J. Parasitol., 101(2), 2015, pp. 182–192 Ó American Society of Parasitologists 2015

MORPHOLOGICAL VARIABILITY AND MOLECULAR IDENTIFICATION OF UNCINARIA SPP. (NEMATODA: ANCYLOSTOMATIDAE) FROM GRIZZLY AND BLACK BEARS: NEW SPECIES OR PHENOTYPIC PLASTICITY? Stefano Catalano, Manigandan Lejeune*, Bradley van Paridon†, Christopher A. Pagan‡, James D. Wasmuth, Paolo Tizzani§, Pa´draig J. Duignan, and Steven A. Nadler‡ Department of Ecosystem and Public Health, Faculty of Veterinary Medicine, University of Calgary, 3280 Hospital Drive NW, Calgary, AB T2N 4Z6, Canada. Correspondence should be sent to: [email protected] ABSTRACT:

The hookworms Uncinaria rauschi Olsen, 1968 and Uncinaria yukonensis (Wolfgang, 1956) were formally described from grizzly (Ursus arctos horribilis) and black bears (Ursus americanus) of North America. We analyzed the intestinal tracts of 4 grizzly and 9 black bears from Alberta and British Columbia, Canada and isolated Uncinaria specimens with anatomical traits never previously documented. We applied morphological and molecular techniques to investigate the taxonomy and phylogeny of these Uncinaria parasites. The morphological analysis supported polymorphism at the vulvar region for females of both U. rauschi and U. yukonensis. The hypothesis of morphological plasticity for U. rauschi and U. yukonensis was confirmed by genetic analysis of the internal transcribed spacers (ITS-1 and ITS-2) of the nuclear ribosomal DNA. Two distinct genotypes were identified, differing at 5 fixed sites for ITS-1 (432 base pairs [bp]) and 7 for ITS-2 (274 bp). Morphometric data for U. rauschi revealed host-related size differences: adult U. rauschi were significantly larger in black bears than in grizzly bears. Interpretation of these results, considering the historical biogeography of North American bears, suggests a relatively recent host-switching event of U. rauschi from black bears to grizzly bears which likely occurred after the end of the Wisconsin glaciation. Phylogenetic maximum parsimony (MP) and maximum likelihood (ML) analyses of the concatenated ITS-1 and ITS-2 datasets strongly supported monophyly of U. rauschi and U. yukonensis and their close relationship with Uncinaria stenocephala (Railliet, 1884), the latter a parasite primarily of canids and felids. Relationships among species within this group, although resolved by ML, were unsupported by MP and bootstrap resampling. The clade of U. rauschi, U. yukonensis, and U. stenocephala was recovered as sister to the clade represented by Uncinaria spp. from otariid pinnipeds. These results support the absence of strict host–parasite co-phylogeny for Uncinaria spp. and their carnivore hosts. Phylogenetic relationships among Uncinaria spp. provided a framework to develop the hypothesis of similar transmission patterns for the closely related U. rauschi, U. yukonensis, and U. stenocephala.

Hookworms (Nematoda: Ancylostomatidae) are hematophagous nematodes responsible for significant pathology in mammals. These parasites develop to the adult stage in the small intestine of their hosts, where they attach to the mucosa and submucosa with their armed buccal capsule. Hookworms of the genus Uncinaria are commonly found in colder climates worldwide. In North America, Uncinaria spp. exclusively parasitize hosts of the order Carnivora such as canids, felids, and otariid pinnipeds (Anderson, 2000). Their infection is initiated when soil-borne third-stage larvae (L3) enter a suitable host by skin penetration, oral ingestion, or both (Anderson, 2000). In northern fur seals (Callorhinus ursinus) and New Zealand sea lions (Phocarctos hookeri), after percutaneous or oral transmission infective Uncinaria L3 can migrate to the abdominal tissues of the host; only in puerperal females can L3 complete their life cycle by passing through the mammary glands to the nursing offspring (Olsen and Lyons, 1965; Lyons, 1994; Castinel et al., 2007). In contrast, milk-borne L3 have not been documented for Uncinaria stenocephala (Railliet, 1884), which infects both canids and felids (Gibbs, 1961; Walker and Jacobs, 1982, 1985).

Information on hookworms in bears is limited to the taxonomic descriptions of Uncinaria yukonensis (Wolfgang, 1956) discovered in black bears (Ursus americanus) from the Yukon Territory, Canada, and Uncinaria rauschi Olsen, 1968 of grizzly (Ursus arctos horribilis) and black bears from Alaska, United States. There are additional reports of U. yukonensis from bears in North America (Rausch, 1961; Choquette et al., 1969; Jonkel and Cowan, 1971; Frechette and Rau, 1977) and in brown bears (Ursus arctos) from eastern Russia (Rausch et al., 1979). In contrast, the only additional report of U. rauschi is from black bears of the Northwest Territories, Canada (S. J. Kutz, pers. comm., reported in Johnson et al., 2013). The few morphological studies of U. yukonensis and U. rauschi (Wolfgang, 1956; Olsen, 1968; Rausch et al., 1979) provided several discriminatory characteristics of taxonomic value: (1) for adults of both genders, U. yukonensis is considerably larger than U. rauschi; (2) male spicule length of 1.6–1.8 mm for U. yukonensis and 0.82–0.95 mm for U. rauschi; (3) females of U. yukonensis characterized by a prominent pre-vulvar flap whereas U. rauschi female specimens lack a pronounced flap. During a survey on parasitic diseases of grizzly and black bears from national and provincial parks of Alberta and British Columbia, Canada, we isolated unknown hookworm morphotypes parasitizing the intestinal tract of both bear species. Specifically, we found female specimens with either 1 or 2 knobs defining the vulvar opening, a morphological trait never reported before for Uncinaria spp. in bears. This preliminary finding raised questions about the systematics of the ursine Uncinaria spp., suggesting the possibility of a third species of Uncinaria in grizzly and black bears and a need to test the hypotheses of 2 described species using molecular data. The rationale behind this study was to better understand hookworm biodiversity and evolution in North American bears. Herein, classical and molecular systematic techniques are used to ascertain whether these anatomical

Received 5 August 2014; revised 12 December 2014; accepted 15 December 2014. * Canadian Wildlife Health Cooperative – Alberta Node, 3280 Hospital Drive NW, Calgary, AB T2N 4Z6, Canada. † Department of Biological Sciences, Faculty of Arts and Science, University of Lethbridge, 4401 University Drive, Lethbridge, AB T1K 3M4, Canada. ‡ Department of Entomology and Nematology, University of California, One Shields Avenue, Davis, California 95616-8668. § Department of Animal Production, Epidemiology and Ecology, Faculty of Veterinary Medicine, University of Turin, Via Leonardo da Vinci 44, Grugliasco, TO 10095, Italy. DOI: 10.1645/14-621.1 182

CATALANO ET AL.—SYSTEMATICS OF UNCINARIA SPP. IN BEARS

183

FIGURE 1. Distribution map of the sites where carcasses of grizzly (Ursus arctos horribilis; black triangle) and black bears (Ursus americanus; black circle) were retrieved in Alberta and British Columbia, Canada. Map developed using the software ArcGIS 10.1, ESRIt (ESRI, Redlands, California).

variants represent polymorphism for known hookworm species or, by contrast, are consistent with separate evolutionary lineages not yet described. MATERIALS AND METHODS Specimen collection The intestinal tracts of 3 grizzlies and 4 black bears from Alberta were obtained during the post-mortem examination of bears found dead within the Alberta Parks and the Canadian Rocky Mountain Parks. Specimens from 1 grizzly and 5 black bears from British Columbia were collected from animals killed by legal hunting within science-based wildlife management programs independent from the present study (Fig. 1). The collected intestines were stored at 20 C. Once thawed and dissected, the intestinal contents were rinsed through a sieve (500 lm mesh), then diluted and examined for parasites. Isolated hookworms and other helminths were preserved in 70% ethanol and stored at 20 C for both morphological and molecular analyses.

150 specimens (99 females and 51 males) from the 4 grizzlies and 285 (170 females and 115 males) from the 9 black bears. Following previous studies on Uncinaria morphometrics (Nadler et al., 2000a; Castinel et al., 2006), measurements for the males included body length and width at its distal extremity, buccal capsule depth, esophageal length and width at the base, distance of the nerve ring from the anterior end of the esophagus, distance of the excretory pore from the anterior end of the body, spicule length, gubernaculum length, and dorsal ray length and width. The first 7 of these measurements were also made for females (body width immediately posterior to the vulvar region) along with distance of vulva from the posterior end, tail length (from the anal opening to the posterior end), and egg length and width. After morphological analysis, specimens were rinsed in 70% ethanol to remove lactophenol before preservation in numbered vials containing 90% ethanol. Morphometric data from the specimens were analyzed using the statistical software R (R Core Team, 2013). The normal distribution of the data was assessed with the Shapiro-Wilk W-test. The Wilcoxon rank sum test with continuity correction was used to determine significant biometric differences among the analyzed specimens (P , 0.05 for statistical significance).

Morphological analysis After rehydration in tap water and clearing with lactophenol, adult hookworms were examined using an Olympus BX53 microscope equipped with an Olympus DP73 digital camera and cellSenst Digital Imaging Software version 1.9 (Olympus Corporation, Tokyo, Japan). Measurements were made for 269 adult female and 166 adult male hookworms:

Polymerase chain reaction (PCR) amplification Individual hookworms subjected to the morphometric analysis were analyzed using sequences from the internal transcribed spacers (ITS-1 and ITS-2) of the nuclear ribosomal DNA (rDNA). The specimens were rehydrated in TE buffer and then genomic DNA was extracted from the

184

THE JOURNAL OF PARASITOLOGY, VOL. 101, NO. 2, APRIL 2015

excised mid-body using the Epicentret MasterPuree Complete DNA and RNA Purification Kit (Epicentre Biotechnologies, Madison, Wisconsin). DNA was eluted in 20 ll TE buffer and stored at 20 C. DNA extracts from each specimen were amplified for the ITS-1 and ITS-2 genes using primers no. 93 (forward, 5 0 -TTGAACCGGGTAAAAGTCG) and 264 (reverse, 5 0 -CGTTTTTCATCGATACGCG) for ITS-1 and primers no. 623 (forward, 5 0 -ACGTCTGGTTCAGGGTTGTT) and 94 (reverse, 5 0 TTAGTTTCTTTTCCTCCGCT) for ITS-2 (Nadler et al., 2000a, 2000b). Amplifications were performed in a 25-ll reaction mixture containing 2.5 ll 103 PCR buffer, 3 mM MgCl2, 200 lM deoxynucleoside triphosphates, 0.5 lM of each primer, 1.25 ll of bovine serum albumin (New England Biolabs, Ipswich, Massachusetts), 1 unit of AmpliTaq DNA polymerase, and 2 ll DNA template. Cycling parameters consisted of an initial nucleic acid denaturation at 95 C for 5 min followed by 33 cycles of 95 C for 1 min, 54 C for 1 min, and 1 min at 72 C, with a final extension of 5 min at 72 C. Sequence and phylogenetic analyses PCR products were sequenced using an Applied Biosystems 3730xl DNA Analyzer with BigDyet Terminator chemistry (Perkin-Elmer, Waltham, Massachusetts) after treatment with exonuclease I and shrimp alkaline phosphatase (GE Healthcare Biosciences, Piscataway, New Jersey) or purification with the E.Z.N.A.e MicroElute Cycle-Pure Kit (Omega Bio-Tek, Norcross, Georgia). Sequencing reactions were doublestranded using the original PCR primers. Contig assembly and editing were performed with CodonCode Aligner (CodonCode Corporation, Centerville, Massachusetts). The invariant flanking regions corresponding to the PCR primers and any poor-quality ends were removed from each contig before sequence alignment and analysis. ITS-1 and ITS-2 sequences from individual parasites were aligned separately using PRANKSTER (Loytynoja and Goldman, 2005). Additional sequences from the National ¨ Center for Biotechnology Information (NCBI) GenBank database were incorporated into the alignments; the analysis included the ITS regions of: U. stenocephala from the arctic fox, Alopex lagopus (GenBank AF194145); U. stenocephala from the island fox, Urocyon littoralis (HQ262052); Uncinaria lucasi Stiles, 1901 from the Steller’s sea lion, Eumetopias jubatus (HQ262132); Uncinaria hamiltoni Baylis, 1933 from the South American sea lion, Otaria flavescens (HQ262120); Uncinaria sp. from the New Zealand sea lion (HQ262089). The species Ancylostoma caninum (Ercolani, 1859) and Ancylostoma duodenale (Dubini, 1843) were used as outgroups to root the phylogenetic tree (GenBank JQ812694 and EU344797, respectively). The aligned ITS-1 and ITS-2 regions were concatenated for the phylogenetic analysis, and gaps were recoded when ambiguous. Maximum parsimony (MP) and maximum likelihood (ML) analyses were conducted using PAUP* 4.0b10 (Swofford, 1998). The branch-and-bound search option was used for the MP tree search and for the bootstrap MP analysis (2,000 replicates). The ML tree search was performed using the branch-and-bound search option and a sub-model of the GTR model (010210þGþI model), which was selected as the best-fit model using jModelTest 2 (Guindon and Gascuel, 2003; Darriba et al., 2012) and the Akaike Information Criterion (AIC). Nodal support in the ML analysis was estimated by bootstrap resampling using 2,000 replicates and the heuristic search option (10 replicates of random stepwise addition per replicate and TBR branch-swapping).

RESULTS Morphological analysis All the hookworms had the oral opening fitted with 2 cutting plates and subventral lancets characteristic of Uncinaria spp. (Anderson, 2000). They also presented well-defined cervical papillae, claviform esophagus constricted by a nerve ring at its mid-anterior region, and excretory pore slightly behind the nerve ring. Male hookworms were identified as U. rauschi or U. yukonensis based on identification keys (Wolfgang, 1956; Olsen, 1968). The bursa was characterized by 1 small dorsal and 2 lateroventral lobes, and by 1 dorsal ray divided distally into 2 tridigitate branches, as also described for U. stenocephala (Gibbs, 1961). The 2 spicules were slender and of approximately equal size. The

spicules of U. yukonensis often appeared curved at their distal tip. The ellipsoidal gubernaculum was widest at its posterior (Fig. 2). The mean lengths of spicules and gubernaculum, respectively, were 913.1 6 46.8 lm and 112.9 6 6.1 lm for U. rauschi and 1,641.4 6 86.2 lm and 185.0 6 3.8 lm for U. yukonensis. Based on the morphological analysis, all the bears (n ¼ 13) were parasitized by males of U. rauschi, whereas only 1 adult female grizzly was co-infected with males of U. yukonensis. The 13 bears infected with U. rauschi males also harbored female hookworms characterized by body length varying from 7.77 mm to 16.47 mm and by either 1 or 2 knob-like vulvar appendages respectively posterior to the vulvar opening and delimiting it; few individuals lacked any vulvar knob (Fig. 2). These specimens were provisionally identified as 3 morphovariants of U. rauschi. The only host infected with both U. rauschi and U. yukonensis males harbored several female hookworms that exhibited additional distinct morphological features. These individuals had a body length of 12.89–16.89 mm and were characterized by typical, clearly visible ovejectors and by either a linguiform pre-vulvar flap or obvious bi-lobed, knob-like appendages, remarkably similar to the vulvar structures described for the females from hosts exclusively parasitized by U. rauschi males (Fig. 2). These specimens were provisionally identified as 2 morphovariants of U. yukonensis. However, the high anatomical variability of the vulva among the isolated female hookworms, their largely overlapping ranges of body size, and the incongruence between our observations and published descriptions made necessary a molecular approach for the species diagnosis. Sequence and phylogenetic analyses A total of 16 ITS-1 and 56 ITS-2 rDNA sequences were obtained from 35 grizzly and 21 black bear hookworms (40 females, 16 males). Amplicon size was 432 base pairs (bp) for ITS1 and 274 bp for ITS-2. The sequence alignment revealed 2 distinct genotypes among ursine hookworms, including 5 variable sites for ITS-1 and 7 for ITS-2. The 2 genes exhibited patterns of fixed differences consistent with the presence of 2 exclusive hookworm lineages. No additional sequence variants were detected; the fixed differences were not partitioned according to host species, geographical location, or female hookworm morphotype (Table I). A reduced number of identical ITS sequences from Uncinaria spp. and representative sequences from Ancylostoma spp. (outgroups) were used for phylogenetic analysis to reduce computational requirements. PRANKSTER yielded an alignment of 698 characters (415 characters for ITS-1, 283 characters for ITS-2). Pairwise comparison of the ITS sequences from U. rauschi and U. yukonensis showed a similarity of 686/698 characters (98.3%). Between U. yukonensis and U. stenocephala (AF194145) sequence identity was observed for 688/698 characters (98.6%). Between U. rauschi and U. stenocephala sequence identity was of 684/698 characters (98.0%). Sequence similarity was lower (91.8–92.7%) when ursine hookworms were compared with Uncinaria spp. (HQ262120 and HQ262132) from pinniped hosts (Table II). Phylogenetic analyses of the concatenated ITS-1 and ITS-2 data were performed using MP and ML. For MP analysis, the PRANKSTER alignment included 6 indels recoded as gap present–absent, yielding 704 characters and 92 parsimonyinformative sites. Gaps that were not recoded were treated as

CATALANO ET AL.—SYSTEMATICS OF UNCINARIA SPP. IN BEARS

185

FIGURE 2. Uncinaria yukonensis, grizzly bear (Ursus arctos horribilis): male bursa and spicules (A); female vulvar region, specimens with pre-vulvar flap (B) and with 2 knob-like vulvar appendages (C). Uncinaria rauschi, black bear (Ursus americanus): male bursa and spicules (D); female vulvar region, specimens with 2 (E), 1 (F), and no vulvar knob (G). Scale bars ¼ 200 lm.

missing data. Four most-parsimonious trees were recovered by branch-and-bound parsimony search; each had a length of 118 steps and a consistency index of 0.90. Bootstrap re-sampling with MP analysis yielded 100% support for the clade consisting of U. rauschi, U. yukonensis, and U. stenocephala, with high bootstrap values supporting each species lineage (Fig. 3). However, the strict consensus of MP trees did not resolve relationships among these 3 species of Uncinaria. For ML analysis, the PRANKSTER alignment was used without recoded gaps (698 characters), yielding a single ML tree that depicted U. rauschi and U. stenocephala as sister species. This relationship lacked reliable bootstrap support but, in contrast, ML bootstrap values of 96– 100% supported U. rauschi, U. yukonensis, and U. stenocephala as separate lineages (Fig. 3). The phylogenetic MP and ML analyses

strongly support a close relationship between the ursine hookworms U. rauschi and U. yukonensis with U. stenocephala. These 3 species formed the sister clade to the 1 including Uncinaria spp. from otariid pinnipeds. Voucher specimens representing intact males and each examined female morphotype were deposited in the U.S. National Parasite Collection (USNPC), U.S. Department of Agriculture (USDA), under the accession numbers USNPC 106982 (U. yukonensis from Alberta grizzly bear), 106983 (U. rauschi from British Columbia black bear), 107885 (U. rauschi from British Columbia grizzly bear), 106985 (U. rauschi from Alberta grizzly bear), 107886 (U. rauschi from Alberta black bear). Nuclear ribosomal ITS-1 and ITS-2 data from individual hookworm specimens were deposited in the NCBI GenBank database under

TABLE I. Polymorphic sites within ITS-1 and ITS-2 rDNA of Uncinaria rauschi and Uncinaria yukonensis. The analysis included specimens isolated from grizzly (Ursus arctos horribilis) and black bears (Ursus americanus) from both Alberta (AB) and British Columbia (BC), Canada. Five nucleotide differences were detected within ITS-1 and 7 within ITS-2. Sequences representative of those obtained from grizzly and black bear hosts are shown. ITS-1 sequence variation sites Host species (location)

Hookworm species

Black bear (AB) Black bear (BC) Grizzly bear (AB) Grizzly bear (BC) Grizzly bear (AB)

U. U. U. U. U.

rauschi rauschi rauschi rauschi yukonensis

ITS-2 sequence variation sites

126

177

208

218

271

21

51

54

120

158

175

209

C C C C T

A A A A G

C C C C T

G G G G T

G G G G A

C C C C T

T T T T C

C C C C T

A A A A C

G G G G A

A A A A G

C C C C T

186

THE JOURNAL OF PARASITOLOGY, VOL. 101, NO. 2, APRIL 2015

TABLE II. Pairwise similarity scores (%) for ITS rDNA data from Uncinaria species. Hookworm species U. U. U. U. U. U.

Uncinaria yukonensis

Uncinaria rauschi

Uncinaria stenocephala*

U. stenocephala†

Uncinaria lucasi‡

Uncinaria hamiltoni§

— 98.3% 98.6% 98.3% 92.4% 92.7%

98.3% — 98.0% 97.7% 92.3% 91.8%

98.6% 98.0% — 99.7% 92.4% 92.4%

98.3% 97.7% 99.7% — 92.1% 92.1%

92.4% 92.3% 92.4% 92.1% — 98.6%

92.7% 91.8% 92.4% 92.1% 98.6% —

yukonensis rauschi stenocephala* stenocephala† lucasi‡ hamiltoni§

* GenBank AF194145 (Nadler et al., 2000b). † GenBank HQ262052 (Nadler et al., 2013). ‡ GenBank HQ262132 (Nadler et al., 2013). § GenBank HQ262120 (Nadler et al., 2013).

the accession numbers KJ026495–KJ026519. Anterior and posterior ends of hookworm specimens used for the genetic analysis were archived as vouchers in the collection of the Canadian Wildlife Health Cooperative, University of Calgary, Canada, or in the Nematode Collection, University of California Davis, Davis, California (Table III). Morphometric analysis Uncinaria rauschi and U. yukonensis specimens (n ¼ 435) were subjected to morphometric and statistical analyses. The results of the morphometric analysis are shown in Tables IV and V. Comparative historical data from Wolfgang (1956), Olsen (1968), and Rausch et al. (1979) have been included. Morphometric features did not co-vary with the number of vulvar knobs for the 3 female morphotypes of U. rauschi (P . 0.05) as determined by the Wilcoxon rank sum test with continuity correction. Similarly, the morphometric traits of U. yukonensis females did not significantly differ when specimens with a linguiform pre-vulvar flap were compared to specimens characterized by two vulvar knobs (P . 0.05).

The Wilcoxon rank sum test with continuity correction revealed intra-specific, host-related morphometric differences when U. rauschi from black bears were compared to U. rauschi from grizzlies. Both males and females of U. rauschi from black bears had significantly greater body length than those collected from grizzlies (W ¼ 9,220 and P , 0.001 for females; W ¼ 3,064 and P , 0.001 for males), as shown in Figure 4. The same significant relationship existed for the tail size of U. rauschi females (W ¼ 5,569 and P , 0.001 for tail width; W ¼ 5,787 and P , 0.001 for tail length). Other measurements were not significantly different between U. rauschi from black bears and U. rauschi from grizzlies (P , 0.05). The isolation of U. yukonensis from only 1 host did not allow intra-specific statistical comparisons. We applied the Wilcoxon rank sum test with continuity correction for interspecific comparisons between U. rauschi and U. yukonensis: the latter was significantly larger than the former for most of the anatomic structures measured, especially body length, as shown in Figure 4 (W ¼ 1,241 and P , 0.001 for females; W ¼ 48 and P , 0.001 for males). Only female tail length and width were not significantly different between U. rauschi and U. yukonensis (P , 0.05). Although measurements of the reproductive characters for male specimens (e.g., spicules, gubernaculum, and dorsal ray of the bursa) showed distinct, non-overlapping features between U. rauschi and U. yukonensis, females lacked marked differences for any anatomic traits. DISCUSSION Hookworm identification

FIGURE 3. Phylogenetic analysis of the concatenated ITS-1 and ITS-2 rDNA datasets from Uncinaria spp. and Ancylostoma spp. (outgroups). The tree represents the optimal maximum likelihood (ML) tree. Bootstrap support percentages .50% are indicated above (ML) and below (maximum parsimony) the branches. Triangles represent 2 individuals of U. stenocephala (GenBank AF194145 and HQ262052) and 3 individuals for both U. rauschi and U. yukonensis. GenBank accession numbers of other previously published sequences are shown in parentheses.

Wolfgang (1956) and Olsen (1968) concluded that the anatomy of the vulva is a useful feature to distinguish females of U. rauschi from U. yukonensis. However, our observations found considerable morphological variability of the vulvar region, which is likely to confuse taxonomic identification. Few U. rauschi lacked vulvar appendages; most females had either 1 or 2 vulvar knobs. For U. yukonensis, in addition to females with the characteristic linguiform flap, we recovered specimens with conspicuous bilobed vulvar knobs. Conversely, male hookworms could be unequivocally identified as U. rauschi or U. yukonensis based on their reproductive structures. These results seem inconsistent with the hypothesis of more than 2 species of Uncinaria in grizzly and black bears and, in contrast, suggest phenotypic plasticity of the vulva for U. rauschi and U. yukonensis. Previous studies of strongylid parasites have shown that intra-specific morphological polymorphism is common for both genders and that the vulva can

CATALANO ET AL.—SYSTEMATICS OF UNCINARIA SPP. IN BEARS

187

TABLE III. Hookworm species, specimen gender (M for males, F for females) and morphotype, host species and sampling area in western Canada (AB for Alberta, BC for British Columbia), hookworm specimen identifier, and GenBank accession numbers for ITS-1 and ITS-2 rDNA of Uncinaria rauschi and Uncinaria yukonensis.

Species U. U. U. U. U. U. U. U. U. U. U. U. U. U. U. U. U. U. U. U.

Gender – morphotype*

rauschi rauschi rauschi rauschi rauschi rauschi rauschi rauschi rauschi rauschi rauschi rauschi rauschi rauschi rauschi rauschi rauschi yukonensis yukonensis yukonensis

F– F– F– M F– F– F– M F– F– F– F– M M F– F– M F– F– M

0 vk 1 vk 2 vk 1 vk 2 vk 2 vk 0 1 2 2

vk vk vk vk

1 vk 2 vk vf 2 vk

Host

Host location

Hookworm identifiers

GenBank ITS-1

GenBank ITS-2

Black bear Black bear Black bear Black bear Black bear Black bear Black bear Black bear Grizzly bear Grizzly bear Grizzly bear Grizzly bear Grizzly bear Grizzly bear Grizzly bear Grizzly bear Grizzly bear Grizzly bear Grizzly bear Grizzly bear

Banff National Park, AB Lake Louise, AB Jasper National Park, AB Canmore, AB Fort Nelson, BC Cowichan Lake, BC Yoho National Park, BC Quesnel, BC Banff National Park, AB Banff National Park, AB Banff National Park, AB Lake Louise, AB Lake Louise, AB Banff National Park, AB Kitwancool Lake, BC Kitwancool Lake, BC Kitwancool Lake, BC Banff National Park, AB Banff National Park, AB Banff National Park, AB

X7237 X71 X7229 X70 X20 X7206 X7223 X25 X7217 X7214 X35 X7212 X26 X16 X50 X49 X51 X7341 X11 X15

— — — — KJ026501 KJ026502 — KJ026500 — — KJ026505 — KJ026503 — KJ026504 — — KJ026495 KJ026496 —

KJ026507 KJ026516 KJ026517 KJ026515 KJ026508 — KJ026509 KJ026506 KJ026511 KJ026512 — KJ026514 — KJ026510 — KJ026518 KJ026519 KJ026498 KJ026499 KJ026497

* Number of observed vulvar knobs (vk) or vulvar flap (vf).

TABLE IV. Morphometrics of Uncinaria rauschi and Uncinaria yukonensis males from Ursus host species. Unless indicated, measurements of length (L) and width (W) are in micrometers (lm), displayed as mean 6 standard deviation, with range in parentheses. The number of specimens analyzed in the present study is reported along with the parasite species. Parasite species

U. rauschi (n ¼ 115)

U. rauschi (n ¼ 31)

U. yukonensis (n ¼ 20)

U. rauschi*

U. yukonensis

Host

Black bear

Grizzly bear

Grizzly bear

Black bear Grizzly bear

Black bear† Brown bear‡ 10.50–12.94† 13.40–15.10‡ 520† 556–576‡ 230–280† 196–222‡ 150–190† 131–150‡ 860–1150† 949–982‡ 196–222‡ 640–750† 576–602‡ 655–766‡ 1,650–1,750† 1,600–1,800‡ 200† 196–222‡ — —

Body L (mm)

10.20 6 0.77 (7.39–12.14)

8.63 6 1.14 (6.90–10.71)

12.28 6 0.76 (10.56–13.44)

7.40–9.10

Body W at bursa§

275.6 6 30.8 (165.7–354.2)

271.8 6 33.2 (209.5–355.1)

381.0 6 18.3 (355.0–426.0)

243–297

Buccal capsule L

152.8 6 9.0 (128.4–177.0)

162.1 6 12.2 (141.6–188.8)

162.9 6 15.2 (135.7–187.5)

213–297

Buccal capsule W

120.7 6 8.3 (101.4–150.2)

120.6 6 9.1 (104.0–137.7)

129.5 6 10.7 (109.4–152.2)

133–186

Esophagus L

819.8 6 38.2 (731.4–956.6)

817.7 6 44.4 (736.5–915.8)

931.0 6 32.5 (871.1–974.1)

763–856

Esophagus W Nerve ringjj

166.6 6 16.9 (115.1–221.5) 363.0 6 42.6 (221.8–483.4)

165.2 6 19.4 (113.2–197.3) 349.6 6 40.5 (255.1–470.9)

184.7 6 21.4 (128.5–207.3) 374.3 6 30.4 (331.0–428.7)

167–191 445–583

Excretory pore Spicule L

711.4 6 74.5 (537.1–898.9) 913.4 6 48.7 (799.6–1,172.9)

685.9 6 55.6 (584.0–788.9) 912.8 6 35.6 (786.9–973.8)

Gubernaculum L

111.9 6 5.8 (90.5–120.6)

116.5 6 6.0 (108.7–128.4)

185.0 6 3.8 (176.0–190.6)

114–146

Dorsal ray L Dorsal ray W at base

190.4 6 16.2 (156.2–232.8) 55.1 6 5.9 (42.6–80.1)

190.2 6 12.5 (172.0–221.8) 52.9 6 7.9 (40.7–66.5)

292.7 6 19.4 (246.6–316.2) 77.6 6 7.0 (67.2–89.3)

— —

770.3 6 37.0 (681.3–839.3) 1,641.4 6 86.2 (1,320.4–1,763.7)

— 816–954

* Study by Olsen (1968): number of analyzed specimens not reported; only measurement range available. † Study by Wolfgang (1956): analysis made on 2 specimens; only measurement range available. ‡ Study by Rausch et al. (1979): analysis made on 3 specimens; only measurement range available. § Historical studies (Wolfgang, 1956; Olsen, 1968; Rausch et al., 1979) made this measurement at the maximum body width. jj Measurement made to the anterior end of the esophagus; historical studies (Wolfgang, 1956; Olsen, 1968; Rausch et al., 1979) made this measurement to the anterior end of the body.

188

THE JOURNAL OF PARASITOLOGY, VOL. 101, NO. 2, APRIL 2015

TABLE V. Morphometrics of Uncinaria rauschi and Uncinaria yukonensis females from Ursus host species. Unless indicated, measurements of length (L) and width (W) are in micrometers (lm), displayed as mean 6 standard deviation with range in parentheses (NA when not available). The number of specimens analyzed in the present study is reported along with the morphotype. Parasite species

U. rauschi

U. rauschi

Host

Black bear

Grizzly bear

Morphotype* Body L (mm) Body W at vulva Buccal capsule L Buccal capsule W Esophagus L Esophagus W Nerve ring† Excretory pore Vulva–end L (mm) Tail L Egg L‡ Egg W‡

0 vk (n ¼ 2)

1 vk (n ¼ 98)

2 vk (n ¼ 70)

0 vk (n ¼ 5)

14.20 6 0.83 (13.62–14.79) 454.6 6 9.6 (447.8–461.4) 165.2 6 14.3 (155.1–175.3) 148.6 6 7.6 (143.2–154.0) 883.8 6 NA (NA) 181.4 6 12.9 (172.2–190.6) 361.7 6 NA (NA) 907.5 6 181.8 (778.9–1036.0) 5.27 6 0.14 (5.17–5.36) 162.7 6 19.3 (149.1–176.4) 70.9 6 0.3 (70.7–71.1) 38.6 6 3.8 (35.8–41.3)

14.27 6 0.89 (10.67–16.17) 430.0 6 38.8 (318.4–528.3) 171.7 6 10.4 (139.1–197.5) 140.9 6 11.5 (106.5–176.7) 902.3 6 58.6 (784.8–1149.1) 196.6 6 21.1 (137.4–250.1) 386.1 6 43.7 (294.9–498.5) 762.2 6 74.0 (588.6–1001.9) 5.19 6 0.45 (4.06–6.24) 187.1 6 23.2 (127.5–244.7) 77.6 6 4.9 (69.0–90.0) 45.5 6 4.0 (38.5–57.3)

13.94 6 1.69 (8.16–16.47) 409.0 6 55.7 (222.3–497.0) 171.2 6 13.3 (140.2–195.9) 143.9 6 10.1 (119.2–165.3) 895.6 6 37.0 (813.1–988.5) 197.8 6 22.9 (155.4–241.8) 386.8 6 40.2 (320.2–493.7) 772.6 6 71.1 (657.5–1077.3) 5.06 6 0.72 (2.78–6.10) 190.9 6 19.3 (140.8–242.9) 77.1 6 5.8 (66.8–87.0) 45.4 6 4.8 (38.0–56.7)

10.95 6 2.25 (8.40–12.98) 382.1 678.7 (283.1–465.5) 171.5 6 10.7 (161.6–188.3) 143.5 6 7.1 (138.1–154.7) 884.1 6 89.2 (831.6–1042.2) 186.8 6 14.6 (162.4–200.3) 370.2 6 52.9 (316.8–451.8) 748.9 6 123.2 (647.3–950.7) 3.73 6 1.17 (2.32–4.77) 185.6 6 26.8 (149.8–210.2) 78.4 6 5.5 (72.9–83.8) 47.9 6 3.3 (44.1–50.2)

1 vk (n ¼ 27) 11.51 6 1.66 (8.97–15.23) 413.0 6 45.9 (342.1–515.4) 173.3 6 15.7 (141.2–208.3) 139.9 6 9.8 (117.5–159.4) 903.6 6 51.0 (785.7–1012.2) 193.7 6 22.9 (131.4–227.1) 379.4 6 34.2 (284.5–435.8) 749.89 6 63.1 (646.6–883.9) 3.93 6 0.64 (2.89–5.52) 173.3 6 18.1 (140.3–201.3) 81.4 6 4.5 (72.3–89.1) 45.6 6 3.9 (40.4–53.9)

2 vk (n ¼ 28) 10.57 6 1.71 (7.77–13.91) 363.8 6 64.5 (254.8–482.6) 178.0 6 18.5 (141.7–217.6) 142.8 6 12.1 (106.2–160.5) 888.4 6 54.2 (763.5–1006.9) 188.5 6 16.3 (150.6–215.2) 381.3 6 43.0 (331.7–509.8) 757.1 6 67.0 (665.9–939.9) 3.56 6 0.82 (2.19–5.09) 177.6 6 23.7 (137.2–233.6) 80.6 6 5.0 (71.8–89.3) 45.7 6 3.5 (39.5–53.5)

* Number of observed vulvar knobs (vk) or flaps (vf). † Measurement made to the anterior end of the esophagus; historical studies (Wolfgang, 1956; Olsen, 1968; Rausch et al., 1979) made this measurement to the anterior end of the body. ‡ Measurements made from eggs in the vagina. § Study by Olsen (1968): number of analyzed specimens not reported; only measurement range available. jj Study by Wolfgang (1956): analysis made on 5 specimens; only measurement range available. # Study by Rausch et al. (1979): analysis made on 3 specimens; only measurement range available.

be a particularly variable structure (e.g., Le Jambre, 1977; Le ´ Jambre and Royal, 1977; Drozdz, 1995; Lichtenfels et al., 1997; Hoberg et al., 1999, 2012). Careful analyses have demonstrated the presence of morphovariants where it was once thought there were multiple species infections; in contrast, there are also many instances of single morphospecies concealing a complex of genetically distinct lineages (e.g., Lancaster and Hong, 1990; Hoberg et al., 1993; Lichtenfels et al., 1994; Newton et al., 1998; Dallas et al., 2001; Leignel et al., 2002). The analysis of the ITS rDNA sequences unambiguously confirmed the current species status and the hypothesis of morphological polymorphism for U. rauschi and U. yukonensis. Sequences of the ITS-1 and ITS-2 regions showed a total of 12 nucleotide differences at fixed sites between U. rauschi and U. yukonensis. The ITS regions were confirmed to be reliable genetic markers to discriminate between nematode species because of their low level of intra-specific variability (typically 1%) coupled with higher rates of evolution than catalytic RNA (Nadler, 2002; Chilton, 2004). The combined use of morphological observations and molecular data further proved its value for the delimitation of

Uncinaria species (Nadler et al., 2000a; Ramos et al., 2013; Marcus et al., 2014a). Hookworm morphometry Along with male reproductive structures and the vulvar region of females, the original descriptions of U. rauschi (Olsen, 1968) and U. yukonensis (Wolfgang, 1956) reported total body length as a discriminating feature, with U. yukonensis distinctly larger than U. rauschi for adults of both genders. However, our analysis of 376 U. rauschi specimens revealed a wider morphometric range than previously reported for most structures. Larger body size range was particularly remarkable for U. rauschi males (6.90– 12.14 mm in the current study, 7.40–9.10 mm in Olsen [1968]) and females (7.77–16.47 mm in the current study, 7.20–10.50 mm in Olsen [1968]). The Wilcoxon rank sum test with continuity correction demonstrated that body dimensions were host-related, with U. rauschi from black bears significantly larger than those from grizzlies. The larger size was not significantly correlated with the number of vulvar knobs for females of U. rauschi. In contrast, the 59 U. yukonensis from a grizzly bear showed measurements

CATALANO ET AL.—SYSTEMATICS OF UNCINARIA SPP. IN BEARS

TABLE V. Extended.

U. yukonensis

U. rauschi§

U. yukonensis

Grizzly bear

Black bear Grizzly bear

Black bearjj Brown bear#

7.2–10.5

14.25–17.12jj 19.4–19.9# 490–600jj 628–884# 230–280jj 183–229# 150–190jj 117–150# 860–1150jj 940–1000# 229–242#

1 vf (n ¼ 27)

2 vk (n ¼ 12)

15.23 6 0.96 (12.89–16.71) 437.3 6 35.4 (373.0–498.8) 177.7 6 9.0 (164.4–203.8) 145.6 6 11.3 (128.8–168.6) 997.4 6 39.8 (897.8–1067.1) 197.6 6 24.3 (136.5–234.9) 420.9 6 63.2 (359.7–634.2) 847.4 6 70.8 (714.6–979.2) 5.45 6 0.43 (4.64–6.19) 191.1 6 24.0 (118.0–238.7) 80.3 6 4.5 (70.1–88.8) 44.9 6 3.9 (40.5–54.5)

15.61 6 0.81 (13.72–16.89) 438.2 6 38.3 (355.0–485.7) 183.8 6 10.1 (165.7–202.3) 146.9 6 15.2 (120.7–171.1) 994.1 6 39.4 (936.1–1062.6) 200.0 6 22.0 (163.3–230.2) 401.2 6 37.5 (371.5–494.3) 849.7 6 82.8 (723.2–993.1) 5.39 6 0.43 (4.73–6.11) 189.0 6 28.0 (131.5–247.5) 80.4 6 4.1 (73.4–86.4) 44.3 6 3.4 (38.1–48.3)

275–381 215–282 133–186 742–954 159–201 318–614 488–700

640–750jj 576–713# 674#

2.4–3.5

7.1–7.9#

127–170

230–250jj 189–255# 75–83jj 79–86# 60–68jj 43–49#

72–80 35–45

and ranges similar to the specimens analyzed by Wolfgang (1956), whereas the same hookworm species was reported as much larger in Russian brown bears (Rausch et al., 1979). In particular, the body length for U. yukonensis males (10.56–13.44 mm in the current study, 10.50–12.94 mm in Wolfgang [1956], 13.40–15.10 mm in Rausch et al. [1979]), and females (12.89–16.89 mm in the current study, 14.25–17.12 mm in Wolfgang [1956], 19.40–19.90 mm in Rausch et al. [1979]) differed considerably between North American reports and the study from the Russian Far East. However, comparisons between current and historical morphometric data must consider that U. yukonensis was obtained from only 1 host in this study and that previous studies (Wolfgang, 1956; Rausch et al., 1979) measured a small number of individuals (n ¼ 13). Different conditioning fitness and growth of U. rauschi and U. yukonensis within North American bears may explain the observed intra-specific body size variability in these hookworms. The proposed origin of U. yukonensis in the Palearctic (Rausch et al., 1979) and of U. rauschi in the Nearctic (no reports from Eurasia) endorse the hypothesis of relatively recent host-switching (or host-shifting; see Bush, 1969, 1975) events, with U. rauschi and U. yukonensis colonizing the grizzly and the black bear, respectively. The evolutionary history of grizzly and black bears began with their divergence from a common ancestor approximately 5 million years ago (mya) at the Miocene–Pliocene boundary (Krause et al., 2008). Thereafter, the 2 bear species were geographically separated for millions of years: black bears

189

settled in North America approximately 2.4 mya, whereas the ancestors of modern grizzly bears migrated across the Bering Land Bridge at the beginning of the Wisconsin glaciation, ca. 70– ´ and Anderson, 1980; 100 thousand years ago (kya) (Kurten Hopkins, 1982). During the Wisconsin glaciation black bears used multiple refugia in the Pacific Northwest, which was isolated by the Cordilleran and Laurentide continental ice sheets from the Beringian nexus, the refugium for the precursors of the grizzly bear (Hopkins, 1982; Shields and Kocher, 1991; Shafer et al., 2010). Glacial refugia in Beringia may have favored the genetic divergence of grizzly and Kodiak bears (Ursus arctos middendorffi) from their Eurasian ancestors (Waits et al., 1998). Eventually, with the retreat of the ice sheets ca. 10 kya, grizzly and black bears ´ and Anderson, 1980; Krause et al., became sympatric (Kurten 2008). The historical biogeography of North American bears supports the hypothesis of ancient U. americanus–U. rauschi and U. arctos–U. yukonensis associations. The smaller size of U. rauschi in grizzly bears, hypothesized as the more-recent host– parasite association, may reflect a host-switching event from the black bear that occurred when the 2 Ursus species became sympatric. A comparable hypothesis has been formulated to explain the remarkable host-induced size difference for U. lucasi in northern fur seals and Steller’s sea lions (Lyons, 2005; Nadler et al., 2013). Adult U. lucasi are significantly larger in Steller’s sea lions than in northern fur seals. This observation, interpreted relative to phylogenetic hypotheses for pinniped hookworms and their hosts, implicates Steller’s sea lions as the most ancient U. lucasi host in which the parasite is able to maximize its growth (Nadler et al., 2013). Female parasite body size is considered a reliable measure of parasite fitness and reproductive output within the host (Skorping et al., 1991; Poulin and Morand, 2000; Poulin, 2007). The potentially different historical biogeography of U. rauschi and U. yukonensis in bears suggests an important role for fitness pulses and ecological co-adaptations in the diversification of these host–parasite assemblages (Hoberg and Brooks, 2010). Hookworm phylogeny Pairwise sequence divergence of Uncinaria spp. showed a high similarity among U. rauschi, U. yukonensis, and U. stenocephala. Similarity scores were slightly lower between the ursine hookworms U. rauschi and U. yukonensis (98.3%) than between U. yukonensis and U. stenocephala (98.3–98.6%). However, phenograms as indicators of relationships are inappropriate: they ignore potential rate variation of sequence evolution among lineages and can confound interpretations of evolutionary history (Adams, 1998; Nadler, 2002). The phylogenetic MP and ML analyses of the concatenated ITS-1 and ITS-2 data supported monophyly of U. rauschi, U. yukonensis, and U. stenocephala, depicted the close relationship between the ursine hookworms and U. stenocephala within the clade, and recovered Uncinaria spp. from otariid pinnipeds as the sister group. Bootstrap resampling provided reliable support for 2 distinct sub-clades within the genus Uncinaria, 1 including species from terrestrial carnivore hosts and the other including species from aquatic carnivores (i.e., otariid pinnipeds). However, relationships among U. rauschi, U. yukonensis, and U. stenocephala were not resolved by MP and bootstrap resampling (support was below 50%); only the optimal ML tree topology showed U. rauschi as sister to U. stenocephala.

190

THE JOURNAL OF PARASITOLOGY, VOL. 101, NO. 2, APRIL 2015

FIGURE 4. Body length for male (A) and female (B) Uncinaria specimens: comparison among (1) Uncinaria rauschi in black bears (Ursus americanus), (2) U. rauschi in grizzly bears (Ursus arctos horribilis), and (3) Uncinaria yukonensis. Measurements are in micrometers. The box plots show the distribution of the data; the thicker line indicates its median value, the box shows the distance between first and third quartile, the whiskers represent the lowest and highest datum respectively within 1.5 inter-quartile range of the lower and upper quartile, and outliers are indicated by dots.

Despite the lack of robust, fine-scaled phylogenetic resolution, these results provide a framework for formulating hypotheses on the evolution of hookworms in bears. The MP and ML analyses support 2 distinct clades of Uncinaria spp., 1 from terrestrial and the other from aquatic carnivores, suggesting that habitat has played a fundamental role in the evolution of Uncinaria hookworms. These preliminary results may be used to infer a transition of Uncinaria spp. from terrestrial to aquatic carnivore hosts, which perhaps occurred when the ancestors of pinnipeds colonized the aquatic environment. Paleontological and molecular evidence have shown that ursids became a monophyletic group by first diverging from early canids, then from mustelids and pinnipeds approximately 35 mya, during the Oligocene epoch (Wesley-Hunt and Flynn, 2005; Arnason et al., 2006; Higdon et al., 2007). The co-phylogenetic hypothesis predicting that the ursine Uncinaria spp. should be more closely related to Uncinaria spp. of pinnipeds than to U. stenocephala is not supported by our study. Topological incongruence between the phylogenies of hosts and their parasites has been found in several host–parasite systems, including the one composed of Uncinaria spp. and their pinniped hosts (e.g., Joseph et al., 2002; Wickstrom ¨ et al., 2003; Brooks and Ferrao, 2005; Nadler et al., 2013). The phylogeny of Uncinaria spp. may also be useful as a predictive framework for hookworm transmission patterns in carnivore hosts. Closely related species such as A. caninum and A. duodenale appear to share the same soil-borne and milk-borne

transmission of their infective L3 (Loukas and Prociv, 2001; Bethony et al., 2006; Jex et al., 2009). Similarly, phylogeny can be used as a tool to infer life cycle features for hookworms of pinniped hosts. Transmammary transmission of milk-borne L3 from mother to neonates during lactation has been documented for the closely related Uncinaria spp. of California sea lions (Zalophus californianus) and northern fur seals (Olsen and Lyons, 1965; Lyons, 1994; Lyons et al., 2000, 2005; Nadler et al., 2013); their infection is reported as a primary cause of debilitation and mortality in pups (Lyons et al., 1997, 2011; Spraker et al., 2004, 2007). Transmammary transmission as a relevant source of infective L3 for newborns has also been inferred for the phylogenetically close Uncinaria spp. of Australian sea lions (Neophoca cinerea) and New Zealand sea lions (Castinel et al., 2007; Marcus et al., 2014b). Is the clade of U. rauschi, U. yukonensis, and U. stenocephala predictive of similar transmission routes for its members? The parasite U. stenocephala is the only species of this group with well-known life cycle features. Experimental infections to detect U. stenocephala milk-borne L3 have been inconclusive; only a horizontal, mainly oral infection route has been documented (Gibbs, 1961; Walker and Jacobs, 1982, 1985). Uncinaria stenocephala is currently considered among the least-pathogenic hookworm species (Miller, 1968; Bowman et al., 2010). Low Uncinaria spp. burdens in the intestine of grizzly and black bear cubs, in addition to higher infection prevalence and intensity in adult bears (Catalano, 2014), further support a mainly percutaneous–oral transmission of infective L3 for U. rauschi and U. yukonensis. In conclusion, our study reports morphological polymorphism for U. rauschi and U. yukonensis of grizzly and black bears. Morphometric and distribution data of these 2 hookworm species, along with the historical biogeography of bears, suggest ancient host–parasite associations of grizzly and black bears with U. yukonensis and U. rauschi, respectively. Phylogenetic MP and ML analyses of the ITS rDNA regions support the species lineages of U. rauschi and U. yukonensis as monophyletic and as closely related to U. stenocephala. This study provides a preliminary framework to interpret the systematics of Uncinaria spp. and generates hypotheses for additional testing. Nevertheless, the evolution and life cycle of U. rauschi and U. yukonensis remain enigmatic. Further studies are necessary to confirm the presence of vulvar polymorphism in U. rauschi and U. yukonensis and to rule out the potential for artifacts. A more-comprehensive analysis for Uncinaria spp. of terrestrial carnivores including multiple, more-rapidly evolving DNA regions and specimens from different localities will be essential to the understanding of host–parasite evolution and biological features of Uncinaria species. ACKNOWLEDGMENTS We are grateful to the Environment and Sustainable Resource Development (ESRD) of the Alberta Government, to the Fish and Wildlife Branch of the British Columbia Ministry of Forests, Lands and Natural Resource Operations, to the Guide Outfitters Association of British Columbia (GOABC), and to the officers of Parks Canada for their help with the collection of specimens. We sincerely thank Helen Schwantje, Cait Nelson, Susan Cork, Cameron Goater, Blair Fyten, Jon Jorgenson, Guilherme Verocai, and Kathryn Berger for their constant support during the project. The study was funded by the Alberta Conservation Association (ACA) Grants in Biodiversity and by sources internal to the Faculty of Veterinary Medicine, University of Calgary.

CATALANO ET AL.—SYSTEMATICS OF UNCINARIA SPP. IN BEARS

LITERATURE CITED ADAMS, B. J. 1998. Species concepts and the evolutionary paradigm in modern nematology. Journal of Nematology 30: 1–21. ANDERSON, R. C. 2000. Order Strongylida (the bursate nematodes). In Nematode parasites of vertebrates: Their development and transmission, 2nd ed., R. C. Anderson (ed.). CAB International, Wallingford, U.K., p. 41–230. ARNASON, U., A. GULLBERG, A. JANKE, M. KULLBERG, N. LEHMAN, E. A. ¨ A¨ . 2006. Pinniped phylogeny and a new PETROV, AND R. VA¨ INOL hypothesis for their origin and dispersal. Molecular Phylogenetics and Evolution 41: 345–354. BETHONY, J., S. BROOKER, M. ALBONICO, S. M. GEIGER, A. LOUKAS, D. DIEMERT, AND P. J. HOTEZ. 2006. Soil-transmitted helminth infections: Ascariasis, trichuriasis, and hookworm. Lancet 367: 1521–1532. BOWMAN, D. D., S. P. MONTGOMERY, A. M. ZAJAC, M. L. EBERHARD, AND K. R. KAZACOS. 2010. Hookworms of dogs and cats as agents of cutaneous larva migrans. Trends in Parasitology 26: 162–167. BROOKS, D. R., AND A. L. FERRAO. 2005. The historical biogeography of co-evolution: Emerging infectious diseases are evolutionary accidents waiting to happen. Journal of Biogeography 32: 1291–1299. BUSH, G. L. 1969. Sympatric host race formation and speciation in frugivorous flies of the genus Rhagoletis (Diptera, Tephritidae). Evolution 23: 237–251. ———. 1975. Modes of animal speciation. Annual Review of Ecology and Systematics 6: 339–364. CASTINEL, A., P. J. DUIGNAN, E. T. LYONS, W. E. POMROY, N. GIBBS, N. LO´ PEZ-VILLALOBOS, B. L. CHILVERS, AND I. S. WILKINSON. 2007. Epidemiology of hookworm (Uncinaria spp.) infection in New Zealand (Hooker’s) sea lion (Phocarctos hookeri) pups on Enderby Island, Auckland Islands (New Zealand) during the breeding seasons from 1999/2000 to 2004/2005. Parasitology Research 101: 53–62. ———, ———, W. E. POMROY, E. T. LYONS, S. A. NADLER, M. D. DAILEY, I. S. WILKINSON, AND B. L. CHILVERS. 2006. First report and characterization of adult Uncinaria spp. in New Zealand sea lion (Phocarctos hookeri) pups from the Auckland Islands, New Zealand. Parasitology Research 98: 304–309. CATALANO, S. 2014. Morphological and molecular insights into the biodiversity of gastrointestinal parasites from Canadian grizzly (Ursus arctos horribilis) and black bears (Ursus americanus). M.S. Thesis. University of Calgary, Calgary, Alberta, 105 p. CHILTON, N. B. 2004. The use of nuclear ribosomal DNA markers for the identification of bursate nematodes (order Strongylida) and for the diagnosis of infections. Animal Health Research Reviews 5: 173– 187. CHOQUETTE, L. P. E., G. G. GIBSON, AND A. M. PEARSON. 1969. Helminths of the grizzly bear, Ursus arctos L., in northern Canada. Canadian Journal of Zoology 47: 167–170. DALLAS, J. F., R. J. IRVINE, AND O. HALVORSEN. 2001. DNA evidence that Marshallagia marshalli Ransom, 1907 and M. occidentalis Ransom, 1907 (Nematoda: Ostertagiinae) from Svalbard reindeer are conspecific. Systematic Parasitology 50: 101–103. DARRIBA, D., G. L. TABOADA, R. DOALLO, AND D. POSADA. 2012. jModelTest 2: More models, new heuristics and parallel computing. Nature Methods 9: 772. ´ , J. 1995. Polymorphism in the Ostertagiinae Lopez-Neyra, 1947 DROZDZ and comments on the systematics of these nematodes. Systematic Parasitology 32: 91–99. FRECHETTE, J. L., AND M. E. RAU. 1977. Helminths of the black bear in Quebec. Journal of Wildlife Diseases 13: 432–434. GIBBS, H. C. 1961. Studies on the life cycle and developmental morphology of Dochmoides stenocephala (Railliet 1884) (Ancylostomidae: Nematoda). Canadian Journal of Zoology 39: 325–348. GUINDON, S., AND O. GASCUEL. 2003. A simple, fast and accurate method to estimate large phylogenies by maximum-likelihood. Systematic Biology 52: 696–704. HIGDON, J. W., O. R. P. BININDA-EMONDS, R. M. D. BECK, AND S. H. FERGUSON. 2007. Phylogeny and divergence of the pinnipeds (Carnivora: Mammalia) assessed using a multigene dataset. BMC Evolutionary Biology 8: 216. HOBERG, E. P., A. ABRAMS, P. A. PILITT, AND S. J. KUTZ. 2012. Discovery and description of the ‘‘davtiani’’ morphotype for Teladorsagia boreoarcticus (Trichostrongyloidea: Ostertagiinae) abomasal parasites in muskoxen, Ovibos moschatus, and caribou, Rangifer tarandus,

191

from the North American Arctic: Implications for parasite faunal diversity. Journal of Parasitology 98: 355–364. ———, AND D. R. BROOKS. 2010. Beyond vicariance: Integrating taxon pulses, ecological fitting and oscillation in historical biogeography and evolution. In The geography of host–parasite interactions, S. Morand, and B. R. Krasnov (eds.). Oxford University Press, Oxford, U.K., p. 7–20. ———, J. R. LICHTENFELS, AND P. A. PILITT. 1993. Comparative morphology of Ostertagia mossi and Ostertagia dikmansi (Trichostrongylidae) from Odocoileus virginianus and comments on other Ostertagia spp. from the Cervidae. Systematic Parasitology 24: 111– 127. ———, K. J. MONSEN, S. J. KUTZ, AND M. S. BLOUIN. 1999. Structure, biodiversity, and historical biogeography of nematode faunas in Holarctic ruminants: Morphological and molecular diagnoses for Teladorsagia boreoarcticus n. sp. (Nematoda: Ostertagiinae), a dimorphic cryptic species in muskoxen (Ovibos moschatus). Journal of Parasitology 85: 910–934. HOPKINS, D. M. 1982. Aspects of the paleogeography of Beringia during the late Pleistocene. In Paleoecology of Beringia, D. M. Hopkins, J. V. Matthews, C. E. Schweger, and S. B. Young (eds.). Academic Press, New York, New York, p. 3–28. JEX, A., A. WAESCHENBACH, M. HU, J. VAN WYK, I. BEVERIDGE, D. T. LITTLEWOOD, AND R. GASSER. 2009. The mitochondrial genomes of Ancylostoma caninum and Bunostomum phlebotomum—Two hookworms of animal health and zoonotic importance. BMC Genomics 10: 79. JOHNSON, D., N. C. LARTER, B. ELKIN, AND D. G. ALLAIRE. 2013. An opportunistic parasitological and serological examination of nuisance black bears in the Dehcho region of the Northwest Territories. Department of Environment and Natural Resources, Government of the Northwest Territories, Northwest Territories, Manuscript Report No. 227, 62 p. Available at: http://www.enr.gov.nt.ca/sites/default/ files/227_manuscript.pdf. JONKEL, C. J., AND I. MCT. COWAN. 1971. The black bear in the spruce-fir forest. Wildlife Monographs 27, 57 p. JOSEPH, L., T. WILKE, AND D. ALPERS. 2002. Reconciling genetic expectations from host specificity with historical population dynamics in an avian brood parasite, Horsfield’s bronze cuckoo Chalcites basalis of Australia. Molecular Ecology 11: 829–837. ¸ , A. S. MALASPINAS, S. O. KOLOKOTRONIS, KRAUSE, J., T. UNGER, A. NOCON M. STILLER, L. SOIBELZON, H. SPRIGGS, P. H. DEAR, A. W. BRIGGS, ET AL. 2008. Mitochondrial genomes reveal an explosive radiation of extinct and extant bears near the Miocene–Pliocene boundary. BMC Evolutionary Biology 8: 220. ´ , B., AND E. ANDERSON. 1980. Pleistocene mammals of North KURTEN America. Columbia University Press, New York, New York, 442 p. LANCASTER, M. B., AND C. HONG. 1990. The identification of females within the subfamily Ostertagiinae Lopez-Neyra 1947. Veterinary Parasitology 35: 21–27. LE JAMBRE, L. F. 1977. Genetics of vulvar morph types in Haemonchus contortus: Haemonchus contortus from the Finger Lakes region of New York. International Journal for Parasitology 7: 9–14. ———, AND W. M. ROYAL. 1977. Genetics of vulvar morph types in Haemonchus contortus: Haemonchus contortus from the Northern Tablelands of New South Wales. International Journal for Parasitology 7: 481–487. LEIGNEL, V., J. CABARET, AND J. F. HUMBERT. 2002. New molecular evidence that Teladorsagia circumcincta (Nematoda: Trichostrongylidea) is a species complex. Journal of Parasitology 88: 135–140. LICHTENFELS, J. R., E. P. HOBERG, AND D. S. ZARLENGA. 1997. Systematics of gastrointestinal nematodes of domestic ruminants: Advances between 1992 and 1995 and proposals for future research. Veterinary Parasitology 72: 225–245. ———, P. A. PILITT, AND E. P. HOBERG. 1994. New morphological characters for identifying individual specimens of Haemonchus spp. (Nematoda: Trichostrongyloidea) and a key to species in ruminants of North America. Journal of Parasitology 80: 107–119. LOUKAS, A., AND P. PROCIV. 2001. Immune responses in hookworm infections. Clinical Microbiology Reviews 14: 689–703. LO¨ YTYNOJA, A., AND N. GOLDMAN. 2005. An algorithm for progressive multiple alignment of sequences with insertions. Proceedings of the National Academy of Sciences of the U.S.A. 102: 10557–10562.

192

THE JOURNAL OF PARASITOLOGY, VOL. 101, NO. 2, APRIL 2015

LYONS, E. T. 1994. Vertical transmission of nematodes: Emphasis on Uncinaria lucasi in northern fur seals and Strongyloides westeri in equids. Journal of the Helminthological Society of Washington 61: 169–178. ———. 2005. Historic importance of some aspects of research by O. Wilford Olsen on hookworms (Uncinaria lucasi) in northern fur seals (Callorhinus ursinus) and Steller sea lions (Eumatopias jubatus) in 1951 on St. Paul Island, Alaska. Parasitology Research 95: 353–357. ———, R. L. DELONG, F. M. GULLAND, S. R. MELIN, S. C. TOLLIVER, AND T. R. SPRAKER. 2000. Comparative biology of Uncinaria spp. in the California sea lion (Zalophus californianus) and the northern fur seal (Callorhinus ursinus) in California. Journal of Parasitology 86: 1348– 1352. ———, ———, S. R. MELIN, AND S. C. TOLLIVER. 1997. Uncinariasis in northern fur seal and California sea lion pups from California. Journal of Wildlife Diseases 33: 848–852. ———, ———, S. A. NADLER, J. L. LAAKE, A. J. ORR, B. L. DELONG, AND C. PAGAN. 2011. Investigations of peritoneal and intestinal infections of adult hookworms (Uncinaria spp.) in northern fur seal (Callorhinus ursinus) and California sea lion (Zalophus californianus) pups on San Miguel Island, California (2003). Parasitology Research 109: 581– 589. ———, ———, T. R. SPRAKER, S. R. MELIN, J. L. LAAKE, AND S. C. TOLLIVER. 2005. Seasonal prevalence and intensity of hookworms (Uncinaria spp.) in California sea lion (Zalophus californianus) pups born in 2002 on San Miguel Island, California. Parasitology Research 96: 127–132. MARCUS, A. D., D. P. HIGGINS, AND R. GRAY. 2014b. Epidemiology of hookworm (Uncinaria sanguinis) infection in free-ranging Australian sea lion (Neophoca cinerea) pups. Parasitology Research 113: 3341– 3353. ———, ———, J. Sˇ LAPETA, AND R. GRAY. 2014a. Uncinaria sanguinis sp. n. (Nematoda: Ancylostomatidae) from the endangered Australian sea lion, Neophoca cinerea (Carnivora: Otariidae). Folia Parasitologica 61: 255–265. MILLER, T. A. 1968. Pathogenesis and immunity in hookworm infection. Transactions of the Royal Society of Tropical Medicine and Hygiene 62: 473–489. NADLER, S. A. 2002. Species delimitation and nematode biodiversity: Phylogenies rule. Nematology 4: 615–625. ———, B. J. ADAMS, E. T. LYONS, R. L. DELONG, AND S. R. MELIN. 2000a. Molecular and morphometric evidence for separate species of Uncinaria (Nematoda: Ancylostomatidae) in California sea lions and northern fur seals: Hypothesis testing supplants verification. Journal of Parasitology 86: 1099–1106. ———, E. P. HOBERG, D. S. S. HUDSPETH, AND L. R. RICKARD. 2000b. Relationships of Nematodirus species and Nematodirus battus isolates (Nematoda: Trichostrongyloidea) based on nuclear ribosomal DNA sequences. Journal of Parasitology 86: 588–601. ———, E. T. LYONS, C. PAGAN, D. HYMAN, E. E. LEWIS, K. BECKMEN, C. M. BELL, A. CASTINEL, R. L. DELONG, P. J. DUIGNAN, ET AL. 2013. Molecular systematics of pinniped hookworms (Nematoda: Uncinaria): Species delimitation, host associations and host-induced morphometric variation. International Journal for Parasitology 43: 1119– 1132. NEWTON, L. A., N. B. CHILTON, I. BEVERIDGE, AND R. B. GASSER. 1998. Genetic evidence indicating that Cooperia surnabada and Cooperia oncophora are one species. International Journal for Parasitology 28: 331–336. OLSEN, O. W. 1968. Uncinaria rauschi (Strongyloidea: Nematoda), a new species of hookworms from Alaskan bears. Canadian Journal of Zoology 46: 1113–1117. ———, AND E. T. LYONS. 1965. Life cycle of Uncinaria lucasi Stiles, 1901 (Nematoda: Ancylostomatidae) of fur seals, Callorhinus ursinus

Linn., on the Pribilof Islands, Alaska. Journal of Parasitology 51: 689–700. POULIN, R. 2007. Are there general laws in parasite ecology? Parasitology 134: 763–776. ———, AND S. MORAND. 2000. Testes size, body size and male–male competition in acanthocephalan parasites. Journal of Zoology of London 250: 551–558. R CORE TEAM. 2013. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. ISBN 3-900051-07-0. Available at: http://www.R-project. org/. RAMOS, P., M. LYNCH, M. HU, J. P. Y. ARNOULD, R. NORMAN, AND I. BEVERIDGE. 2013. Morphometric and molecular characterization of the species of Uncinaria Frolich, 1789 (Nematoda) parasitic in the ¨ Australian fur seal Arctocephalus pusillus doriferus (Schreber), with notes on hookworms in three other pinniped hosts. Systematic Parasitology 85: 65–78. RAUSCH, R. L. 1961. Notes on the black bear, Ursus americanus Pallas, in Alaska, with particular reference to dentition and growth. Zeitschrift fur ¨ Saugetierkunde 26: 77–107. ———, A. V. KRECHMAR, AND V. R. RAUSCH. 1979. New records of helminths from the brown bear, Ursus arctos L., in the Soviet Far East. Canadian Journal of Zoology 57: 1238–1243. SHAFER, A. B. A., C. I. CULLINGHAM, S. D. COˆ TE´ , AND D. W. COLTMAN. 2010. Of glaciers and refugia: A decade of study sheds new light on the phylogeography of northwestern North America. Molecular Ecology 19: 4589–4621. SHIELDS, G. F., AND T. D. KOCHER. 1991. Phylogenetic relationships of North American ursids based on analysis of mitochondrial DNA. Evolution 45: 218–221. SKORPING, A., A. F. READ, AND A. E. KEYMER. 1991. Life history covariation in intestinal nematodes of mammals. Oikos 60: 365–372. SPRAKER, T. R., R. L. DELONG, E. T. LYONS, AND S. R. MELIN. 2007. Hookworm enteritis with bacteremia in California sea lion pups on San Miguel Island. Journal of Wildlife Diseases 43: 179–188. ———, E. T. LYONS, R. L. DELONG, AND R. R. ZINK. 2004. Penetration of the small intestine of a California sea lion (Zalophus californianus) pup by adult hookworms (Uncinaria spp.). Parasitology Research 92: 436–438. SWOFFORD, D. L. 1998. PAUP*. Phylogenetic analysis using parsimony (*and other methods). Sinauer Associates, Sunderland, Massachusetts, 143 p. WAITS, L. P., S. L. TALBOT, R. H. WARD, AND G. F. SHIELDS. 1998. Mitochondrial DNA phylogeography of the North American brown bear and implications for conservation. Conservation Biology 12: 408–417. WALKER, M. J., AND D. E. JACOBS. 1982. Epidemiology of Uncinaria stenocephala infections in greyhound breeding kennels. Veterinary Parasitology 10: 317–321. ———, AND ———. 1985. Pathophysiology of Uncinaria stenocephala infections of dogs. Veterinary Annual 25: 263–271. WESLEY-HUNT, G. D., AND J. J. FLYNN. 2005. Phylogeny of the Carnivora: Basal relationships among the Carnivoramorphans, and assessment of the position of ‘‘Miacoidea’’ relative to Carnivora. Journal of Systematic Paleontology 3: 1–28. ¨ , L. M., V. HAUKISALMI, S. VARIS, J. HANTULA, V. B. FEDOROV, WICKSTROM AND H. HENTTONEN. 2003. Phylogeography of the circumpolar Paranoplocephala arctica species complex (Cestoda: Anoplocephalidae) parasitizing collared lemmings (Dicrostonyx spp.). Molecular Ecology 12: 3359–3371. WOLFGANG, R. W. 1956. Dochmoides yukonensis sp. nov. from the brown bear (Ursus americanus) in the Yukon. Canadian Journal of Zoology 34: 21–27.