HYBRIDOMA Volume 9, Number 1, 1990 Mary Ann Liebert, Inc., Publishers

Mouse-Human Chimeric Monoclonal to

Antibody Carcinoembryonic Antigen (CEA): In Vitro and In Vivo Activities

HIROFUMI KOGA,1 HIDETOSHI KANDA,' MANABU NAKASHIMA,' YUJI WATANABE,2 KEIGO ENDO,2 and TAKESHI WATANABE' 1 Medical Institute of Bioregulation, Kyushu University, Fukuoka, Japan 2Department of Nuclear Medicine, Kyoto University, Faculty of Medicine, Kyoto, Japan

ABSTRACT

antibody specific for human carcinoembryonic The produced by recombinant DNA techniques. chains were of and of the light regions heavy genes cloned from hybridoma, 2.7.1G.10., which secreted anti human CEA antibody (IgGl,*), and were joined with human yi and < constant genes. The affinity of the resultant chimeric antibody to its relevant antigen was the same as that of the parental mouse monoclonal antibody when analysed by Scatchard plot analysis. The chimeric antibody showed a potent antibody dependent cell-mediated cytotoxicity (ADCC) activity with human peripheral blood mononuclear cells against CEA-positive human adenocarcinoma cells. In vivo imaging analysis revealed that the present chimeric antibody was specifically localized on the tumor site. These results indicate that our mouse-human chimeric antibody is a promising reagent for the diagnosis and therapy of CEA-positive human canMouse-human chimeric

antigen (CEA)

was mouse variable the mouse

cers.

INTRODUCTION Mouse monoclonal antibodies specific for tumor-related antigens are effective reagents for the diagnosis and therapy of human cancers. But there are various problems in clinical applications, particularly, the immunogenecity of mouse monoclonal antibody to the human system. Many human monoclonal antibodies available for clinical use are limited because of difficulties in the establishment and maintenance of human hybridoma cell lines. Mouse-human chimeric antibodies, which are composed of the mouse variable regions and the human constant regions, have been reported 43

of recombinant DNA techniques (1-9). Most of them have to retain the specific binding activities to the antigens which were recognized by their parental mouse antibodies. Considering that a major portion of the immunogenecity of the antibody molecules is directed against the constant region, mousehuman chimeric antibodies appear to be more suitable reagents than mouse monoclonal antibodies in the human system. Carcinoembryonic antigen (CEA) is one of the most characterized human tumor-related antigen. It is a glycoprotein with Mr 200,000 and specifically expressed in the human fetal and malignant

by

means

been

reported

gastrointestinal

tracts

(10-12).

We have been producing mouse monoclonal antibodies specific for CEA by cell fusion for diagnosis and therapy of CEA-positive human canTwelve anti CEA monoclonal antibodies were established and cers. one of them showed specific and obvious localization on the tumor site in scintigraphic imaging by using nude mice bearing CEApositive tumor. The hybridoma which secreted this anti CEA monoclonal antibody was designated as 2.7.1G.10. In this report, we constructed mouse-human chimeric antibody molecules consisting of the mouse variable regions of the hybridoma 2.7.IG.10. and the human yi and k constant regions. The resultant chimeric antibody showed the same specific binding affinity to the relevant antigen, and a potent activity of ADCC as well as CDC, and a specific localization on the tumor site in in vivo imaging. The present anti CEA mouse-human chimeric antibody appears to be a suitable candidate for the diagnosis and therapy of CEA-positive cancers.

MATERIALS AND METHODS

Cell Lines and Culture Medium. A

mouse

antibody

hybridoma, designated as 2.7.1G.10., secreted a monoclonal (IgGj, < ) specific for human carcinoembryonic antigen

(CEA). Both a human adenocarcinoma cell line, MKN-45, and a human colorectal cancer cell line, LS180, expressed CEA on the cell surface. A non-secreting mouse myeloma cell line, X63.653.Ag8., was used for transfection of the chimeric genes. All cell lines were cultured in RPMI-1640 medium containing 10% fetal bovine serum supplemented with 5xlO"^M 2-mercaptoethanol, 2mM L-glutamine, 25ug/ml gentamicin. In case of ADCC and CDC assays (see below), RPMI-1640 medium contained 15% fetal bovine serum. Genomic Cloning

High molecular BamHI

DNA

was

prepared

digested with 10-40% sucrose denwhich contained the

from 2.7.1G.10. and

endonuclease, and size-fractionated

on a

sity gradient. The appropriate DNA fragments, functionally rearranged V^ and VK genes of 2.7.IG.10., were ligated into EMBL-3 phage vector (Stratagene, CAl* The resultant recombinant phage libraries were screened with á¿P-labeled probes, mouse 1.5 Kb Hindlll-EcoRI Ju4 fragment and 0.7kb Aval-PstI JK4_5 fragment (provided by Dr. Honjo, Kyoto Univ., Kyoto, Japan).

44

Nucleotide

Sequencing

Selected DNA fragments from the VH and Vk genes of 2.7.1G.10. were subcloned into the M13mpl9 phage vectors. They were sequenced by the dideoxy chain termination method (13).

Transfection of Chimeric Immunoglobulin Genes into Mouse Cell Line

Myeloma

The chimeric immunoglobulin genes were introduced into the mouse myeloma cell line, X63.653.Ag8., by electroporation. The plasmid p2.7.HBgpt (see Fig.3A) was transfected and stable transformants were selected with 6.5ug/ml of mycophenolic acid (gifted from Dr. Yamamura, Kumamoto Uni v. Kumamoto, japan). Then p2.7.LB-lneo (see Fig.3B) was transfected into the stable transformants containing the chimeric heavy chain gene and the resultant transformants were

selected with lmg/ml of G418 (GIBCO). A clone of the stable transformants containing the chimeric heavy and light chain genes was established and termed as H-L-l 3.11. Purification of

Immunoglobulin Proteins

anti human CEA monoclonal antibody secreted by 2.7.IG.10. purified by the protein A column (Pharmacia, Sweden). The chimeric anti human CEA monoclonal antibody secreted by H-L-l 3.11 was concentrated by ultrafiltration (Amicon Corp., USA) and precipitated with ammonium sulfate and purified by anti human IgGSepharose affinity column. The purity of immunoglobulin proteins was confirmed by electrophoresis on SDS-polyacrylamide gel (data The

mouse

was

not

shown).

Assay

of

Antigen Binding Activity

The 1X105 cells of the human adenocarcinoma cell line, MKN-45, were washed with phosphate buffer saline containing 5% fetal bovine serum and 0.1% NaN3> and then incubated for 30 min at 4° C with either the medium only, the culture supernatant of the mouse hybridoma 2.7.IG.10. or the culture fluid of the chimeric transfecAfter washing three times, cells were stained tant H-L-l 3.11. for 30 min at 4° C with a 1/100 dilution of fluorescein isothiocyanate (FITC)-conjugated antibody specific for either mouse y chain or human y chain (Cappel, PA). The stained cells were analysed by EPICS profile (Coulter).

Binding Inhibition Assay

and Scatchard Plot

Analysis

binding inhibition assay was performed to determine the association constant (Ka) of the chimeric and original mouse antibodies. The quantity of each antibody was adjusted to give 50% binding of 1Z5I-labeled CEA (Eiken Chemical Co., Japan) in the absence of unlabeled CEA. The antibody (lOOul) was mixed with 200ul of 1Z5I-CEA cpm) and 50ul of titrated unlabeled CEA, then incubated at 25°C over night, followed by addition of anti mouse IgG or anti human IgG antibody. After the incubation for 30 min at 25°C, imA

(1.2X104

45

munoprecipitates were recovered and counted in a y-counter. The was determined by Scatchard plot analysis (14).

Ka

Antibody Dependent Cell-Mediated Cytotoxicity (ADCC)

(5X106)

MKN-45 cells used as target cells were labeled with lOOuCi of "Cr-sodium chromate (New England Nuclear Corp. Boston, MA) for Human peripheral blood one hour at 37°C in RPMI-1640 medium. mononuclear cells used as effector cells were obtained from a healthy donor and separated by using lymphocyte reparation medium (Organon Teknika Corp., NC). Target cells 50ul) and effector cells (50ul) at the indicated E/T (effector/target) ratio were added in triplicate to the round-bottomed 96 well microtiter plate (Corning) with lOOul of the purified chimeric or original mouse antibody (lug/ml in the same medium), and incubated for 6 hr at 37°C. After incubation, lOOul of the supernatant from each well were collected and counted in a y-counter. The percentage of cytotoxicity was calculated as described in the formula of the cytotoxic acti vi ty.

(2X104,

Complement Dependent Cytotoxicity (CDC)

51Cr-labeled MKN-45 cells 50ul) were mixed with the indicated concentration of the antibody (50ul) and rabbit complement (lOOul) or human complement (150ul), and then incubated for one hour at 37°C. Rabbit serum was pre-absorbed by 1X107 cells of MKN45 three times before use as complement. Human serum from a healthy donor was used as a source of human complement.

(2X104,

Biodistribution of Radiolabeled Vivo

Imaging

Antibody in Tumor and Blood and In

The purified diimeric or original mouse monoclonal antibody was labeled with 1Z5I or 131I (Amersham International jpJc, Buckinghamshire, UK) by the chloramine-T method (15). 1"I-labeled antibodies were used in an assay of the biodistribution and l0illabeled antibodies were used in case of in vivo imaging. Balb/c nude mice (nu/nu) were transplanted with a human colorectal cancer Two weeks later, when the cell line, LS180, on the left thigh. weight of tumor reached 0.5-lg, the radiolabeled antibody was intravenously injected into nude mice. The antibody dose was adjusted to 20ug per mou5£. by mixing labeled and unlabeled ibodies; luCi/20ug for x"I-labeled antibody and 60uCi/20ug for I-labeled antibody, respectively. The mice were given nonradioactive iodine from 2 days before the injection and throughout the experiment. On days 1, 2 and 4 after the injection, the radioactivity in blood, normal tissue and the tumor were counted and the percentages of the injected dose per gram of wet organ weight were calculated. On the same days, scintigraphic imaging was performed by using a pinhole collimator and a gamma camera (Phogamma LFOV: Searle Diagnostics Inc. Des Plaines, IL) interfaced

Î3Î

to

a

computer (Digital Equipment Corp. Magnord, MA) (15).

46

RESULTS Isolation of

Immunoglobulin

Genes from Mouse

Hybridoma 2.7.IG.10.

identify immunoglobulin genes from a mouse hybridoma 2.7.IG.10., genomic library was constructed from the BamHI endonucleasedigested DNA fragments of the high molecular DNA of 2.7.1G.10. and was screened with plaque hybridization by using 3ZP-labeled mouse and Jk4_5 fragments as probes. The Vu gene of 2.7.1G.10. was JH4 contained in an 8.lkb BamHI fragment and was rearranged to the Juo To a

The Vk gene of 2.7.IG.10. was contained in a 7.8kb exon (Fig.IB). The and was rearranged to the isolated heavy and light chain genes were detected in the mouse hybridoma 2.7.1G.10. by Northern blot analysis (data not shown).

(Fig.lA). fragment transcripts of

exon

BamHI

Jkj

Nucleotide Sequences of The

VH

2.7.1G.10. and VK 2.7.1G.10. genes

A 0.9kb Hindlll fragment from the VH 2.7.1G.10. and a 1.3kb EcoRIAccI fragment from the VK 2.7.1G.10. were recloned and the selected DNA fragments shown by arrows in Fig.l were subcloned into M13mpl9 phage vector, then sequenced by the dideoxy chain termination method. The nucleotide sequences and deduced amino acid sequences are shown in Fig.2. It revealed that the Vu and VK 2.7.1G.10. genes belonged to the subgroup Vu 11(A) and the subgroup VK III respectively (16). The sequences of the Vu and VK 2.7.1G.10. genes were compared with those of the V genes of mouse anti human CEA antibodies which had been reported by S. Cobilly et al. (17) and C.B. Beidler et al. (9). The results showed that the amino acid sequences of the Vu and Vk 2.7.IG.10. genes had lower homology than those of the other two V genes.

A. V« 2.7.1.G.10

I

1 H

Bat P P

1kb

p

H

FIGURE 1. Restriction enzyme map of the Vu and Vk gene from a An mouse hybridoma 2.7.1G.10. 8.lkb BamHI fragment of the VH gene (A) and a 7.8kb BamHI fragment of the Vk gene (B) were cloned and restriction enzymemapped. L; leader segment, V; variable region, D; diversity

segment, J; joining segment.

Exons are shown by open boxes and the nucleotide sequence strategy is shown by arrows. Avo

E

MJ L

BonAvaBon

1

1

VJ'

Ava

U

J'

A

B I Bam HI

Bon i Bon I E : ECO RI H ¡Hind Dl

P i Pit I

47

A.

VH 2.7. IG. 10.

B. Vk 2.7.1G.10.

Leauer

ATGGAAIGGACCTGGCTCTTrCTCTTCCTCCTGTCAGÏAACTGCAGGTAAGCGGCTCAT 60 MetGlyTrpThrTrDValPheteuPheleuLeuSerVaIThrAlaG-

ASA iggacacagacacactcctgct atgggtgc igcigc tc tggg ttccaggtgagggta

CAITTTCAAArCTGAAGAAGAGACAGAGCTTGAGGTGACAATGACAACCACTCTGCCTTT 120

CAGATAAGIGT TA TGAGCAACCTCTGTCGCCAT TAIGATGC rCCATGCCTCTCTGTTCT T

-

h

HetGluThrAspThrleuleuLeuTrpValLmeuLeuTrpvalProG120

GATCACTAT AATTAGGGMTT TGTCAC TGGT TTTAAGTTTCCCCnGT CCCCIGAATT TTC 1W

CrcrCCACAGGTGTCCACTcdcAGGTICAGCTGCAGCAGTCrGGAGCrGAGCrGAIGAAG

CATTTTCTCAGAGTGATGTCCAAAATTATTCTTAAAAAÏTTAAATGAAAAGGTCCTCTGC 240 ISO

-lyWalHi sSerGlnValGInleuGInGInSerGlyAIaGIuLeuMetLys -1— COB-1

CCIGGGGCCICAGIGAAGHIAICAIGCAAGGCIACIGGCIACHCAIICAGI'GACUCIGG 240 ProGlyAlaSerVallyslleSerCyslysAlalhrGlylyrlhrPheSerAsoTyrTro

TGTGAAGGCTTTTAAAGATATATAAAAATAATCTTTGTGTTTATCATTCaGGTTCCACT 300

-lySerîhr FR-1 —¡GGPGACArTGTGCTGACACAGTCTCCTGCTTCCirAGCTGTATCTCTGGGGCAGAGGGCC

360

GlyAsolleValleuIhrGlnSerProAlaSerLeuAlaValSerLeuGlyGlriArgAla

-

ATAMG^GTMAGCAGAGGCCTGGACATGGCCTTGAGTGGAlïWAGAGAiïTTACCÏ 300 ileGluIrpValLysGlnArgProG1yHisGlyleuGluTrr>IleGlyG1ulleLeuPro CDft-2

FR-3

-1-

GUAGTGGGCGÏACTGACTACAATGAGAGGTTCAAGGG0AAGGCCACAT1CACTGGAGAT 360 GlySerGlyArgthrAsplyrAsnGluArgPheLysGlylysAlalhrPheTrirGlyAsp GTTICCTCCAACACAGCCTACATGAAACICAGIAGCCTGACATCTGAGGACTCTGCCGIC 420

ValSerSerAsnThrAlaTyrrletLysleuSerSerLeuTiirSerGluAspSerAlaVal -r—

CDR-3-1-

FR-4

TATTACTGTGCAACOGGAACTACTCCGTTTGGTTA0TGGGGCCAAGGGAC1C1GGTCACT 480 TyrTyrCysAlalhrGlyThrThrProPheGlyTyrTrDGIyGlnGlyThrLeuValThr

-—.-

CDR-1

-,—

ACCATCTUTGOAGGGCCAGCCAUGTGICAGTACArCTAGCTAIACTTATATGCACTGG 420

ThrlleSerCysAroAlaSerGlnSerValSerThrSerSerTyrThrTyrHetHisTrp

--,- CM-2 FR-2 TACCAACAGAAACCAGGACAGCCACCCAAACICCTCATCAAGTAKCATCCAACCIAGAA 4M

TyrGlnGtnLysProGlyGlnProProLysLwLeulleLyslyrAlaScrAsiileuGlu

FR-3 —,TCPGfiGGTCCCTGCCAGGTICAGTGGCAeTGGGTCrCGGACACACirCACCCTCAACAIC 540

SerGlyValProAlaArgPheSerGlySerGlySerGlyThrAspPtieThrleuAsnlle

CDR-3 —, CATCCTGTGGAGGAGGAGGATACrGCAACATArTACTGPCAGCACAGTTGGGAGATTCCr 600 -_-

HisProValGluGluGluAspThrAlaTyrTyrTyrCysGlnHisSerTrpGlullePro

gictctgùJgcigk

»"*

—1 AroThrPheGlyGlyGlyThrLysleufilulleLys

r-

CG6ACGT TCGGIGGAGGCACC AAGC TGGAAA TCAACGT

vaiSerAia

FIGURE 2. Nucleotide sequences and deduced amino acid sequences of the VH gene (A) and the VK gene (B) from 2.7.1G.10. FR; framework

region, CDR; complementary determined region.

Construction of Chimeric Immunoglobulin Expression Plasmids and Introduction into Mouse Myeloma Cell Line

A chimeric heavy chain gene was constructed by ligating a 2.3kb EcoRI-Xbal fragment from the Vu 2.7.IG.10. gene to a 15kb MlulBamHI fragment from the human Cyj gene (8) through site conversions This human Cyi gene had been cloned from a human piasmacytoma line, ARH77, (18) and contained a human heavy chain enhancer element in the upstream of Cyj exon. The resultant chimeric heavy chain gene was inserted into the EcoRI and BamHI sites of pSVpgpt A chimeric light vector (19) as shown in Fig.3A (p2.7.HBgpt). chain gene was constructed as follows, a human heavy chain enhancer element (0.9kb BamHI fragment) was ligated to the upstream of a 4.9kb BamHI-Hindlll fragment from the V< 2.7.1G.10. gene. Then, a .

A. p2.7.HBgpt E(X) LVDJ"

E(M>

O

Human H chain Human Cft

Enhancer

( HfG1 ( ARH77 »

B : Bam HI

Ampf \

20.3 kb

J Eco-gpt

E : Eco Rl

FIGURE 3. Construction of the mouse-human chimeric heavy chain gene, p2.7.HBgpt (A) and light chain gene, p2.7.LB-lneo (B). Exons and human heavy chain enhancer elements are shown by open boxes and open circles,

respectively.

M » Mlu I X

:

XtKll

B. p2.7.LB-1neo

Human H chain Enhancer

l

VJ,

48

human CK gene (2.5kb HindIII-EcoRI fragment), as reported previously (5), was joined to the 31 end of the VK gene. This chimeric light chain gene was inserted into the BamHI and EcoRI sites of pSVoneo vector (20) as shown in Fig.3B (p2.7.LB-lneo). These chimeric immunoglobulin genes were introduced into a mouse myeloma cell line X63.653.Ag8. by electroporation (see Materials

and

Methods).

mants obtained

After selection, a clone of several stable transforwas established and termed as H-L-l 3.11.

Binding of Chimeric Antibody

to CEA-Positive Tumor Cells

To assay the binding activity of the chimeric antibody to the antigen, flow cytometric analysis was performed using a MKN-45 cell line which is a human CEA-positive adenocarcinoma cell line. MKN45 cells were incubated with the culture supernatant of the transformant H-L-l 3.11 or the mouse hybridoma 2.7.IG.10. followed by staining with FITC-conjugated anti human y chain or anti mouse y chain antibody. As shown in Fig.4, the fluorescence intensity of the chimeric antibody was comparable to that of the parental mouse

antibody.

Log Fluorescence Intensity

FIGURE 4. Antigen binding activity of the chimeric antibody to MKN45 cells. Cells were incubated at 4°C with medium only (A,C), the culture supernatant of 2.7.1G.10. (B) or H-L-l 3.11 (D), followed by staining with FITC-conjugated goat anti mouse y chain antibody (A,B) or FITC-conjugated goat anti human y chain antibody (C,D). Stained cells were analysed by EPICS profile (Coulter).

Determination of Association Constant of Chimeric

Antibody

binding inhibition assay was performed with *"I-labeled purified CEA molecules to determine the association constants (Ka) of both antibodies by Scatchard plot analysis. The Ka of the chimeric antibody was 5»6X109 M"1 while that of the original mouse antibody was 5.5X109 M"1 (Fig.5). The results shown in Fig.4 and Fig.5 demonstrated that our mouse-human chimeric antibody obviously retained the same binding activity and affinity to the specific antigen, CEA, of the original mouse antibody, indicating that recomThe

49

0.1

Original

mouse

0.3 ( nM )

0.2

Ka Ka

Ab

Chimeric Ab

=

5.5

x

5.6

x

10* M"' 10' M"'

Binding inhibition assay with chimeric or original mouse antibody to 1¿5I-labeled CEA in the presence of unlabeled CEA (inset) and Scatchard plot analysis. The association constants (Ka) of both antibodies are presented.

FIGURE 5.

bination of constant region genes from mouse to human does not affect any binding activities of the resultant antibody molecule. ADCC

Activity

with Human Effector Cells and CDC

Activity

ADCC and CDC assays were done to investigate the in vitro activity of the chimeric antibody. In ADCC assay MKN-45 cells were used as target cells and human peripheral mononuclear cells were used as effector cells. At the E/T (effector/ target) ratio of 50:1, the chimeric antibody mediated 20.6% lysis of MKN-45 cells, while the original mouse antibody did 8.2% lysis (Fig.6). The chimeric antibody showed the significant cytotoxicity even at the E/T ratio of 5:1. Human peripheral mononuclear cells showed natural killer (NK) activity to MKN-45 cells, which was comparable to the cytotoxicity mediated by the mouse antibody, suggesting that the original mouse antibody did not mediate the ADCC activity with human effector

cells.

'///, chimeric Ab 111 mouse Ab

ÜI effector cell only

20

Effector/

:

50

1

:

1

Target Ratio

FIGURE 6. ADCC assay with human peripheral mononuclear cells against MKN-45 cells. The concentration of each antibody used was lug per ml. The percentage (±SD) of cytotoxicity was determined from the results of a 6 hr-period triplicated blCr release assay. Spontaneous release was 11.3-13% of maximum release. 50

—•

chimeric Ab with complement

---•

chimeric Ab

—*

mouse

—* mouse Ab

25

5

only

Ab with complement

only

50

Antibody ( (ig/ml )

FIGURE 7. CDC assay with the antibody and rabbit complement against MKN-45 cells. The percentage (±SD) of cytotoxicity was determined from the results of an 1 hr-trpl icated ^Cr release assay. Spontaneous release was 12.0-14.3% of maximum release. In CDC assay the antibody and target cells were incubated for one hour with rabbit or human complement. The chimeric antibody with rabbit complement mediated 25.1% lysis and 28.8% lysis of MKN-45 cells at the antibody concentration of 50ug/ml and 25ug/ml respectively, while the original mouse antibody did not (Fig.7). On the other hand, the chimeric antibody with human complement showed a modest CDC activity, but mediated the significant lysis compared with the original mouse antibody (data not shown).

Biodistribution of Radiolabeled

Antibody

and In Vivo

Imaging

preliminary experiments, the 2.7.IG.10. mouse anti human CEA antibody was specifically localized on the colorectal tumor, LS180, xenografted in nude mice. In the present study, in vivo biodistribution study using the chimeric antibody was compared with the results of the parental mouse antibody. The clearance from blood and the uptake of the tumor were indistinguishable between the chimeric and parental mouse antibodies on days 1, 2 and 4 after the injection (Fig.8). The tumor-to-normal In

monoclonal

tissue ratios increased with time and the tumor-to-blood ratio on day 4 after the injection reached 4.4+1.04 for the chimeric antibody, and 3.5±0.7 for the parental antibody, while that of a control antibody was 0.66±0.007. The imaging of nude mice on day 4 after the injection canfirmed the results of the biodistribution study (Fig.9). Both 1,:51I-labeled chimeric and parental mouse antibodies clearly visualized the transplanted tumor. DISCUSSION A number of mouse-human chimeric antibodies which are composed of the mouse variable regions and the human constant regions have been For example, the constructed by recombinant DNA techniques. chimeric antibodies specific for haptens (1-3) and recently, those 51

20

o D TJ

10

Q> O

«

n

12 3 Days after injection

4

FIGURE 8. The radioactivity of the chimeric antibody in blood (•---•) and in tumor (•—•) or the parental mouse antibody in blood (A— ) and in tumor ( A-— ) on days 1, 2 and 4 after the injection of each radiolabeled antibody. Blood clearance and tumor uptake of the chimeric antibody were comparable to those of the

parental

mouse

antibody.

specific for human tumor-related antigens (4-7,9)

have been

reported.

From the point of clinical applications, mouse-human chimeric antibody has more availability than its mouse counterpart. When a mouse monoclonal antibody is applied to human repeatedly, the induction of a human anti mouse immunoglobulin antibody (HAMA) is inevitable (21,22). But the mouse-human chimeric antibody is thought to be less immunogenic to human because of its composition. However, the problem of anti idiotypic antibody still remains (23). Recently, it has been revealed that the chimeric antibody had longer circulation time than its mouse counterpart (24). CEA is one of the most characterized human tumor-related antigen

FIGURE 9. In vivo imaging on day 4 after the injection of each radiolabeled antibody. A; the parental mouse antibody B; the chimeric antibody. The mouse-human chimeric antibody was specifically localized on the LS180 tumor site (indicated by the arrow) and this image was identical to that of the parental mouse an-

tibody.

52

and its immunoassay is important for the diagnosis of tumors and the monitoring of recurrent tumors, particularly in the case of colon cancers. In this study, we constructed the mouse-human chimeric antibody specific for CEA and investigated its in vitro and in vivo properties. On the construction of chimeric genes, we used a heavy chain gene enhancer element as the enhancer for expression of heavy and light chain genes. As described previously (5,8), it was expected that this construction was efficiently transcribed and expressed in mouse myeloma cells. A human Cy^ gene was used as the constant region of a heavy chain. Recently it was reported that the human Cy^ element induced an efficient effector function with the human immune system (25). In fact, our chimeric antibody mediated the efficient lysis of tumor cells in ADCC assay with human effector cells and also mediated the significant lysis in CDC assays compared with the parental mouse antibody. Furthermore, the in vivo anti tumor activity with our chimeric antibody has been investigated by using tumor-bearing nude mice, and the results demonstrated that the in vivo administration of the chimeric antibody greatly suppressed the growth of CEA positive tumor (manuscript in preparation). In biodistribution and immunoscintigraphic imaging, the identical and specific localization on the tumor site was observed with the radiolabeled chimeric antibody and its mouse counterpart. This indicated the our chimeric antibody appeared to be a suitable candidate for the localization of CEA-positive tumors. In conclusion, our mouse-human chimeric antibody specific for CEA is a promising reagent for the diagnosis and/or therapy of CEApositive human cancers. ACKNOWLEDGEMENTS We thank Dr. A. Kudo for his helpful advice and Miss M. Oyamada for preparation of the manuscript. This work was partly supported by the Grant-in-Aid for Cancer Research from the Ministry of Education, Science and Culture of

Japan.

REFERENCES 1. Morrison S.L., Johnson M.J., Herzenberg L.A. and Oi V.T. (1984). Chimeric human antibody molecules : Mouse antigen-binding domains with human constant region domains. Proc. Nati. Acad. Sei. 81: 6851-6855.

2. Boulianne G.L., Hozumi N. and Shulman M.J. functional chimaeric mouse/human antibody. 643-646.

3.

(1984).

Nature

Production of

(London) 312;

Neuberger M.S., Williams G.T., Mitchell E.B., Jouhal S.S., Flanagan J.G. and Rabbitts T.H. (1985). A hapten-specific chimaeric IgE antibody with human physiological effector function.

Nature

(London) 314;

268-270.

53

4.

Sahagan B.G., Dorai H., Saltzgaber-Muller J., Toneguzzo F., Guindon CA., Lilly S.P.. McDonald K.W., Morrissey D.V., Stone B.A., Davis G.L., Mclntosh P.K. and Moore G.P. (1986). A geneti cally engineered murine/human chimeric antibody retains specificity for human tumor-associated antigen. J. Immunol. 137; 1066-1074.

5. Nishimura Y., Yokoyama M., Araki K., Ueda R., Kudo A. and Watanabe T. (1987). Recombinant human-mouse chimeric monoclonal antibody specific for common acute lymphocytic leukemia antigen. Cancer Research 47; 999-1005. 6. Liu A.Y., Robinson R.R., Hellstroem K.E., Murray E.D.Jr, Chang C.P. and Hellstroem I. (1987). Chimeric mouse-human IgGl antibody that can mediate lysis of cancer cells. Proc. Nati. Acad. Sei. 84-,3439-3443.

7. Sun L.K., Curtis P., Rakowicz-Szulczynska E., Ghrayeb J., Chang N., Morrison S.L. and Koprowski H. (1987). Chimeric antibody with human constant regions and mouse variable regions directed against carcinoma-associated antigen 17-1A. Proc. Nati. Acad. Sei. 84;214-218. 8. Komori S., Yamasaki N., Shigeta M., Isojima S. and Watanabe T. (1988). Production of heavy-chain class-switch variants of human monoclonal antibody by recombinant DNA technology. Clin. exp. Immunol. 71; 508-516. 9. Beidler C.B., Ludwig J.R., Cardenas J., Phelps J., Papworth CG., Melcher E., Sierzega M., Myers L.J., Unger B.W., Fisher M., David G.S. and Johnson M.J. (1988). Cloning and high level expression of a chimeric antibody with specificity for human carcinoembryonic antigen. J. Immunol. 141; 4053-4060.

(1965). Demonstration of tumor specific antigens in human colonie carcinoma by immunologie tolerance absorption techniques. J. Exp. Med. 121; 439-462.

10.Gold P. and Freedman S.O.

11.Gold P. and Freedman S.O. (1965). Specific carcinoembryonic antigens of the human digestive system. J. Exp. Med. 122; 467481.

12.Krupey J., Gold

P. and Freedman S.O. (1967). Purification and characterization of carcinoembryonic antigens of the human digestive system. Nature (London) 215; 67-68.

13.Sanger F., Nichklen S. with chain 5463-5467.

terminating

and Coulson A.R. (1977). DNA sequencing inhibitors. Proc. Nati. Acad. Sei. 74;

14.Scatchard G. (1949). The attraction of proteins for small molecules and ions. Ann. N.Y. Acad. Sei. 51; 660-672.

54

15.Endo K., Sakahara H., Nakashima T., Koizumi M., Ohta H., Kawamura Y., Kunimatsu M., Furukawa T., Ohmomo Y., Araño Y., Nakamura T., Tanaka H., Kotoura Y., Yamamuro T., Hosoi S.,

A. and Torizuka K. (1987). Preparation and of antitumor monoclonal antibodies labeled with metallic radionuclides indium-Ill, gallium-67 and technetium99m. NCI Monogrophs 3; 135-140.

Toyama S., Yokoyama

properties

16.Kabat E.A., Wu T.T., Reid-Miller M., Perry H.M. and Gottesman K.S. (1987). Sequences of proteins of immunological interest (Fourth Edition). National Institute of Health, Bethesda.

17.Cabilly S., Riggs A.D., Pande H., Shively J.E., Holmes W.E., Rey M., Perry L.J., Wetzel R. and Heyneker H.L. (1984). Generation of antibody activity from immunoglobulin polypeptide chains produced in Escherichia coli. Proc. Nati. Acad. Sei. 81; 32733277.

18.Kudo A., Ishihara T., Nishimura Y. and Watanabe T. (1985). A cloned human immunoglobulin heavy chain gene with a novel direct repeat sequence in 5' flanking region. Gene 33; 181-189. and Berg P.(1981). Selection for animal cells that Escherichia coli gene coding for xanthine-guanine the express phosphoribosyltransferase. Proc. Nati. Acad. Sei. 78; 20722076.

19.Mulligan R.C.

20.Southern P.J. and Berg P. (1982). Transformation of mammalian cells to antibiotic resistance with a bacterial gene under control of SV40 early region promotor. J. mol. appl. Genetics 1; 327-341. and Miller R.A. (1983). Biological and chemical implications of lymphocyte hybridomas : Tumor therapy with monoclonal antibodies. Ann. Rev. Med. 34; 107-116.

21.Levy R.

22.Shawler D.L., Bartholomew R.M., Smith L.M. and Dillman R.O. (1985). Human immune response to multiple injections of murine monoclonal IgG. J. Immunol. 135; 1530-1535. Moore R., Lärche M., Pectasides D., Dhokia B. and Ritter M.A. (1986). Development of primary and secondary immune responses to mouse monoclonal antibodies used in the diagnosis and therapy of malignant neoplasms. Cancer Research 46; 6489-6493.

23.Courtenay-Luck N.S., Epenetos A.A.,

24.LoBuglio A.F., Wheeler R.H., Trang J., Haynes A., Rogers K., Harvey E.B., Sun L., Ghrayeb J. and Khazaeli M.B. (1989). Mouse/human chimeric monoclonal antibody in man : Kinetics and immune response.

25.Steplewski Z.,

Proc. Nati. Acad. Sei. 86; 4220-4224.

Sun L.K., Shearman C.W., Ghrayeb J., Daddona P.

55

Koprowski H. (1988). Biological activity of human-mouse IgGl, IgG2, IgG3, and IgG4 chimeric monoclonal antibodies with antitumor specificity. Proc. Nati. Acad. Sei. 85; 4852-4856.

and

Address

reprint requests

to

:

Takeshi Watanabe, MD Medical Institute of Bioregulation,

Kyushu University,

3-1-1, Maidashi, Higashi-ku, Fukuoka 812, Japan Received for

Accepted

publication

October

October 2, 1989

9, 1989

56