Pathology (February 2015) 47(2), pp. 156–160
MICROBIOLOGY
Molecular surveillance for carbapenemase genes in carbapenemresistant Pseudomonas aeruginosa in Australian patients with cystic fibrosis ANNA S. TAI1,2,3, TIMOTHY J. KIDD1, DAVID M. WHILEY1, KAY A. RAMSAY1,3, CAMERON BUCKLEY1 AND SCOTT C. BELL1,2,3, FOR THE ACPINCF INVESTIGATOR GROUP 1Queensland Children’s Medical Research Institute, The University of Queensland, Royal Children’s Hospital, Herston, 2Adult Cystic Fibrosis Centre, Department of Thoracic Medicine, The Prince Charles Hospital, Chermside, and 3School of Medicine, The University of Queensland, Brisbane, Qld, Australia
Summary The aim of this study was to assess the prevalence of acquired carbapenemase genes amongst carbapenem non-susceptible Pseudomonas aeruginosa isolates in Australian patients with cystic fibrosis (CF). Cross-sectional molecular surveillance for acquired carbapenemase genes was performed on CF P. aeruginosa isolates from two isolate banks comprising: (i) 662 carbapenem resistant P. aeruginosa isolates from 227 patients attending 10 geographically diverse Australian CF centres (2007–2009), and (ii) 519 P. aeruginosa isolates from a cohort of 173 adult patients attending one Queensland CF clinic in 2011. All 1189 P. aeruginosa isolates were tested by polymerase chain reaction (PCR) protocols targeting ten common carbapenemase genes, as well the Class 1 integron intI1 gene and the aadB aminoglycoside resistance gene. No carbapenemase genes were identified among all isolates tested. The intI1 and aadB genes were frequently detected and were significantly associated with the AUST-02 strain (OR 24.6, 95% CI 9.3–65.6; p < 0.0001) predominantly from Queensland patients. Despite the high prevalence of carbapenem resistance in P. aeruginosa in Australian patients with CF, no acquired carbapenemase genes were detected in the study, suggesting chromosomal mutations remain the key resistance mechanism in CF isolates. Systematic surveillance for carbapenemase-producing P. aeruginosa in CF by molecular surveillance is ongoing. Key words: Carbapenemase, cystic fibrosis, integron, metallo-b-lactamase (MBL), Pseudomonas aeruginosa, real-time PCR. Received 17 August, revised 29 October, accepted 7 November 2014
INTRODUCTION Pseudomonas aeruginosa is an important opportunistic human pathogen causing severe infections in immunocompromised patients with burns, wounds and cancer. It is also the major cause of chronic airway infection in patients with cystic fibrosis (CF) and is associated with substantial morbidity and mortality. Pseudomonas aeruginosa is a significant therapeutic challenge due to its high level of intrinsic resistance and propensity to develop resistance via chromosomal mutations or the acquisition of resistance genes.1 Multidrug resistant (MDR) P. aeruginosa Print ISSN 0031-3025/Online ISSN 1465-3931 DOI: 10.1097/PAT.0000000000000216
#
carrying acquired carbapenemase genes (e.g., blaVIM, blaIMP, blaAIM, blaKPC, blaNDM) have been reported in nosocomial outbreaks, including in Australia, and have been associated with substantial morbidity and mortality.2–9 Carbapenemases are b-lactamases which can hydrolyse carbapenem antibiotics resulting in resistance to nearly all b-lactams including meropenem and imipenem.10 Carbapenemase genes are often co-located with other resistance genes on mobile genetic elements, in particular class 1 integron (intI), which facilitate horizontal gene exchange within and between bacterial species, leading to the dissemination of multidrug resistance.10 In addition, clonal expansion of certain ‘high-risk’ P. aeruginosa clonal clusters (e.g., CC235, CC111) have been recognised to play an important role in the dissemination of carbapenemase genes in both local nosocomial outbreaks and international spread and have been associated with substantial morbidity and mortality.11–13 In routine laboratory practice, antimicrobial resistance is commonly observed in P. aeruginosa isolates collected from chronically infected patients with CF.14,15 Whilst resistance in CF P. aeruginosa is commonly facilitated by chromosomal mutations from recurrent antimicrobial exposure, carbapenemase-producing P. aeruginosa strains have recently been described in CF.16–19 Early detection is critical in effective infection control measures to prevent the spread of carbapenemase-producing P. aeruginosa. However, to date, no consensus guidelines exist on carbapenemase screening in clinical P. aeruginosa isolates and systematic carbapenemase surveillance is not routinely performed.20 Currently, 80% of Australian patients with CF are infected with P. aeruginosa and 60% harbour shared strains.21 The two predominant CF strains, AUST-01 and AUST-02, demonstrate increased resistance to b-lactam antibiotics including carbapenems and aminoglycoside but the resistance mechanism is unclear.22,23 Whilst an acquired aminoglycoside resistance gene (aadB) associated with a class 1 integron has been identified in a subset of AUST-02,24 the mechanism for carbapenem resistance is unknown. No previous study has been performed to assess the prevalence of acquired carbapenemase genes amongst P. aeruginosa from Australian patients with CF. Therefore, this study aims to assess the prevalence of acquired carbapenemase genes in a representative collection of carbapenem resistant (CPMR) P. aeruginosa from Australian patients with CF.
2015 Royal College of Pathologists of Australasia
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
CARBAPENEMASE SCREEN IN CF P. AERUGINOSA
Table 1
157
Carbapenem resistant Pseudomonas aeruginosa isolates from ACPinCF
State/Centre code NSW/02 NSW/04 VIC/02 VIC/03 QLD/02 QLD/04 QLD/05 SA/01 WA/01 TAS/01 Total
Total patient population
No. ACPinCF Study patients
No. ACPinCF Study patients with P. aeruginosa
237 57 270 72 211 56 50 139 145 39 1276
160 21 130 53 211 41 16 74 102 28 836
113 20 124 39 171 38 15 72 92 25 709
No. ACPinCF Study patients with CPMR P. aeruginosa (%) 23 11 51 17 48 13 8 21 28 7 227
No. confirmed P. aeruginosa isolates available for testing
(20%) (55%) (41%) (44%) (28.1%) (34%) (53%) (29%) (30%) (28%) (32%)
64 30 144 51 143 38 24 63 84 21 662
Geographic location of each cystic fibrosis (CF) centre by Australian State: NSW, New South Wales; QLD, Queensland; SA, South Australia; TAS, Tasmania; VIC, Victoria; WA, Western Australia.
MATERIALS AND METHODS Patients and bacterial strains This study originated from a national multi-centre study of P. aeruginosa infection performed in Australian CF Centres [Australian Clonal P. aeruginosa in CF (ACPinCF) Study; NHMRC Project Grant 455919] and was approved by the Human Research Ethics Committee at each of the participating centres and The University of Queensland Medical Research Ethics Committee.21 Briefly, patients provided an expectorated sputum specimen during a clinic visit or hospitalisation. Sputum cultures and disk diffusion susceptibility testing of the P. aeruginosa isolates were performed by the hospital laboratories using standard techniques.25 Three P. aeruginosa colonies representing different morphotypes were selected and transported to the research laboratory and were stored at 808C prior to testing. The study isolates comprised two groups. The first isolate group included ACPinCF participants attending 10 adult CF centres between 2007 and 2008 who had at least one carbapenem resistant (CPMR) P. aeruginosa (i.e., nonsusceptible to either meropenem or imipenem) in the baseline sputum. Of 836 recruited patients, 709 (84.8%) had P. aeruginosa isolated from their baseline sputum and susceptibility data were reviewed (Table 1). Overall, 227/709 patients (32%) had at least one CPMR P. aeruginosa isolate at baseline and all three baseline isolates were included. The second group was a collection of 519 P. aeruginosa isolates from an adult CF cohort (173 patients) attending a Queensland Adult CF Centre (QLD/02) in 2011. Bacterial control strains Three MBL-producing P. aeruginosa positive controls [UNISI-GiaM00 (VIM1), UNISI-SanD99 (VIM-2) and UNISI-OBG6_1 (IMP-13)] cultured from patients with CF were included, courtesy of Professor Gianni Rossolini and Table 2
Dr Simona Pollini (Universita` di Siena, Siena, Italy). A VIM-4 producing P. aeruginosa isolate from a non-CF clinical source and DNA controls for blaOXA-48 and blaGES were kindly provided by Professor David Paterson and Dr Hanna Sidjabat (University of Queensland Clinical Centre of Research, Brisbane, Australia). DNA controls for the blaNDM, blaKPC and blaSHV genes were kindly provided by Jeanette Pham, Thanh Thien Nguyen and Ian Carter (South Eastern Area Laboratory Service, Prince of Wales Hospital, Sydney, Australia). A characterised P. aeruginosa isolate from a previous study was used as the Int1 and aadB positive control.24 We were unable to obtain a control isolate with the blaAIM gene; therefore, an AIM ‘Uni-Control’ reaction was developed to act as the positive control for the AIM PCR based on previously described methodology.26 Template bacterial DNA preparation and pooling Pseudomonas aeruginosa isolates were prepared for PCR using a simple heatdenaturation process as previously described.27 Briefly, overnight aerobic cultures grown on Mueller-Hinton agar at 378C were suspended in sterile water to an equivalent 1.0 McFarland turbidity standard, boiled for 15 min and stored at 808C. Heat-denatured isolates were then pooled for PCR testing, comprising 10 isolates per pool; pools were prepared by adding 5 mL of each heat-denatured preparation from 10 consecutive isolates to a sterile 1.5 mL tube followed by vortexing. PCR amplification Each DNA pool was initially subjected to real-time (RT-PCR) screening for intI1 and carbapenemase genes (including blaIMP, blaVIM, blaNDM, blaAIM, blaGES, blaKPC and blaOXA) using validated primer sets (Table 2). All pools providing positive PCR results were then tested individually with the same assay to detect PCR positive individual isolates. All isolates providing
PCR primers used in this study
Target gene
Forward sequence (5’-3’)
Reverse sequence (5’-3’)
Reference
intI1 blaVIM blaVIM blaVIM blaIMP blaIMP blaIMP blaNDM blaAIM blaOXA blaKPC blaSHV blaGES oprL aadB
ATCATCGTCGTAGAGACGTCGG GATGGTGTTGGTCGCATA AAAGTTATGCCGCACTCACC TTTGGTCGCATATCGCAACG GGTTATGTTCATACWTCG CTACCGCAGCAGAGTCTTTG GGAATAGAGTGGCTTAAYTCTC GGTTTGGCGATCTGGTTTTC CTGAAGGTGTACGGAAACAC TGTTTTTGGTGGCATCGAT CGTCTAGTTCTGCTGTCTTG ATGCGTTATATTCACCTGTG GCTTCATTCACGCACTATT ATGGAAATGCTGAAATTCGGC CACAACGCAGGTCACATTG
GCCTTGATGTTACCCGAGAG CGAATGCGCAGCACCAC TGCAACTTCATGTTATGCCG CCATTCAGCCAGATCGGCAT GGTTTAAYAAAACAACCAC AACCAGTTTTGCCTTACCAT GGTTTAAYAAAACAACCACC CGGAATGGCTCATCACGATC GTTCGGCCACCTCGAATTG GTAAMRATGCTTGGTTCGC CTTGTCATCCTTGTTAGGCG TGCTTTGTTATTCGGGCCAA CGATGCTAGAAACCGCTT CTTCTTCAGCTCGACGCGACG GCCTCCGCGATTTCATACGC
31 32 33 34 34 35 32 36 36 37 36 34 38 39 22
Genes screened include: carbapenemases blaIMP, blaVIM, blaNDM, blaAIM, blaKPC, blaSHV, blaOXA, blaGES; Class 1 integron gene intI1; the aminoglycoside resistance gene aadB; and the house keeping gene oprL.
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
158 Table 3
TAI et al.
Pathology (2015), 47(2), February
Distribution of intI1 and aadB positive Pseudomonas aeruginosa isolates
State/Centre code NSW/02 NSW/04 VIC/02 VIC/03 QLD/02 QLD/04 QLD/05 SA/01 WA/01 TAS/01 Total
No. isolates tested
No. int1þ isolates, %
No. Int1/aadBþ isolates, strain type/s (no.)
64 30 144 51 143 38 24 63 84 21 662
0 1, 3.3% 2, 1.4% 1, 1.9% 22, 15.3% 4, 10% 9, 37.5% 0 0 0 39, 5.8%
0 1, AUST-02 (1) 1, AUST-01 (1) 0 16 (11.2%); AUST-01 (1), AUST-02 (12), AUST-13 (1), Unique (2) 4, AUST-02 (4) 9, AUST-02 (9) 0 0 0 31, AUST-01 (2); AUST-02 (26); AUST-13 (1); Unique (2)
Carbapenemase genes screened include: blaIMP, blaVIM, blaNDM, blaAIM, blaKPC, blaSHV, blaOXA, blaGES. Geographic location of each cystic fibrosis (CF) centre by Australian State: NSW, New South Wales; QLD, Queensland; SA, South Australia; TAS, Tasmania; VIC, Victoria; WA, Western Australia. positive results for intI1 were also screened for aadB given the previously reported association.24 Each PCR reaction mix contained 10.0 mL of 2X QuantiTect SYBR Green PCR mix (Qiagen, Australia), 0.5 mM of forward and reverse primers for each gene of interest (Table 2), 2.0 mL of isolate preparation, pool or control and were made up to a total volume of 20.0 mL with DNase-free water. Cycling was performed on a Rotor-Gene Q instrument (Qiagen) using the following cycling conditions: an initial enzyme activation step at 958C for 15 min, followed by 45 cycles of denaturation at 958C for 15 s, annealing at 508C for 30 s and extension at 728C for 60 s. Melting curve analysis was performed following PCR amplification whereby reaction mixes were continuously analysed from 608C to 958C, with temperature increments of 0.58C per s. PCR reactions were defined as positive where the melting temperature was consistent with the positive control and the cycle threshold (CT) value was less than or equal to 30 cycles. Reactions providing positive results were also subject to 1.5% agarose gel electrophoresis to ensure the PCR products were of the expected size. Validation of DNA pooling approach To assess the validity of the pooling approach for screening using these PCRbased assays, 150 isolates from 50 patients attending CF centre QLD/02 [comprising 143 isolates included in carbapenemase screening (Table 3) and seven additional CF P. aeruginosa isolates collected after 2008] were subjected to intI1 PCR screening both individually and in pools of 10 (n ¼ 15 pools), and the results compared. The intI1 marker was selected for this testing as it is known to be common in isolates of patients attending the QLD/02 clinic.24 Association between acquired resistance mechanisms and P. aeruginosa genotype The association between the PCR results and genotype for each isolate was assessed using previously published enterobacterial repetitive intergenic consensus (ERIC)-PCR genotyping data from the ACPinCF Study.21 Statistical analysis Qualitative variables were compared using the Yates Chi-square analysis, and odds ratios (OR) and 95% confidence intervals (CI) were calculated.
RESULTS RT-PCR screen for intI1, carbapenemase and aadB genes Overall, 39 of 662 isolates (5.9%) tested positive for intI1; however, the entire collection was negative for all 12 carbapenemase genes tested for by the PCR assays. Of the 39 intI1 positive isolates, 31 (79%) contained the aadB gene (Table 3), of which 26 isolates (84%) were AUST-02. Review of the ACPinCF database demonstrated that of the 662 isolates screened, 136 (21%) were AUST-02, of which 85 (62.5%) were from Queensland. The aadB gene was statistically more likely to be associated with AUST-02 (26/136 AUST-02; 19.1%) than non-AUST-02 (5/526 non-AUST-02; 1.0%) (OR 24.6; 95%CI 9.3–65.6; p < 0.0001) isolates. In particular,
Queensland AUST-02 isolates (25/85; 29%) were significantly more likely than AUST-02 from other states (1/52; 5.8%) to harbour the aadb gene (OR 20.8; 95%CI 2.7–159.2; p < 0.0001). Follow up RT-PCR screening of 519 P. aeruginosa isolates collected from 173 ACPinCF participants attending a major Queensland adult CF centre (QLD/02) in 2011 demonstrated 61 isolates (11.7%) to be intI1 positive, of which 49 harboured aadB. Again, no carbapenemase genes were identified. There was no statistically significant difference in the rate of aadB positive P. aeruginosa in 2011 (49/519; 9.4%) when compared to 2007 (16/143; 11.2%) at QLD/02 (OR 0.8; 95% CI 0.5–1.5; p ¼ 0.6). Validation of pooled DNA PCR screening approach Of the 150 P. aeruginosa isolates collected from centre QLD/ 02, 22 isolates were intI1 positive and 128 were negative using both the pooling approach and the individual PCR screening.
DISCUSSION This is the first systematic molecular surveillance study investigating the presence of carbapenemase genes in CF P. aeruginosa isolates collected from Australian adult CF centres. This study comprised approximately 55% of the Australian CF population infected with P. aeruginosa,21 and no P. aeruginosa strains harbouring acquired carbapenemase genes were identified. This finding suggests carbapenem resistance observed amongst Australian CF P. aeruginosa is predominantly chromosomally-mediated leading to the derepression of multidrug efflux pump, overexpression of cephalosporinase AmpC and outer-membrane impermeability as observed by other authors.16,28 As previously observed, class 1 integron int1 and acquired aadB genes were identified in a subset of predominantly Queensland AUST-02 isolates.24 Given the potential public health significance of carbapenemase-producing organisms, reliable and efficient screening methodologies are needed to enable early detection and implementation of infection control measures.10,29 Incursion of an endemic MBL-producing P. aeruginosa strain from a non-CF source into a paediatric patient with CF, resulting in eradication failure and the establishment of chronic infection has been reported.17 Likewise, chronic infections arising from person-toperson transmission of a mucoid MBL-producing P. aeruginosa strain between patients with chronic obstructive airways disease and non-CF bronchiectasis has also been described.30
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
CARBAPENEMASE SCREEN IN CF P. AERUGINOSA
Patients with chronic airway infection with MBL-producing P. aeruginosa strains therefore are potential chronic reservoirs. CF P. aeruginosa strains have been shown to remain viable in cough aerosols up to 45 min and could travel up to at least 4 metres, highlighting the potential risk of airborne transmission.31 Such infection risk is potentially increased during hospitalisation where viable aerosol P. aeruginosa burden is heightened as a result of illness, chest physiotherapy and nebuliser use. Furthermore, patients with CF often require frequent and prolonged hospitalisations, posing additional risk for nosocomial dissemination. Systematic MBL surveillance therefore is required for early detection of MBL-producing P. aeruginosa strains in CF and facilitate strict inpatient and outpatient infection control measures including contact and droplet precautions. Furthermore, a systematic approach to understanding other mechanisms of resistance in CF derived P. aeruginosa strains are now being undertaken in our laboratory. However, there are numerous challenges in implementing such a strategy in the context of CF microbiology. These challenges include: (a) lack of consensus guidelines for carbapenemase screening for CF P. aeruginosa in terms of methodology, selection criteria for isolates, and screening frequency; (b) typically more than half of CF P. aeruginosa isolates in our clinics are carbapenem resistant, limiting the utility of using carbapenem susceptibility to reduce testing numbers by exclusion of susceptible strains; (c) established phenotypic tests (including the Modified Hodge test, MBL Etest and EDTA based combined disc or double disc synergy tests) have suboptimal specificity when applied to P. aeruginosa, in particular CF isolates,32,33 however studies of the newer chromogenic assay, the CarbaNP test, are promising and demonstrate superior sensitivity and specificity for carbapenemase detection in P. aeruginosa compared with other conventional phenotypic methods;34,35 (d) MBL-harbouring P. aeruginosa that are carbapenem ‘susceptible’ have also been reported from patients with CF, hence a susceptibility screen may also lead to falsenegative results;17 and (e) molecular screening by PCR requires the use of numerous assays, which through their targeted nature may also be susceptible to false-negative results where new or variant carbapenemase genes are involved. In this study we examined the use of an isolate pooling approach for PCR-based screening. While it does not address all of the above challenges, it provides us with a simple means of screening for recognised carbapenemase genes in our patients and is now being implemented for ongoing surveillance. We are currently looking at multiplex PCR strategies to further improve throughput and reduce testing costs. Acknowledgements: This work was funded by The Prince Charles Hospital Foundation (Novice Researcher Project Grant NR2012-128 to Anna Tai), National Health and Medical Research Council [Post-graduate Medical and Dental Scholarship APP1017517 to Anna Tai; Early Career Fellowship (APP1054129) to DMW; Project Grant (455919) to SCB]; Queensland Children’s Medical Research Institute [Early Career Fellowship to DMW (50024)], Queensland Health Office of Health and Medical Research [Health Fellowship to SCB (QCOS013795)]. We wish to express our gratitude to Professor Gianni Rossolini and Dr Simona Pollini (Universita` di Siena, Siena, Italy), Dr Hanna Sidjabat and Professor David Paterson (University of Queensland Clinical Centre of Research, Brisbane, Australia), Jeanette Pham, Thanh Thien Nguyen and Ian Carter (South Eastern Area Laboratory
159
Service, Prince of Wales Hospital) for kindly providing the MBL-producing P. aeruginosa strains and DNA positive controls. We also wish to sincerely thank the staff and patients from the following participating sites in the ACPinCF study: Royal Prince Alfred Hospital Cystic Fibrosis Clinic, Sydney; John Hunter Adult Cystic Fibrosis Clinic, Newcastle; The Alfred Hospital Cystic Fibrosis Service, Melbourne; Monash Medical Centre Cystic Fibrosis Unit, Melbourne; The Prince Charles Hospital Adult Cystic Fibrosis Centre, Brisbane; Mater Adult Cystic Fibrosis Unit, Brisbane; Gold Coast Hospital Adult Cystic Fibrosis Centre, Southport; The Royal Adelaide Hospital Cystic Fibrosis Program, Adelaide; Sir Charles Gairdner Hospital Cystic Fibrosis and Bronchiectasis Unit, Perth; Tasmanian Adult Cystic Fibrosis Unit; Hobart. Conflicts of interest and sources of funding: The authors state that there are no conflicts of interest to disclose. Address for correspondence: Dr Anna Sze Tai, Queensland Children’s Medical Research Institute, University of Queensland, Brisbane, Qld 4029, Australia. E-mail: [email protected]
References 1. Poole K. Pseudomonas aeruginosa: resistance to the max. Front Microbiol 2011; 2: 65. 2. Yong D, Toleman MA, Bell J, et al. Genetic and biochemical characterization an acquired subgroup B3 metallo-beta-lactamase gene, blaAIM-1, and its unique genetic context in Pseudomonas aeruginosa from Australia. Antimicrob Agents Chemother 2012; 56: 6154–9. 3. Carattoli A, Fortini D, Galetti R, et al. Isolation of NDM-1-producing Pseudomonas aeruginosa sequence type ST235 from a stem cell transplant patient in Italy, May 2013. Euro Surveill 2013; 18: 20633. 4. Rieber H, Frontzek A, von Baum H, et al. Emergence of metallo-beta-lactamases GIM-1 and VIM in multidrug-resistant Pseudomonas aeruginosa in North Rhine-Westphalia, Germany. J Antimicrob Chemother 2012; 67: 1043–5. 5. Herbert S, Halvorsen DS, Leong T, et al. Large outbreak of infection and colonization with gram-negative pathogens carrying the metallo-betalactamase gene blaIMP-4 at a 320-bed tertiary hospital in Australia. Infect Control Hosp Epidemiol 2007; 28: 98–101. 6. Zavascki AP, Gaspareto PB, Martins AF, et al. Outbreak of carbapenemresistant Pseudomonas aeruginosa producing SPM-1 metallo-{beta}-lactamase in a teaching hospital in southern Brazil. J Antimicrob Chemother 2005; 56: 1148–51. 7. Poirel L, Nordmann P, Lagrutta E, et al. Emergence of KPC-producing Pseudomonas aeruginosa in the United States. Antimicrob Agents Chemother 2010; 54: 3072. 8. Laupland KB, Parkins MD, Church DL, et al. Population-based epidemiological study of infections caused by carbapenem-resistant Pseudomonas aeruginosa in the Calgary Health Region: importance of metallo-betalactamase (MBL)-producing strains. J Infect Dis 2005; 192: 1606–12. 9. Peleg AY, Franklin C, Bell JM, et al. Dissemination of the metallo-betalactamase gene blaIMP-4 among gram-negative pathogens in a clinical setting in Australia. Clin Infect Dis 2005; 41: 1549–56. 10. Walsh TR, Toleman MA, Poirel L, et al. Metallo-beta-lactamases: the quiet before the storm? Clin Microbiol Rev 2005; 18: 306–25. 11. Woodford N, Turton JF, Livermore DM. Multiresistant Gram-negative bacteria: the role of high-risk clones in the dissemination of antibiotic resistance. FEMS Microbiol Rev 2011; 35: 736–55. 12. Kim MJ, Bae IK, Jeong SH, et al. Dissemination of metallo-beta-lactamase-producing Pseudomonas aeruginosa of sequence type 235 in Asian countries. J Antimicrob Chemother 2013; 68: 2820–4. 13. Edelstein MV, Skleenova EN, Shevchenko OV, et al. Spread of extensively resistant VIM-2-positive ST235 Pseudomonas aeruginosa in Belarus, Kazakhstan, and Russia: a longitudinal epidemiological and clinical study. Lancet Infect Dis 2013; 13: 867–76. 14. Emerson J, McNamara S, Buccat AM, et al. Changes in cystic fibrosis sputum microbiology in the United States between 1995 and 2008. Pediatr Pulmonol 2010; 45: 363–70. 15. Valenza G, Tappe D, Turnwald D, et al. Prevalence and antimicrobial susceptibility of microorganisms isolated from sputa of patients with cystic fibrosis. J Cystic Fibrosis 2008; 7: 123–7. 16. Henrichfreise B, Wiegand I, Pfister W, et al. Resistance mechanisms of multiresistant Pseudomonas aeruginosa strains from Germany and correlation with hypermutation. Antimicrob Agents Chemother 2007; 51: 4062–70.
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
160
TAI et al.
17. Pollini S, Fiscarelli E, Mugnaioli C, et al. Pseudomonas aeruginosa infection in cystic fibrosis caused by an epidemic metallo-beta-lactamase-producing clone with a heterogeneous carbapenem resistance phenotype. Clin Microbiol Infect 2011; 17: 1272–5. 18. Perez LR, Antunes AL, Freitas AL, et al. When the resistance gets clingy: Pseudomonas aeruginosa harboring metallo-beta-lactamase gene shows high ability to produce biofilm. Eur J Clin Microbiol Infect Dis 2012; 31: 711–4. 19. Cardoso O, Alves AF, Leitao R. Metallo-beta-lactamase VIM-2 in Pseudomonas aeruginosa isolates from a cystic fibrosis patient. Int J Antimicrob Agents 2008; 31: 375–9. 20. Leung GH, Gray TJ, Cheong EY, et al. Persistence of related bla-IMP-4 metallo-beta-lactamase producing Enterobacteriaceae from clinical and environmental specimens within a burns unit in Australia – a six-year retrospective study. Antimicrob Resist Infect Control 2013; 2: 35. 21. Kidd TJ, Ramsay KA, Hu H, et al. Shared Pseudomonas aeruginosa genotypes are common in Australian cystic fibrosis centres. Eur Respir J 2013; 41: 1091–100. 22. Armstrong DS, Nixon GM, Carzino R, et al. Detection of a widespread clone of Pseudomonas aeruginosa in a pediatric cystic fibrosis clinic. Am J Respir Crit Care Med 2002; 166: 983–7. 23. O’Carroll MR, Syrmis MW, Wainwright CE, et al. Clonal strains of Pseudomonas aeruginosa in paediatric and adult cystic fibrosis units. Eur Respir J 2004; 24: 101–6. 24. Syrmis M, Bell S, Bye P, et al. High prevalence of a class 1 integronassociated aadB gene cassette in Pseudomonas aeruginosa isolates from an Australian cystic fibrosis patient population. Pathology 2008; 40: 524–5. 25. CLSI. Performance Standards for Antimicrobial Susceptibiltiy Testing; 17th Informational Supplement. CLSI document M100-S17. Wayne PA: Clinical and Laboratory Standards Institute; 2007.
Pathology (2015), 47(2), February
26. Whiley DM, Faux CE, Bialasiewicz S, et al. A simple approach for preparing real-time PCR positive reaction controls for rare or emerging viruses. J Clin Virol 2010; 48: 193–7. 27. Anuj SN, Whiley DM, Kidd TJ, et al. Rapid single-nucleotide polymorphism-based identification of clonal Pseudomonas aeruginosa isolates from patients with cystic fibrosis by the use of real-time and high-resolution melting curve analysis. Clin Microbiol Infect 2011; 17: 1403–8. 28. Oliver A, Canton R, Campo P, et al. High frequency of hypermutable Pseudomonas aeruginosa in cystic fibrosis lung infection. Science 2000; 288: 1251–4. 29. Cornaglia G, Akova M, Amicosante G, et al. Metallo-beta-lactamases as emerging resistance determinants in Gram-negative pathogens: open issues. Int J Antimicrob Agents 2007; 29: 380–8. 30. Juan C, Gutierrez O, Renom F, et al. Chronic respiratory infections by mucoid carbapenemase-producing Pseudomonas aeruginosa strains, a new potential public health problem. Antimicrob Agents Chemother 2008; 52: 2285–6. 31. Knibbs LD, Johnson GR, Kidd TJ, et al. Viability of Pseudomonas aeruginosa in cough aerosols generated by persons with cystic fibrosis. Thorax 2014; 69: 740–5. 32. Samuelsen O, Buaro L, Giske CG, et al. Evaluation of phenotypic tests for the detection of metallo-beta-lactamase-producing Pseudomonas aeruginosa in a low country. J Antimicrob Chemother 2008; 61: 827–30. 33. Berges L, Rodriguez-Villalobos H, Deplano A, et al. Prospective evaluation of imipenem/EDTA combined disc and Etest for detection of metallo-betalactamase-producing Pseudomonas aeruginosa. J Antimicrob Chemother 2007; 59: 812–3. 34. Dortet L, Poirel L, Nordmann P. Rapid detection of carbapenemaseproducing Pseudomonas spp. J Clin Microbiol 2012; 50: 3773–6. 35. Dortet L, Poirel L, Nordmann P. Further proofs of concept for the Carba NP test. Antimicrob Agents Chemother 2014; 58: 1269.
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
MICROBIOLOGY
Molecular surveillance for carbapenemase genes in carbapenemresistant Pseudomonas aeruginosa in Australian patients with cystic fibrosis ANNA S. TAI1,2,3, TIMOTHY J. KIDD1, DAVID M. WHILEY1, KAY A. RAMSAY1,3, CAMERON BUCKLEY1 AND SCOTT C. BELL1,2,3, FOR THE ACPINCF INVESTIGATOR GROUP 1Queensland Children’s Medical Research Institute, The University of Queensland, Royal Children’s Hospital, Herston, 2Adult Cystic Fibrosis Centre, Department of Thoracic Medicine, The Prince Charles Hospital, Chermside, and 3School of Medicine, The University of Queensland, Brisbane, Qld, Australia
Summary The aim of this study was to assess the prevalence of acquired carbapenemase genes amongst carbapenem non-susceptible Pseudomonas aeruginosa isolates in Australian patients with cystic fibrosis (CF). Cross-sectional molecular surveillance for acquired carbapenemase genes was performed on CF P. aeruginosa isolates from two isolate banks comprising: (i) 662 carbapenem resistant P. aeruginosa isolates from 227 patients attending 10 geographically diverse Australian CF centres (2007–2009), and (ii) 519 P. aeruginosa isolates from a cohort of 173 adult patients attending one Queensland CF clinic in 2011. All 1189 P. aeruginosa isolates were tested by polymerase chain reaction (PCR) protocols targeting ten common carbapenemase genes, as well the Class 1 integron intI1 gene and the aadB aminoglycoside resistance gene. No carbapenemase genes were identified among all isolates tested. The intI1 and aadB genes were frequently detected and were significantly associated with the AUST-02 strain (OR 24.6, 95% CI 9.3–65.6; p < 0.0001) predominantly from Queensland patients. Despite the high prevalence of carbapenem resistance in P. aeruginosa in Australian patients with CF, no acquired carbapenemase genes were detected in the study, suggesting chromosomal mutations remain the key resistance mechanism in CF isolates. Systematic surveillance for carbapenemase-producing P. aeruginosa in CF by molecular surveillance is ongoing. Key words: Carbapenemase, cystic fibrosis, integron, metallo-b-lactamase (MBL), Pseudomonas aeruginosa, real-time PCR. Received 17 August, revised 29 October, accepted 7 November 2014
INTRODUCTION Pseudomonas aeruginosa is an important opportunistic human pathogen causing severe infections in immunocompromised patients with burns, wounds and cancer. It is also the major cause of chronic airway infection in patients with cystic fibrosis (CF) and is associated with substantial morbidity and mortality. Pseudomonas aeruginosa is a significant therapeutic challenge due to its high level of intrinsic resistance and propensity to develop resistance via chromosomal mutations or the acquisition of resistance genes.1 Multidrug resistant (MDR) P. aeruginosa Print ISSN 0031-3025/Online ISSN 1465-3931 DOI: 10.1097/PAT.0000000000000216
#
carrying acquired carbapenemase genes (e.g., blaVIM, blaIMP, blaAIM, blaKPC, blaNDM) have been reported in nosocomial outbreaks, including in Australia, and have been associated with substantial morbidity and mortality.2–9 Carbapenemases are b-lactamases which can hydrolyse carbapenem antibiotics resulting in resistance to nearly all b-lactams including meropenem and imipenem.10 Carbapenemase genes are often co-located with other resistance genes on mobile genetic elements, in particular class 1 integron (intI), which facilitate horizontal gene exchange within and between bacterial species, leading to the dissemination of multidrug resistance.10 In addition, clonal expansion of certain ‘high-risk’ P. aeruginosa clonal clusters (e.g., CC235, CC111) have been recognised to play an important role in the dissemination of carbapenemase genes in both local nosocomial outbreaks and international spread and have been associated with substantial morbidity and mortality.11–13 In routine laboratory practice, antimicrobial resistance is commonly observed in P. aeruginosa isolates collected from chronically infected patients with CF.14,15 Whilst resistance in CF P. aeruginosa is commonly facilitated by chromosomal mutations from recurrent antimicrobial exposure, carbapenemase-producing P. aeruginosa strains have recently been described in CF.16–19 Early detection is critical in effective infection control measures to prevent the spread of carbapenemase-producing P. aeruginosa. However, to date, no consensus guidelines exist on carbapenemase screening in clinical P. aeruginosa isolates and systematic carbapenemase surveillance is not routinely performed.20 Currently, 80% of Australian patients with CF are infected with P. aeruginosa and 60% harbour shared strains.21 The two predominant CF strains, AUST-01 and AUST-02, demonstrate increased resistance to b-lactam antibiotics including carbapenems and aminoglycoside but the resistance mechanism is unclear.22,23 Whilst an acquired aminoglycoside resistance gene (aadB) associated with a class 1 integron has been identified in a subset of AUST-02,24 the mechanism for carbapenem resistance is unknown. No previous study has been performed to assess the prevalence of acquired carbapenemase genes amongst P. aeruginosa from Australian patients with CF. Therefore, this study aims to assess the prevalence of acquired carbapenemase genes in a representative collection of carbapenem resistant (CPMR) P. aeruginosa from Australian patients with CF.
2015 Royal College of Pathologists of Australasia
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
CARBAPENEMASE SCREEN IN CF P. AERUGINOSA
Table 1
157
Carbapenem resistant Pseudomonas aeruginosa isolates from ACPinCF
State/Centre code NSW/02 NSW/04 VIC/02 VIC/03 QLD/02 QLD/04 QLD/05 SA/01 WA/01 TAS/01 Total
Total patient population
No. ACPinCF Study patients
No. ACPinCF Study patients with P. aeruginosa
237 57 270 72 211 56 50 139 145 39 1276
160 21 130 53 211 41 16 74 102 28 836
113 20 124 39 171 38 15 72 92 25 709
No. ACPinCF Study patients with CPMR P. aeruginosa (%) 23 11 51 17 48 13 8 21 28 7 227
No. confirmed P. aeruginosa isolates available for testing
(20%) (55%) (41%) (44%) (28.1%) (34%) (53%) (29%) (30%) (28%) (32%)
64 30 144 51 143 38 24 63 84 21 662
Geographic location of each cystic fibrosis (CF) centre by Australian State: NSW, New South Wales; QLD, Queensland; SA, South Australia; TAS, Tasmania; VIC, Victoria; WA, Western Australia.
MATERIALS AND METHODS Patients and bacterial strains This study originated from a national multi-centre study of P. aeruginosa infection performed in Australian CF Centres [Australian Clonal P. aeruginosa in CF (ACPinCF) Study; NHMRC Project Grant 455919] and was approved by the Human Research Ethics Committee at each of the participating centres and The University of Queensland Medical Research Ethics Committee.21 Briefly, patients provided an expectorated sputum specimen during a clinic visit or hospitalisation. Sputum cultures and disk diffusion susceptibility testing of the P. aeruginosa isolates were performed by the hospital laboratories using standard techniques.25 Three P. aeruginosa colonies representing different morphotypes were selected and transported to the research laboratory and were stored at 808C prior to testing. The study isolates comprised two groups. The first isolate group included ACPinCF participants attending 10 adult CF centres between 2007 and 2008 who had at least one carbapenem resistant (CPMR) P. aeruginosa (i.e., nonsusceptible to either meropenem or imipenem) in the baseline sputum. Of 836 recruited patients, 709 (84.8%) had P. aeruginosa isolated from their baseline sputum and susceptibility data were reviewed (Table 1). Overall, 227/709 patients (32%) had at least one CPMR P. aeruginosa isolate at baseline and all three baseline isolates were included. The second group was a collection of 519 P. aeruginosa isolates from an adult CF cohort (173 patients) attending a Queensland Adult CF Centre (QLD/02) in 2011. Bacterial control strains Three MBL-producing P. aeruginosa positive controls [UNISI-GiaM00 (VIM1), UNISI-SanD99 (VIM-2) and UNISI-OBG6_1 (IMP-13)] cultured from patients with CF were included, courtesy of Professor Gianni Rossolini and Table 2
Dr Simona Pollini (Universita` di Siena, Siena, Italy). A VIM-4 producing P. aeruginosa isolate from a non-CF clinical source and DNA controls for blaOXA-48 and blaGES were kindly provided by Professor David Paterson and Dr Hanna Sidjabat (University of Queensland Clinical Centre of Research, Brisbane, Australia). DNA controls for the blaNDM, blaKPC and blaSHV genes were kindly provided by Jeanette Pham, Thanh Thien Nguyen and Ian Carter (South Eastern Area Laboratory Service, Prince of Wales Hospital, Sydney, Australia). A characterised P. aeruginosa isolate from a previous study was used as the Int1 and aadB positive control.24 We were unable to obtain a control isolate with the blaAIM gene; therefore, an AIM ‘Uni-Control’ reaction was developed to act as the positive control for the AIM PCR based on previously described methodology.26 Template bacterial DNA preparation and pooling Pseudomonas aeruginosa isolates were prepared for PCR using a simple heatdenaturation process as previously described.27 Briefly, overnight aerobic cultures grown on Mueller-Hinton agar at 378C were suspended in sterile water to an equivalent 1.0 McFarland turbidity standard, boiled for 15 min and stored at 808C. Heat-denatured isolates were then pooled for PCR testing, comprising 10 isolates per pool; pools were prepared by adding 5 mL of each heat-denatured preparation from 10 consecutive isolates to a sterile 1.5 mL tube followed by vortexing. PCR amplification Each DNA pool was initially subjected to real-time (RT-PCR) screening for intI1 and carbapenemase genes (including blaIMP, blaVIM, blaNDM, blaAIM, blaGES, blaKPC and blaOXA) using validated primer sets (Table 2). All pools providing positive PCR results were then tested individually with the same assay to detect PCR positive individual isolates. All isolates providing
PCR primers used in this study
Target gene
Forward sequence (5’-3’)
Reverse sequence (5’-3’)
Reference
intI1 blaVIM blaVIM blaVIM blaIMP blaIMP blaIMP blaNDM blaAIM blaOXA blaKPC blaSHV blaGES oprL aadB
ATCATCGTCGTAGAGACGTCGG GATGGTGTTGGTCGCATA AAAGTTATGCCGCACTCACC TTTGGTCGCATATCGCAACG GGTTATGTTCATACWTCG CTACCGCAGCAGAGTCTTTG GGAATAGAGTGGCTTAAYTCTC GGTTTGGCGATCTGGTTTTC CTGAAGGTGTACGGAAACAC TGTTTTTGGTGGCATCGAT CGTCTAGTTCTGCTGTCTTG ATGCGTTATATTCACCTGTG GCTTCATTCACGCACTATT ATGGAAATGCTGAAATTCGGC CACAACGCAGGTCACATTG
GCCTTGATGTTACCCGAGAG CGAATGCGCAGCACCAC TGCAACTTCATGTTATGCCG CCATTCAGCCAGATCGGCAT GGTTTAAYAAAACAACCAC AACCAGTTTTGCCTTACCAT GGTTTAAYAAAACAACCACC CGGAATGGCTCATCACGATC GTTCGGCCACCTCGAATTG GTAAMRATGCTTGGTTCGC CTTGTCATCCTTGTTAGGCG TGCTTTGTTATTCGGGCCAA CGATGCTAGAAACCGCTT CTTCTTCAGCTCGACGCGACG GCCTCCGCGATTTCATACGC
31 32 33 34 34 35 32 36 36 37 36 34 38 39 22
Genes screened include: carbapenemases blaIMP, blaVIM, blaNDM, blaAIM, blaKPC, blaSHV, blaOXA, blaGES; Class 1 integron gene intI1; the aminoglycoside resistance gene aadB; and the house keeping gene oprL.
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
158 Table 3
TAI et al.
Pathology (2015), 47(2), February
Distribution of intI1 and aadB positive Pseudomonas aeruginosa isolates
State/Centre code NSW/02 NSW/04 VIC/02 VIC/03 QLD/02 QLD/04 QLD/05 SA/01 WA/01 TAS/01 Total
No. isolates tested
No. int1þ isolates, %
No. Int1/aadBþ isolates, strain type/s (no.)
64 30 144 51 143 38 24 63 84 21 662
0 1, 3.3% 2, 1.4% 1, 1.9% 22, 15.3% 4, 10% 9, 37.5% 0 0 0 39, 5.8%
0 1, AUST-02 (1) 1, AUST-01 (1) 0 16 (11.2%); AUST-01 (1), AUST-02 (12), AUST-13 (1), Unique (2) 4, AUST-02 (4) 9, AUST-02 (9) 0 0 0 31, AUST-01 (2); AUST-02 (26); AUST-13 (1); Unique (2)
Carbapenemase genes screened include: blaIMP, blaVIM, blaNDM, blaAIM, blaKPC, blaSHV, blaOXA, blaGES. Geographic location of each cystic fibrosis (CF) centre by Australian State: NSW, New South Wales; QLD, Queensland; SA, South Australia; TAS, Tasmania; VIC, Victoria; WA, Western Australia. positive results for intI1 were also screened for aadB given the previously reported association.24 Each PCR reaction mix contained 10.0 mL of 2X QuantiTect SYBR Green PCR mix (Qiagen, Australia), 0.5 mM of forward and reverse primers for each gene of interest (Table 2), 2.0 mL of isolate preparation, pool or control and were made up to a total volume of 20.0 mL with DNase-free water. Cycling was performed on a Rotor-Gene Q instrument (Qiagen) using the following cycling conditions: an initial enzyme activation step at 958C for 15 min, followed by 45 cycles of denaturation at 958C for 15 s, annealing at 508C for 30 s and extension at 728C for 60 s. Melting curve analysis was performed following PCR amplification whereby reaction mixes were continuously analysed from 608C to 958C, with temperature increments of 0.58C per s. PCR reactions were defined as positive where the melting temperature was consistent with the positive control and the cycle threshold (CT) value was less than or equal to 30 cycles. Reactions providing positive results were also subject to 1.5% agarose gel electrophoresis to ensure the PCR products were of the expected size. Validation of DNA pooling approach To assess the validity of the pooling approach for screening using these PCRbased assays, 150 isolates from 50 patients attending CF centre QLD/02 [comprising 143 isolates included in carbapenemase screening (Table 3) and seven additional CF P. aeruginosa isolates collected after 2008] were subjected to intI1 PCR screening both individually and in pools of 10 (n ¼ 15 pools), and the results compared. The intI1 marker was selected for this testing as it is known to be common in isolates of patients attending the QLD/02 clinic.24 Association between acquired resistance mechanisms and P. aeruginosa genotype The association between the PCR results and genotype for each isolate was assessed using previously published enterobacterial repetitive intergenic consensus (ERIC)-PCR genotyping data from the ACPinCF Study.21 Statistical analysis Qualitative variables were compared using the Yates Chi-square analysis, and odds ratios (OR) and 95% confidence intervals (CI) were calculated.
RESULTS RT-PCR screen for intI1, carbapenemase and aadB genes Overall, 39 of 662 isolates (5.9%) tested positive for intI1; however, the entire collection was negative for all 12 carbapenemase genes tested for by the PCR assays. Of the 39 intI1 positive isolates, 31 (79%) contained the aadB gene (Table 3), of which 26 isolates (84%) were AUST-02. Review of the ACPinCF database demonstrated that of the 662 isolates screened, 136 (21%) were AUST-02, of which 85 (62.5%) were from Queensland. The aadB gene was statistically more likely to be associated with AUST-02 (26/136 AUST-02; 19.1%) than non-AUST-02 (5/526 non-AUST-02; 1.0%) (OR 24.6; 95%CI 9.3–65.6; p < 0.0001) isolates. In particular,
Queensland AUST-02 isolates (25/85; 29%) were significantly more likely than AUST-02 from other states (1/52; 5.8%) to harbour the aadb gene (OR 20.8; 95%CI 2.7–159.2; p < 0.0001). Follow up RT-PCR screening of 519 P. aeruginosa isolates collected from 173 ACPinCF participants attending a major Queensland adult CF centre (QLD/02) in 2011 demonstrated 61 isolates (11.7%) to be intI1 positive, of which 49 harboured aadB. Again, no carbapenemase genes were identified. There was no statistically significant difference in the rate of aadB positive P. aeruginosa in 2011 (49/519; 9.4%) when compared to 2007 (16/143; 11.2%) at QLD/02 (OR 0.8; 95% CI 0.5–1.5; p ¼ 0.6). Validation of pooled DNA PCR screening approach Of the 150 P. aeruginosa isolates collected from centre QLD/ 02, 22 isolates were intI1 positive and 128 were negative using both the pooling approach and the individual PCR screening.
DISCUSSION This is the first systematic molecular surveillance study investigating the presence of carbapenemase genes in CF P. aeruginosa isolates collected from Australian adult CF centres. This study comprised approximately 55% of the Australian CF population infected with P. aeruginosa,21 and no P. aeruginosa strains harbouring acquired carbapenemase genes were identified. This finding suggests carbapenem resistance observed amongst Australian CF P. aeruginosa is predominantly chromosomally-mediated leading to the derepression of multidrug efflux pump, overexpression of cephalosporinase AmpC and outer-membrane impermeability as observed by other authors.16,28 As previously observed, class 1 integron int1 and acquired aadB genes were identified in a subset of predominantly Queensland AUST-02 isolates.24 Given the potential public health significance of carbapenemase-producing organisms, reliable and efficient screening methodologies are needed to enable early detection and implementation of infection control measures.10,29 Incursion of an endemic MBL-producing P. aeruginosa strain from a non-CF source into a paediatric patient with CF, resulting in eradication failure and the establishment of chronic infection has been reported.17 Likewise, chronic infections arising from person-toperson transmission of a mucoid MBL-producing P. aeruginosa strain between patients with chronic obstructive airways disease and non-CF bronchiectasis has also been described.30
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
CARBAPENEMASE SCREEN IN CF P. AERUGINOSA
Patients with chronic airway infection with MBL-producing P. aeruginosa strains therefore are potential chronic reservoirs. CF P. aeruginosa strains have been shown to remain viable in cough aerosols up to 45 min and could travel up to at least 4 metres, highlighting the potential risk of airborne transmission.31 Such infection risk is potentially increased during hospitalisation where viable aerosol P. aeruginosa burden is heightened as a result of illness, chest physiotherapy and nebuliser use. Furthermore, patients with CF often require frequent and prolonged hospitalisations, posing additional risk for nosocomial dissemination. Systematic MBL surveillance therefore is required for early detection of MBL-producing P. aeruginosa strains in CF and facilitate strict inpatient and outpatient infection control measures including contact and droplet precautions. Furthermore, a systematic approach to understanding other mechanisms of resistance in CF derived P. aeruginosa strains are now being undertaken in our laboratory. However, there are numerous challenges in implementing such a strategy in the context of CF microbiology. These challenges include: (a) lack of consensus guidelines for carbapenemase screening for CF P. aeruginosa in terms of methodology, selection criteria for isolates, and screening frequency; (b) typically more than half of CF P. aeruginosa isolates in our clinics are carbapenem resistant, limiting the utility of using carbapenem susceptibility to reduce testing numbers by exclusion of susceptible strains; (c) established phenotypic tests (including the Modified Hodge test, MBL Etest and EDTA based combined disc or double disc synergy tests) have suboptimal specificity when applied to P. aeruginosa, in particular CF isolates,32,33 however studies of the newer chromogenic assay, the CarbaNP test, are promising and demonstrate superior sensitivity and specificity for carbapenemase detection in P. aeruginosa compared with other conventional phenotypic methods;34,35 (d) MBL-harbouring P. aeruginosa that are carbapenem ‘susceptible’ have also been reported from patients with CF, hence a susceptibility screen may also lead to falsenegative results;17 and (e) molecular screening by PCR requires the use of numerous assays, which through their targeted nature may also be susceptible to false-negative results where new or variant carbapenemase genes are involved. In this study we examined the use of an isolate pooling approach for PCR-based screening. While it does not address all of the above challenges, it provides us with a simple means of screening for recognised carbapenemase genes in our patients and is now being implemented for ongoing surveillance. We are currently looking at multiplex PCR strategies to further improve throughput and reduce testing costs. Acknowledgements: This work was funded by The Prince Charles Hospital Foundation (Novice Researcher Project Grant NR2012-128 to Anna Tai), National Health and Medical Research Council [Post-graduate Medical and Dental Scholarship APP1017517 to Anna Tai; Early Career Fellowship (APP1054129) to DMW; Project Grant (455919) to SCB]; Queensland Children’s Medical Research Institute [Early Career Fellowship to DMW (50024)], Queensland Health Office of Health and Medical Research [Health Fellowship to SCB (QCOS013795)]. We wish to express our gratitude to Professor Gianni Rossolini and Dr Simona Pollini (Universita` di Siena, Siena, Italy), Dr Hanna Sidjabat and Professor David Paterson (University of Queensland Clinical Centre of Research, Brisbane, Australia), Jeanette Pham, Thanh Thien Nguyen and Ian Carter (South Eastern Area Laboratory
159
Service, Prince of Wales Hospital) for kindly providing the MBL-producing P. aeruginosa strains and DNA positive controls. We also wish to sincerely thank the staff and patients from the following participating sites in the ACPinCF study: Royal Prince Alfred Hospital Cystic Fibrosis Clinic, Sydney; John Hunter Adult Cystic Fibrosis Clinic, Newcastle; The Alfred Hospital Cystic Fibrosis Service, Melbourne; Monash Medical Centre Cystic Fibrosis Unit, Melbourne; The Prince Charles Hospital Adult Cystic Fibrosis Centre, Brisbane; Mater Adult Cystic Fibrosis Unit, Brisbane; Gold Coast Hospital Adult Cystic Fibrosis Centre, Southport; The Royal Adelaide Hospital Cystic Fibrosis Program, Adelaide; Sir Charles Gairdner Hospital Cystic Fibrosis and Bronchiectasis Unit, Perth; Tasmanian Adult Cystic Fibrosis Unit; Hobart. Conflicts of interest and sources of funding: The authors state that there are no conflicts of interest to disclose. Address for correspondence: Dr Anna Sze Tai, Queensland Children’s Medical Research Institute, University of Queensland, Brisbane, Qld 4029, Australia. E-mail: [email protected]
References 1. Poole K. Pseudomonas aeruginosa: resistance to the max. Front Microbiol 2011; 2: 65. 2. Yong D, Toleman MA, Bell J, et al. Genetic and biochemical characterization an acquired subgroup B3 metallo-beta-lactamase gene, blaAIM-1, and its unique genetic context in Pseudomonas aeruginosa from Australia. Antimicrob Agents Chemother 2012; 56: 6154–9. 3. Carattoli A, Fortini D, Galetti R, et al. Isolation of NDM-1-producing Pseudomonas aeruginosa sequence type ST235 from a stem cell transplant patient in Italy, May 2013. Euro Surveill 2013; 18: 20633. 4. Rieber H, Frontzek A, von Baum H, et al. Emergence of metallo-beta-lactamases GIM-1 and VIM in multidrug-resistant Pseudomonas aeruginosa in North Rhine-Westphalia, Germany. J Antimicrob Chemother 2012; 67: 1043–5. 5. Herbert S, Halvorsen DS, Leong T, et al. Large outbreak of infection and colonization with gram-negative pathogens carrying the metallo-betalactamase gene blaIMP-4 at a 320-bed tertiary hospital in Australia. Infect Control Hosp Epidemiol 2007; 28: 98–101. 6. Zavascki AP, Gaspareto PB, Martins AF, et al. Outbreak of carbapenemresistant Pseudomonas aeruginosa producing SPM-1 metallo-{beta}-lactamase in a teaching hospital in southern Brazil. J Antimicrob Chemother 2005; 56: 1148–51. 7. Poirel L, Nordmann P, Lagrutta E, et al. Emergence of KPC-producing Pseudomonas aeruginosa in the United States. Antimicrob Agents Chemother 2010; 54: 3072. 8. Laupland KB, Parkins MD, Church DL, et al. Population-based epidemiological study of infections caused by carbapenem-resistant Pseudomonas aeruginosa in the Calgary Health Region: importance of metallo-betalactamase (MBL)-producing strains. J Infect Dis 2005; 192: 1606–12. 9. Peleg AY, Franklin C, Bell JM, et al. Dissemination of the metallo-betalactamase gene blaIMP-4 among gram-negative pathogens in a clinical setting in Australia. Clin Infect Dis 2005; 41: 1549–56. 10. Walsh TR, Toleman MA, Poirel L, et al. Metallo-beta-lactamases: the quiet before the storm? Clin Microbiol Rev 2005; 18: 306–25. 11. Woodford N, Turton JF, Livermore DM. Multiresistant Gram-negative bacteria: the role of high-risk clones in the dissemination of antibiotic resistance. FEMS Microbiol Rev 2011; 35: 736–55. 12. Kim MJ, Bae IK, Jeong SH, et al. Dissemination of metallo-beta-lactamase-producing Pseudomonas aeruginosa of sequence type 235 in Asian countries. J Antimicrob Chemother 2013; 68: 2820–4. 13. Edelstein MV, Skleenova EN, Shevchenko OV, et al. Spread of extensively resistant VIM-2-positive ST235 Pseudomonas aeruginosa in Belarus, Kazakhstan, and Russia: a longitudinal epidemiological and clinical study. Lancet Infect Dis 2013; 13: 867–76. 14. Emerson J, McNamara S, Buccat AM, et al. Changes in cystic fibrosis sputum microbiology in the United States between 1995 and 2008. Pediatr Pulmonol 2010; 45: 363–70. 15. Valenza G, Tappe D, Turnwald D, et al. Prevalence and antimicrobial susceptibility of microorganisms isolated from sputa of patients with cystic fibrosis. J Cystic Fibrosis 2008; 7: 123–7. 16. Henrichfreise B, Wiegand I, Pfister W, et al. Resistance mechanisms of multiresistant Pseudomonas aeruginosa strains from Germany and correlation with hypermutation. Antimicrob Agents Chemother 2007; 51: 4062–70.
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
160
TAI et al.
17. Pollini S, Fiscarelli E, Mugnaioli C, et al. Pseudomonas aeruginosa infection in cystic fibrosis caused by an epidemic metallo-beta-lactamase-producing clone with a heterogeneous carbapenem resistance phenotype. Clin Microbiol Infect 2011; 17: 1272–5. 18. Perez LR, Antunes AL, Freitas AL, et al. When the resistance gets clingy: Pseudomonas aeruginosa harboring metallo-beta-lactamase gene shows high ability to produce biofilm. Eur J Clin Microbiol Infect Dis 2012; 31: 711–4. 19. Cardoso O, Alves AF, Leitao R. Metallo-beta-lactamase VIM-2 in Pseudomonas aeruginosa isolates from a cystic fibrosis patient. Int J Antimicrob Agents 2008; 31: 375–9. 20. Leung GH, Gray TJ, Cheong EY, et al. Persistence of related bla-IMP-4 metallo-beta-lactamase producing Enterobacteriaceae from clinical and environmental specimens within a burns unit in Australia – a six-year retrospective study. Antimicrob Resist Infect Control 2013; 2: 35. 21. Kidd TJ, Ramsay KA, Hu H, et al. Shared Pseudomonas aeruginosa genotypes are common in Australian cystic fibrosis centres. Eur Respir J 2013; 41: 1091–100. 22. Armstrong DS, Nixon GM, Carzino R, et al. Detection of a widespread clone of Pseudomonas aeruginosa in a pediatric cystic fibrosis clinic. Am J Respir Crit Care Med 2002; 166: 983–7. 23. O’Carroll MR, Syrmis MW, Wainwright CE, et al. Clonal strains of Pseudomonas aeruginosa in paediatric and adult cystic fibrosis units. Eur Respir J 2004; 24: 101–6. 24. Syrmis M, Bell S, Bye P, et al. High prevalence of a class 1 integronassociated aadB gene cassette in Pseudomonas aeruginosa isolates from an Australian cystic fibrosis patient population. Pathology 2008; 40: 524–5. 25. CLSI. Performance Standards for Antimicrobial Susceptibiltiy Testing; 17th Informational Supplement. CLSI document M100-S17. Wayne PA: Clinical and Laboratory Standards Institute; 2007.
Pathology (2015), 47(2), February
26. Whiley DM, Faux CE, Bialasiewicz S, et al. A simple approach for preparing real-time PCR positive reaction controls for rare or emerging viruses. J Clin Virol 2010; 48: 193–7. 27. Anuj SN, Whiley DM, Kidd TJ, et al. Rapid single-nucleotide polymorphism-based identification of clonal Pseudomonas aeruginosa isolates from patients with cystic fibrosis by the use of real-time and high-resolution melting curve analysis. Clin Microbiol Infect 2011; 17: 1403–8. 28. Oliver A, Canton R, Campo P, et al. High frequency of hypermutable Pseudomonas aeruginosa in cystic fibrosis lung infection. Science 2000; 288: 1251–4. 29. Cornaglia G, Akova M, Amicosante G, et al. Metallo-beta-lactamases as emerging resistance determinants in Gram-negative pathogens: open issues. Int J Antimicrob Agents 2007; 29: 380–8. 30. Juan C, Gutierrez O, Renom F, et al. Chronic respiratory infections by mucoid carbapenemase-producing Pseudomonas aeruginosa strains, a new potential public health problem. Antimicrob Agents Chemother 2008; 52: 2285–6. 31. Knibbs LD, Johnson GR, Kidd TJ, et al. Viability of Pseudomonas aeruginosa in cough aerosols generated by persons with cystic fibrosis. Thorax 2014; 69: 740–5. 32. Samuelsen O, Buaro L, Giske CG, et al. Evaluation of phenotypic tests for the detection of metallo-beta-lactamase-producing Pseudomonas aeruginosa in a low country. J Antimicrob Chemother 2008; 61: 827–30. 33. Berges L, Rodriguez-Villalobos H, Deplano A, et al. Prospective evaluation of imipenem/EDTA combined disc and Etest for detection of metallo-betalactamase-producing Pseudomonas aeruginosa. J Antimicrob Chemother 2007; 59: 812–3. 34. Dortet L, Poirel L, Nordmann P. Rapid detection of carbapenemaseproducing Pseudomonas spp. J Clin Microbiol 2012; 50: 3773–6. 35. Dortet L, Poirel L, Nordmann P. Further proofs of concept for the Carba NP test. Antimicrob Agents Chemother 2014; 58: 1269.
Copyright © Royal College of pathologists of Australasia. Unauthorized reproduction of this article is prohibited.
