrosin gene was assigned to human chromosome 22, region ql3-qter (Adham et al., 1989b), and to the rat chromosome 7 (Adham et al., 1991). Combined data from Northern blotting experiments and in situ hybridization studies on testis sections indicate that the proacrosin gene activity in boar and bull is detectable as early as in the postmeio-

Acrosin is a serine proteinase located in the acrosome of the sperm in a zymogen form, proacrosin. As deduced from the cDNA sequences of human, boar, and mouse proacrosin, the enzyme is synthesized as a preproenzyme, preproacrosin, which contains a hydrophobic leader sequence of 15 to 18 amino acid residues. We have isolated the gene coding for mouse proacrosin from a mouse cosmid library, using cDNA clones as probes. The gene comprises six exons, and one of the five introns is located in the 5’-untranslated region. The transcription initiation site of the preproacrosin mRNA could be assigned to the residue T, 581 nucleotides upstream of the translation initiation codon ATG, with primer extension analysis. TATA and CAAT boxes could be identified at positions -26 and -97, respectively. Similar to other serine proteases, the coding sequence encompasses five exons and the three active-site residues His, Asp, and Ser are encoded by three different exons (E2, E3, E5). The proline-rich domain, which is a characteristic feature of the proacrosin polypeptide, is encoded in exon 5 with the serine active-site residue. The gene is located on chromosome 15 of the mouse genome, bands E/F, and is a member of a syntenic group that was mapped on human chromosome 22, ql3-qter. During spermatogenesis the proacrosin gene in the mouse is expressed diploid, in contrast to a haploid expression observed in bull, boar, and rat. o issi Academic POW, I~C.

Copyright

M. ADHAM,*

fur Humangenetik der Universit.%, Gosslerstrasse 120, W-3400 GCittingen, Federal Republic of Germany; and tAbteilung Klinische Genetik, Universitat Ulm, Oberer fselsberg, M25, W-7900 Urn, Federal Republic of Germany Received

osss-7543/91

Sequence, Diploid Expression, Localization

MOUSE 5’

(on

Ia

&

Eo El

&CC

E2

/ro

Id M E4

E3

c--

-c-

d

.-.---

PROACROSIN

E5

d-c c-c --

--

-c_

-A-

, 1Kb

,

FIG. 1. Diagram of mouse proacrosin gene illustrating the fragments that have undergone nucleotide sequence analysis. Restriction sites used for subcloning into pUC 18 and subsequent sequencing are marked as (K) KpnI, (S) StyI, (A) Ad, (E) EcoRI, (St) StuI, (AC) AccI, (B) BarnHI, (Hi) HincII, and (Bx) B&XI. Overlaps were established by reference to the sequence of cDNA (Ref. (19)). The gene consists of six exons (EO, El-E5) and five introns (IO, Ia-Id). EO and IO are located in the 5’-untranslated region. 340 nucleotides of El belong to this untranslated part of the proacrosin gene as well. Shading indicates translated portions of exons.

tic stages of spermatogenesis (Adham et al., 1989a). Controversial results on proacrosin gene expression have been published in the mouse, namely haploid expression by Klemm et al. (1990) and Kashiwabara et al. (1990a) and diploid expression by Kashiwabara et al. (199Ob). Here we report the nucleotide sequence of the six exons of the mouse proacrosin gene, its chromosomal localization on chromosome 15, bands E/F, and the expression of the gene in pachytene spermatocytes, which are diploid spermatogenic cells. MATERIALS

AND

METHODS

Isolation and Sequencing of Genomic Clones A mouse cosmid library cloned in pWE 15 (Stratagene, La Jolla, CA) was used for the isolation of genomic clones for mouse proacrosin. Cosmid clones, 1 X lo’, were screened by replicating clones onto nitrocellulose filters (Hanahan and Meselson, 1980) and hybridized with the 32P-multiprimed mouse proacrosin cDNA (Klemm et al., 1990). Hybridization and the washing procedure were the same as described earlier (Keime et al., 1990). Suitable restriction fragments (Fig. 1) were subcloned into plasmid pUC18 and sequenced on both strands by chain-termination reactions @anger et al., 1977). Nucleotide sequence analysis and comparison with the cDNA were carried out with the help of DNA Star computer program ALIGN. Primer Extension and Polymerase Chain Reaction Both methods were applied to evaluate the structure of the 5’-untranslated region of the mouse pro-

GENE

829

acrosin gene and the identification of the transcription start point. For primer extension a synthetic 21base oligonucleotide complementary to nucleotides 45 to 65 of the mouse proacrosin gene (Fig. 2) was used as a primer. The 5’-labeled oligonucleotide (Maniatis et al., 1982) was annealed to 10 pg of poly(A)-rich RNA of mouse testis. The extension reaction was performed according to Domenjoud et al. (1990). For polymerase chain reaction (PCR), 200 ng of a primer mpl, which is complementary to nucleotides 584 to 604 of the mouse proacrosin gene, were annealed to 5 pg of mouse testis poly(A)-rich RNA. cDNA synthesis was performed using 200 U of reverse transcriptase (Superscript, BRL) and 40 U of RNasin (Boehringer) according to the manufacturer’s recommendation in a final volume of 20 ~1. After alkaline hydrolysis, amplification was performed as described by Kogan et al. (1987). The first round of PCR was carried out with 5 ~1 cDNA, 50 pmol each of primers mpl and mp2 (positions 23 to 43), and 3 U of Taq DNA polymerase (Amersham) in a final volume of 50 11. Cycling conditions were 50 s at 93”C, 50 s at 55”C, and 2 min at 63°C. The second round was performed with 5 ~1 of the PCR product and 50 pmol of primers mp2 and mp3 (positions 542 to 562). Cycling conditions were 50 s at 93°C 50 s at 6O”C, and 2 min at 63°C. For nucleotide sequence analysis the PCRproduct was treated with T, DNA polymerase (Biolabs) and cloned into pUC 18. Separation of Spermatogenic Cells and Northern Blot Analysis Cell suspensions of decapsulated testes of adult NMRI mice were prepared according to the method of Wolgemuth et al. (1985) and fractionated by a CELSEP unit gravity sedimentation system (DuPont, Inc., Wilmington, DE), using a 2-4% BSA (w/v) gradient. Sixteen fractions were collected and analyzed by phase-contrast microscopy. The purities of pachytene spermatocytes (fractions 3-5) and round spermatids (fractions 11-12) exceeded 90% in all experiments. RNA was extracted from the different cell fractions by a single-step method (Chomczynski and Sacchi, 1987). Five micrograms of RNA from each fraction was electrophoresed on 1.2% agarose gels containing 2.2 M formaldehyde, transferred to nitrocellulose filters, and hybridized with 32P-labeled mouse proacrosin cDNA (Klemm et al., 1990). Duplicate RNA samples run on other gels were stained with toluidine blue to demonstrate intact ribosomal RNA. To examine the contamination of the pachytene spermatocytes with spermatids, the filter was subsequently rehybridized with rat protamine 1 cDNA (Klemm et al., 1989).

830

KREMLING

ET

AL.

-200 -pl ctcgtacactcagatggaagaaatgagaccacggq~c~tqdtqtqgaa~daaaaaadcagttattctcacatatggagaaaggaagtctgctttctgatgcttaggtaagatatccaaga -150 -200 ccttattggccagccatgggagatgtgacctccgaadqltdtdtaataaaqtatgacattcagttaacagtacccagaaaaatcaagatcatcccataaaactcaacataatgtctggat -250 -200 gggtaggagcatcgccatcttgtgaccccccccccctctcccccgaggaaatgtaacctttccatactatagcaggctggtggggagtttac~gtcagagatgagaccttctgacattgt -go -LOO tatagggaaggagaaacatagtatgggatacacttctgtcatactatcttctga~cagatatattaaaaaaaaaagacacttgatatgcagatagccctgatgagaattcccactgc -L I 50 tcaaE%atgttcatatgtggctgttct TATGTCCAAAAGAGGAGCCCCGW\GAACTTCAAGAAGCACACW\TACTCAGCAGTGGGCAAGAAC LOtI L50 aagcaacttcaaaatggctctttgaaagtgttctggtgacdtatacttctccccccccccccaaccctcatcatatactaaggacctatcagccaacagaacctgatttcttttagctgt

-$O

-20 gtaggctttgaagtcataagtc 200

gaacatcccgtatgcactaactacctcattacag

GAGCACC~~~CTGClCTTCAGTCCGTGAGCCTGTGGTGGTGTCATCCCCC*~GC~~~TCCC~GTATTCAT~GG~~CT 350 400 TCAGAAGGCTGCCCAAGW\T~TGGAGGTCTTCCGACAGAGGAGATGGGTTGGTTGCACATW\GTACCTCA~CACCCTGAGGTCAG~~TCTACTCGG~GTTAG~TGGCACTTC

AG~~~AGATCAGTTAATCGAGCAGGCCTGCCTGGCCTAACTGCTGGGGTGGGG~~~GGAGGTCACCCTGCTW\TTGGCCAGAAGGCTGTGGAGCTTTGTGAGG~~~CAGCTTGCAGGCCA 650 600 GGTTAGGGCAGGAGT ATG GTA GAG ATG CTG CCsi ACT GTC GCT GTG CTG GTC TTG GCA GTG TCC GTG GTT CCC AAG CAT AAC AFC ACG TGT GA +++ Val Clu Met Leu Pm Thr Val Ala Val Leu Val Leu Ala Val Ser Val Val Ala Lys Asp Asn Thr Thr Cys Asp

ca..750bp..ctcctaccctaaagctccccgccccatctttcccaacgagcagtttcctggtctctcctcag

T GGT CCC TGT GGG TTA CGA TTC AGG CAG AAC TCA Gly Pm Cys Gly Leu Arg Phe Arg Gin Asn Ser

CM GCA GGT ACC CGG ATT GTC AGT GGG CAG AGT GCG CAG CTT GGG CCC TGG CCC TGG ATG GTC AGC TTA CAG ATC TTC ACG KC Gln Ala Gly Thr Arg Ile Val Ser Gly Gln Ser Ala Gln Leu Gly Ala Trp Pm Trp Ret Val Ser Leu Gin Ile Phe Thr Ser

CAT AAC His Asn

AGC CGC AGG TAC CAC GCC TGT GGA GGC ALC CIC CTG AAC TCC CAC TGG GTG CTC ACA GCT CCC CAT TGC TTC GAT MC AAA AA gtaagtgct Ser Aq Arg Tyr His Ala Cys Gly Gly Ser Leu Leu Asn Ser His Trp Val Leu Thr Ala Ala rlHis Cys Phe Asp Asn Lys Lys

-

ggg..170bp..cctttgtctcctcag

MA GAG CCC CM Lys 61~ Pm Cln

A AAA GTC TAT GAC TGG AGA CTG GTT TTC CGA GCA CAA GAA ATC GAA TAT GGA AGA AAC AAG CCA GTG Lys Val Tyr Asp Trp Aq Leu Val Phe Gly Ala Gln Glu Ile Glu Tyr Gly Aq Asn Lys Pm Val

GAG GAG AGA TAT GTG CAG AAG ATT GTC ATC CAT GAG AAA TAC AAC GTA GTG ACG GAG GGA MT G4C ATT CCC CTC TTG 61~ 61~ Arg Tyr Val Gin Lys Ile Val Ile His 61~ Lys Tyr Asn Val Val Thr Glu Gly Asn [1Asp Ile Ala Leu Leu

AAA GTC ACT CCT CCT GTT ACA TGT GGG AAC TTC ATT GGA CCC TGC TGT CTA CCT CAT TTT AAG GCG GGT CCT CCC CAA ATA CCC CAC ACC Lys Val Thr Pm Pm Val Thr Cys Gly Asn Phe Ile Glu Pm Cys Cys Leu Pm His Phe Lys Ala Gly Pm Pm 61n Ile Pm His Thr TGC TAC GTG ACT GGG TGG GGA TAC ATA AAA GAG AAG G gtgagtatgtgtcggggcctcctctgtgggccctggtgccggttctccttgccttttggcggggtcacgg Cys Tyr Val Thr Sly Trp Sly Tyr Ile Lys 61~ Lys cgtgtcgggctgagctgttcagtt..2600bp..agggaggagaggcagggcttctccggctcctccctgcgaactgacctgacaactgtgtggcctgctgcag

CC CCC AGG CCA Ala Pm At-g Pm

TCA CCT GTC CTG ATG GAA GCA CGT GIG GAC CTC ATT CAC CTC GAC CTG TGT AAC TCA ACC CAG TGG TAC AAT GGG CGT GTC ACA TCA ACT %r Pm Val Leu #t Glu Ala Arg Val Asp Leu Ile Asp Leu Asp Leu Cys Asn Ser Thr Gin Trp Tyr Asn Gly Arg Val Thr Ser Thr AAT GTG TGT GCA GGG TAT CCT GAA GGC AAG ATT GAC ACC TGC CAG gtaacttccttctgtaccccagacccctgggt..7OObp..agttgtgtcttaaggcagc Asn Val Cys Ala 61~ Tyr Pm 61~ Gly Lys Ile Asp Thr Cys Gin aagaaaactatgtggctacagacatttgttctcccataggccccatccatgagtcttctgggaagggagagtggtttaggctgaaagtgacccctctgtccttctggacag

GGG GAC 61Y Asp

AGT GGT GGG CCT CTC ATG TGC AGA GAC AAC GTC GAC AGC CCC Cl1 TGT GGT CGT GGG CAT CAC GAG CTG CCC GGT AGG CTG TGC CGT GCT Cys Aq Asp Asn Val Asp Ser Pm Leu Cys Gly Arg Gly Asp His Glu Leu Gly Gly Aq Leu Cys Arg Ala nSer 61~ Gly Pm Leu kt AAG CGT CCC GGA GTC TAC ACA CCC ACC TGG GAC TAC CTG GAC TGG ATT GCT TCC AAG ATC GGC CCT AAC GCC TTG CAC TTG ATT CAG CCA Lys Arg Pm Gly Val Tyr Thr Ala Thr Trp Asp Tyr Leu Asp Trp Ile Ala Ser Lys Ile Gly Pm Asn Ala Leu His Leu Ile Gin Pm GCC ACC CCT CAT CCG CCG ACT ACC CCC CAT CCG ATG GTC TCT TTT CAC CCT CCT TCT CTT CGC CCT CCT TGG TAT TTC CM CAC CTG CCT Ala Thr Pm His Pm Pm Thr Thr Aq His Pm Met Val Ser Phe His Pm Pm Ser Leu Aq Pm Pm Trp Tyr Phe 6ln His Leu Pm TCT CGA CCG CTT TAC CTG CGA CCA CTA CCI; CC1 GIG CTC CAT CGG CCG TCT TCG ACC CAA ACC TCC TCA TCA CTC ATG CCC CTC CTC TCG SW Arg Pm Leu Tyrleu Arg Pm Lw Arg Pm Leu Leu His Aq Pm Ser Ser Thr GlnThr set Ser Ser Leullst PmLeu Leu Ser CCC CCA ACC CCA GCC CAG CC1 GCA TCC TTl ACC ATT GCT ACA CM CAC ATG AGG CAC CGC ACA ACG CTG TCT TTT GCT CGG CGT CTC CAG Pm Pm Thr Pm Ala Gln Pm Ala Ser Phc Thr Ile Ala Thr Gin His ICt Arg His Arg Thr Thr Leu Ser Phe Ala Arg Aq Leu 6ln CCC CTC ATA GAG CCC CTG AAG ATG AGA ACT TAC CCT ATG AAA CAT CCT CCC AGT ACA GTG GAC AAG GM CTA CCA CTA CCC CTT CTC CAC Aq Leu Ile Glu Ala Leu Lys kt Aq Thr Tyr Pm Met Lys His Pm Pm Ser Thr Val Asp Lys Glu Leu Pm Leu Pm Leu La, His a..... GTT TGA GCCCCTTTCCAACAAACCCAGCGAGCCCIII:CICCAITCTAT VaI ++* acttctgttttcttcaactcaacccaaatcttcctccaatcaaatttacatcctccctgctcagctccaataaaatggaattgctcaatatatattttttttaaatgttgaaatttaatg cttgaataagcaaacttggccataggccaaccatggtccttacttcatactttattgatactgcaaggtgttaaatgcctctgtatatgtagctagcgggtggagtgagagagctcattc taccaactaaactgatcagaaaaggagggggggtggatcc

atatgtacactcgaggacatga

MOUSE

PROACROSIN

GENE

831

b FIG. 3. (a) Northern blot with mouse testes RNA from 16 cell fractions, isolated by a CELSEP unit gravity sedimentation system, using a 2-4% BSA gradient. Pachytene spermatocytes are enriched in fraction 3-5, round spermatide in fractions 11-12, and elongated spermatids in fractions 14-16. Hybridization was carried out with the “P-labeled proacrosin cDNA. (b) The purity of fractions 3-5 (pachytene spermatocytes) was proved by reprobing the Northern blot with rat protamine 1 cDNA. This gene is haploid expressed; hybridization signals could only be obtained in the fractions containing spermatids.

Chromosomal

Localization

By in Situ Hybridization

For in situ hybridization, embryo fibroblasts were grown from a strain of mice carrying the marker chromosome Rb(4.15)4Rma in a homozygous form as the only metacentric chromosome. In this karyotype, chromosome 15 is easily recognized as the short arm of this single pair of metacentric chromosomes. The chromosomes were prepared according to standard techniques. In situ hybridization was performed as outlined previously (Adolph et al., 1987, 1988) using 5-10 ng of nick-translated Q3H]dTTP and t3H]dCTP) mouse proacrosin cDNA as a probe (specific activity 2-5 X 10’ cpm/pg DNA). Fifty metaphases were evaluated. RESULTS

AND

Isolation and Characterization Proacrosin Gene

FIG. 4. Chromosomal localization of the mouse proacrosin gene. For in situ hybridization embryo fibroblasts were grown from a strain of mice that carries, as the only metacentric chromosome, the marker chromosome Rb (4.15) 4Rma in a homozygous form. The chromosomes were prepared according to standard techniques. Hybridization was performed with a nick-translated mouse proacrosin cDNA as a probe. Staining was done in 8% Giemsa solution for 2-5 min. (a) Eight examples of the G-banded marker chromosome Rb(4.15)4Rma are shown with the specific hybridization signal for mouse proacrosin. (b) Idiogram of the marker chromosome Rb(4.15)4Rma illustrating the distribution of sites labeled by the proacrosin probe (one point = two grains). 73% of the grains detected on chromosome 15 are localized on bands 15E/F with a predominance of the signal in Fl.

DISCUSSION of the Mouse

Five identical clones were identified after screening of 10’ cosmid clones with a mouse proacrosin cDNA

probe. One of these clones was digested with BamHI and KpnI, respectively, and hybridized with a 32Pmultiprimed mouse cDNA clone and with a 200-bp cDNA subclone containing the 5’-region, respectively

FIG. 2. Nucleotide sequence of the six exons of the mouse proacrosin gene including intron-exon boundaries, 5’- and 3’-flanking sequences. The presumed transcription start site is designated by a double cross. The TATA and CAAT boxes are underlined double. Primers used for PCR are single underlined, and primers used for primer extension are double underlined. The translation start codon ATG and the termination codon TGA are each marked by crosses. The derived amino acid sequence is shown below the nucleotide sequence, with the leader peptide underlined. The catalytic triad, His, Asp, and SW, is indicated by boxes. The five introns (lowercase letters) were identified by comparison with the cDNA sequence. The polyadenylation signal is marked by asterisks.

832

KREMLING

(Klemm et al., 1990). Three positive BamHI restriction fragments with a total length of about 6 kb were obtained. In accordance with the length of the human proacrosin gene (Keime et aZ., 1990) these clones were predicted to contain the complete coding region. A 2-kb KpnI fragment was identified by hybridization with the 200-bp cDNA clone. This fragment should contain a part of exon II, intron a, exon I, and 1 kb of the 5’-untranslated region of the mouse proacrosin gene. For further characterization and sequence analyses the BamHI and KpnI fragments were digested with different restriction enzymes and subcloned into pUC 18 vectors (Fig. 1). After comparison of the nucleotide sequence of these fragments with the cDNA sequence of mouse proacrosin (Klemm et al., 1990; Kashiwabara et al., 1990a), the gene was found to contain five exons (El = 77 bp, E2 = 207 bp, E3 = 284 bp, E4 = 146 bp, E5 = 552 bp) and four introns. However, significant differences between the nucleotide sequences of the genomic clones and the cDNA clones were apparent. The nucleotide sequence of the genomic clone coding for the proacrosin leader peptide is entirely different from that of the cDNA clone (Fig. 2). This is apparently due to incorrect cDNA synthesis. This assumption is supported by the fact that the nucleotide sequence of the genomic clones that code for the leader peptide show a rather high homology with those of human (82%; Adham et al., 1990; Keime et uZ., 1990; Baba et al., 1989a), boar (86%; Adham et al., 1989a; Baba et al., 1989a), and rat (94%; Gerloff, 1990). Errors in cDNA synthesis may account for divergencies of further nucleotides in the cDNA sequence resulting in amino acid changes in the proacrosin primary structure (Fig. 2). The intron-exon structure of the coding region of the mouse proacrosin gene is comparable to those of the human gene (Keime et al., 1990). Both genes contain five exons that are arranged in two clusters, separated by a large intron (4.5 kb in human, 3 kb in mouse). Introns a, b, and d interrupt the coding regions at identical positions in mouse and human, whereas intron c splits the triplet for alanine between GC and C in the human sequence and between G and CC in the mouse sequence. The amino acids at the splicing sites are conserved except at i&on b, where human has the split triplet AAT (asparagine), whereas mouse has the triplet AAA (lysine). Every one of the four introns starts with the dinucleotide GT and is terminated with AG, which is in agreement with the splice donor and acceptor consensus sequences known for most eucaryotic genes (Breathnach and Chambon, 1981). Keime et al. (1990) have recently shown that the intron-exon structure of the human proacrosin gene

ET AL.

is similar to those of other serine proteinases, like trypsin and kallikrein. The same is true for the mouse proacrosin gene. The coding sequence encompasses five exons and the three active-site residues His, Asp, and Ser, which are located in three different exons, namely 2,3, and 5. The proline-rich domain in exon 5 was not observed in other serine proteases. The amino acid similarity of the proline-rich domain between mouse and human is only 44%, in contrast to 75% for the remaining part of the polypeptide. This divergence between the mouse and the human proline-rich domains might indicate an evolutionary species-specific function.

Analysis of the 5’ Untrunslated Proucrosin Gene

Region of Mouse

A 2.0-kb genomic KpnI clone containing the 5’-untranslated region of the mouse proacrosin gene was digested with different restriction enzymes (EcoRI, AuuI, S&I, StyI). Sequence analysis was performed on 1093 bp upstream of ATG. TATA and CAAT boxes were identified at positions -26 and -97, respectively. Primer extension experiments using poly(A)-rich RNA from mouse testes and a 21-mer oligonucleotide (positions 45 to 65) determined the transcription initiation site that could be assigned to the T residue at position 1 (Fig. 2). Due to the large distance between the translation start point ATG and the presumable promotor elements TATA and CAAT, the presence of an intron in the Ei’-untranslated region was considered. Evidence for this assumption was provided by analyzing cDNA derived from mouse testes poly(A)-rich RNA. The cDNA was amplified by PCR and sequenced. When compared to the genomic sequence, the PCR product revealed an intron 176 bp in length, 87 bp downstream of the TATA box. The exon-intron boundaries were flanked by the well-known consensus sequences GT and AG, respectively. It can be concluded from these results that the 5’-untranslated region of the mouse proacrosin gene consists of a 65-bp large untranslated exon (EO) and a 176-bp large intron (IO), which is followed by exon 1 (El), of which 340 bp are also not translated. Similar results were obtained by analysis of the 5’-untranslated region of the rat preproacrosin gene (Kremling et aZ., 1991). Keime et al. (1990) performed sequence analysis to 660 nucleotides of the 5’-untranslated region of the human proacrosin gene and could not identify TATA or CAAT boxes. Therefore it can be assumed not only that an additional intron may be in the human gene as well, but furthermore, that TATA and CAAT boxes as well as a transcription initiation site might be present at similar distances upstream from ATG as was

MOUSE

PROACROSIN

identified in the mouse proacrosin gene. This assumption is supported by the observation that the proacrosin gene of boar contain TATA and CAAT boxes located at a distance to ATG comparable to that in the mouse gene (unpublished result). Expression of the Mouse Proacrosin

Gene

Adham et aZ. (1989a) presented clear evidence that the proacrosin gene in boar and bull is only expressed in testis and not in brain, spleen, liver, or kidney. Analysis of testicular RNA from prepubertal bulls revealed proacrosin transcripts of 1.6 kb in size in 7month-old testis, where the first round spermatids could be evaluated microscopically. The hypothesis of haploid expression of the proacrosin gene was supported by the results of in situ hybridization on mature boar testis sections. Labeling was restricted to the cell layers close to the lumen of the tubuli corresponding to the histological localization of the postmeiotic cells. Northern blot experiments with RNA from mouse testes 15 to 40 days of age (Klemm et al., 1990; Kashiwabara et al., 1990a) and in situ hybridization experiments on mature mouse testis sections (Klemm et al., 1990) supported the assumed haploid expression of the proacrosin gene in mammals. Kashiwabara et al. (199Ob), however, recently performed Northern blot analyses of RNAs prepared from purified populations of mouse spermatogenic cells and obtained hybridization signals as early as in pachytene spermatocytes, indicating a diploid proacrosin gene expression. To evaluate the stage of acrosin expression spermatogenic cells of sexually mature mice were separated into 16 fractions by unit gravity velocity sedimentation across a gradient of BSA. Microscopic examination of the cell fractions revealed pachytene spermatocytes in fractions 35, and round spermatids and elongated spermatids were highly enriched in fractions 11-12 and 14-16, respectively. The other fractions contained a mixture of different spermatogenic cells, due to the preparation procedure. RNA was prepared from every cell fraction and hybridized with a mouse proacrosin cDNA probe (Klemm et al., 1990). As illustrated in Fig. 3a, hybridization signals could be obtained with the RNA isolated from round spermatids (fractions 11-12) as well as with RNA obtained from pachytene spermatocytes (fractions 3-5). This result indicates that the preproacrosin mRNA is first transcribed in the diploid stage of spermatogenesis. mRNA of preproacrosin is present in the haploid round spermatids as well, but it is not possible to discriminate whether this mRNA is always conserved from the diploid stage or is newly synthesized. The drastic decrease of hybridization intensity with RNA

833

GENE

from elongated spermatids (fractions 14-16) can be attributed to the advanced translation of proacrosin mRNA. The rehybridization of the filter with rat protamine 1 cDNA, which is expressed in a spermatid specific manner, revealed no hybridization signal in the fractions containing pachytene spermatocytes (Fig. 3b). Thus, it seems obvious that the proacrosin gene is diploid expressed in the mouse, but it remains unclear whether this expression profile can be accepted for mammals in general. Chromosomal Gene

Localization

of the Mouse Proacrosin

For chromosomal assignment of the mouse proacrosin gene, in situ hybridization on metaphases of mouse embryo fibroblasts with the mouse proacrosin cDNA (Klemm et al., 1990) was performed. In an analysis of 50 metaphases 297 grains were scored. Eightyeight grains (29.6%) were detected on chromosome 15 and only 4 grains were found on chromosome 4. Sixty-four (73%) of the grains detected on chromosome 15 are localized on bands 15E/F with a predominance of the signal in Fl (Fig. 4). These results allow us to map the mouse proacrosin gene to mouse chromosome 15, bands E/F. In the human genome, the proacrosin gene was assigned to chromosome 22, ql3-qter (Adham et al., 1989b). Two other genes have been mapped to this region, namely, those for arylsulfate A (ARSA) and for diaphorase (NADH) (cytochrome b, reductase) (DIAl), which have been found syntenic on mouse chromosome 15. It can be suggested that the proacrosin gene belongs to this syntenic group as well, which is conserved in bands E/F of mouse chromosome 15 and in the region ql3-qter of human chromosome 22. Our results can contribute to the construction of a detailed linkage map of the respective regions in human and mouse genomes. ACKNOWLEDGMENTS This work was supported by the Deutsche Forschungsgemeinschaft (EN 84/l&4). We thank Miss Stephanie Bunkowski and Miss Christine Klett for skillful technical assistance, and Miss Frauke Rininsland for reading this manuscript.

REFERENCES 1.

2.

ADHAM, I. M., KLEMM, U., MAIER, W. M., HOYER-FENDER, S., TSAOUSIDOU, S., AND ENGEL, W. (1989a). Molecular cloning of preproacrosin and analysis of its expression pattern in spermatogenesis. Eur. J. Biochem. 182: 563-568. ADHAM, I. M., GRZESCHIK, K.-H., GEURTS VAN KESSEL, A. H. M., AND ENGEL, W. (198913). The gene encoding the human preproacrosin (ACR) maps to the q13-qter region on chromosome 22. Hum. Genet. 84: 59-62.

834

KREMLING

3. ADHAM, I. M., KLEMM, U., MAIER, W. M., AND ENGEL, W. (1990). Molecular cloning of human preproacrosin cDNA. Hum. Genet. 84: 125-128. 4. ADHAM, I. M., SZPIFZER, C., KREMLING, H., KEIME, S., SZPIRER, J., LEVAN, G., AND ENGEL, W. (1991). Chromosomal assignment of four rat genes coding for the spermatid specific proteins proacrosin, transition proteins 1 and 2 and protamine 1. Cytogenet. Cell Genet. 6’7, 47-50. 5. ADOLPH, S., BARTRAM, C. R., AND HAMEISTER, H. (1987). Mapping of the oncogenes Myc, Sis, and Int-I to the distal part of mouse chromosome 15. Cytogenet. Cell Genet. 44: 6568. 6. ADOLPH, S., STRAUSS, P. G., AND HAMEISTER, H. (1988). Localization of proviral integration sites (Mlvi-1, Mlvi-2, and Put-l) and the oc-globin pseudogene, Hba-3ps, on murine chromosome 15. Cytogenet. Cell Genet. 47: 189-191. I. BABA, T., WATANABE, K., KASHIWAEZARA, S., AND ARAI, Y. (1989a). Primary structure of human preproacrosin deduced from its cDNA sequence. FEBS Z&t. 244: 296-300. 8. BABA, T., KASHIWABARA, S., WATANABE, K., ITHO, H., AND ARAI, Y. (1989b). Activation and maturation mechanism of boar acrosin zymogen based on the deduced primary structure. J. Biol. Chem. 264: 11920-11927. 9. BREATHNACH, R., AND CHAMBON, P. (1981). Organization and expression of eucaryotic split genes coding for proteins. Annu.

Rev. B&hem.

50: 349-383.

10. CHOMCZYNSKI, P., AND SACCI, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenolchloroform extraction. Anal. Biochem. 162: 156-159. 11. DOMENJOUD, L., NUSSBAUM, G., ADHAM, I. M., GREESKE, G., AND ENGEL, W. (1990). Genomic sequences of human protamines whose genes, PRMl and PRMP, are clustered. Genomics 8: 127-133. 12. GERLOFF, T. (1990). “Isolierung und Charakterisierung eines Priiproakrosin-cDNA-Klons der Ratte,” Inauguraldissertation, Medizinische Fakultat der Georg-August-Universitlit zu Gottingen. 13. HANAHAN, D., AND ~MESELSON,M. (1980). Plasmid screening at high colony density. Gene 10: 63-73. 14. JONES, R., BROWN, C. R., AND LANCASTER, R. T. (1988). Carbohydrate-binding properties of boar sperm proacrosin and assessment of its role in sperm-egg recognition and adhesion during fertilization. Development 102: 781-792. 15. KASHIWABARA, S., BABA, T., TAKADA, M., WATANABE, K., YANO, Y., AND ARAI, Y. (1990a). Primary structure of mouse proacrosin deduced from the cDNA sequence and its gene expression during spermatogenesis. J. Biochem. 108: 785791. 16. KASHIWABARA, S., ARAI, Y., KODAIRA, K., AND BABA, T. (1990b). Acrosin biosynthesis in meiotic and postmeiotic spermatogenic cells. Biochem. Biophys. Res. Commun. 173: 240-245.

ET AL. ‘. 17. KEIME, S., ADHAM, I. M., AND ENGEL, W. (1990). Nucleotide sequence and exon-intron organization of the human proacrosin gene. Eur. J. Biochem. 190: 195-200. 18. KLEMM, U., LEE, C. H., BURFEIND, P., HAKE, S., AND ENGEL, W. (1989). Nucleotide sequence of a cDNA encoding rat protamine and the haploid expression of the gene during spermatogenesis. Biol. Chem. Hoppe Seyler 370: 293-301. 19. KLEMM, U., MAIER, W.-M., TSAOUSIDOU, S., ADHAM, I. M., WILLISON, K., AND ENGEL, W. (1990). Mouse preproacrosin: cDNA sequence, primary structure and postmeiotic expression in spermatogenesis. Differentiation 42: 160-166. 20. KLEMM, U., MOLLER-ESTERL, W., AND ENGEL, W. (1991). Acrosin, the peculiar sperm-specific serine protease. Hum. Genet., in press. 21. KOGAN, S. C., DOHERTY, M., AND GITSCHIER, J. (1987). An improved method for prenatal diagnosis of genetic diseases by analysis of amplified DNA sequences. N. Engl. J. Med. 317: 985-990. 22. KFZEMLING, H., FLAKE, A., ADHAM, I. M., RADTKE, J., AND ENGEL, W. (1991). Exon-intron structure and nucleotide sequence of the rat proacrosin gene. DNA Sequence, in press. 23. MANIATIS, T., FRITSCH, E. F., AND SAME~ROOK,I. (1982). “Molecular Cloning: A Laboratory Manual,” Cold Spring Harbor Laboratories, Cold Spring Harbor, New York. 24. MCRORIE, R. A., AND WILLIAMS, W. L. (1974). Biochemistry of mammalian fertilization. Annu. Rev. Biochem. 43: 777803. 25. POLAKOSKI, K. L., AND MCRORIE, R. A. (1973). Boar acrosin. Classification, inhibition and specificity studies of a proteinase from sperm acrosomes. J. Biol. Chem. 248: 8183-8188. 26. SALING, P. M. (1981). Involvement of trypsin-like activity in binding of mouse spermatozoa to zonae pellucidae. Proc. Natl. Acad. Sci. USA 78: 6231-6235. 27. SANGER, F., NICKLEN, S., AND COULSON, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad.

Sci. USA

74: 5663-5467.

28. SCHLEUNING, W. D., AND FRITZ, H. (1974). Some characteristics of highly purified boar sperm acrosin. Hoppe Seyler’s 2. Physiol. Chem. 355: 125-130. 29. TGPFER-PETERSEN, E., AND HENSCHEN, A. (1988). ikma pellucida binding and fucose-binding of boar sperm acrosin is not correlated with proteolytic activity. Biol. Chem. Hoppe Seyler 369:

69-76.

30. WOLGEMUTH, D. J., GIZANG-GINSBERG, E., ENGELMYER, E., GAVIN, B. J., AND PONZETTO, C. (1985). Separation of mouse testis cell on a Cellsept” apparatus and their usefulness as a source of high molecular weight DNA or RNA. Gamete Res. 12: l-10. 31. YANAGIMACHI, R. (1981). Mechanism of fertilization in mammals. In “Fertilization and Embryonic Development in Vitro” (L. Mastoianne and J. Biggers, Eds.), pp. 32-155, Plenum, New York.