Mutation Research, 266(1992) 163-170 © 1992 Elsevier Science Publishers B.V. All rights reserved 0027-5107/92/$05.00

163

MUT 05064

Molecular mechanisms of the formation of DNA double-strand breaks and induction of genomic rearrangements R u d o l f I. Salganik and Grigory L. Dianov Institute of Cytology and Genetics, U.S.S.R. Academy of Sciences, Siberian Branch, Nocosibirsk-90, 630090 (U.S.S.R.) (Received 11 March 1991) (Revision received 1~. October 1991) (Accepted 18 October 1991)

Keywords: DNA double-strand breaks, formation; Genomic rearrangements, induction of; Plasmid molecules, broken

Summary The probability that damage occurs in closely opposed sites on complementary DNA strands increases when DNA is heavily modified with mutagenic agents. Enzymatic excision of the opposite lesions produces DNA double-strand breaks which give rise to genomic rearrangements (deletions, insertions, etc.). Plasmid systems were developed for studying chemical lesions leading to double-strand breaks and the fate of broken plasmid molecules within bacterial cells. Deletions result from the base-pairing of fortuitously located direct repeats flanking the DNA broken ends; as a consequence, the latter are joined, while the DNA fragment between the direct repeats is deleted. Genomic rearrangements arise during the repair of the DNA double-strand breaks, and both events are due to similar repair enzymes which maintain the integrity of the DNA primary structure when conditions are not stressful. A number of genomic rearrangements and point mutations seem to be predetermined by the DNA primary structure.

A large group of chemical and physical agents are known to interact with DNA, modifying nucleotides and thereby providing conditions for alteration of genetic information. Such agents of the internal milieu of the cell include primary superoxide radicals generated in the course of a number of biochemical reactions (Fridovich, 1978; Imlay and Linn, 1988) and S-adenosylmethionine and other physiological compounds (Lutz, 1990;

Correspondence: Dr. O. Dianov, (present address), Imperial Cancer Research Fund, Clare Hall Laboratories, South Mimms, Potters Bar, Herts, EN6 3LD (Great Britain).

Glatt, 1990). Alternatively, mutations can arise due to errors produced by DNA polymerase during DNA replication or repair (Loeb and Cheng, 1980) The external mutagens comprise ionizing and ultraviolet radiation and many highly reactive naturally occurring or anthropogenic compounds modifying cellular DNA (Singer and Kusmierek, 1982). Stability of genetic information is ensured by a set of enzymes repairing DNA lesions in concert. Specific DNA-glycosylases recognize various chemically modified bases and remove them by catalysing the cleavage of the bond between the base and deoxyribose residues. The base-free site

164 of the DNA strand (the apyrimidinic or apurinic site) is cleaved by an endonuclease and then extends to the single-strand gap. The gap created is further repaired by DNA polymerase which uses the intact complementar'j strand of DNA as a template, while DNA-ligase ultimately joins the free ends. Another specific endonuclease (UvrABC) makes two nicks at the 3'- and 5'-side of the modified nucleotide and thus initiates the removal of the entire damaged fragment of DNA. These events are also associated with the formation of single-strand gaps. The enzymatic repair mechanisms providing the constancy of the DNA primary structure have been outlined in a number of reviews (Lindahl, 1982; Walker, 1984; Friedberg, 1985; Grossman and Yeung, 1990). Under relatively innocuous constant conditions the correction mechanisms cope mostly with a low level of DNA lesions, and only a small number of mutational events take place. On the other hand, under increased exposure to radiation, or to environmental chemicals eliciting premutational lesions, or under other stressful conditions, the degree of DNA modification would increase and accordingly the mutation rate would grow. McClintock's term "genomic stress" denotes a condition of DNA modification and reorganization within the genome itself in response to environmental challenge (McClintock, 1984). A number of cytogenetic and biochemical observations have shown that double-strand breaks arise in the stressed gcnome (Bryant, 1984; Obe et al., 1985; Stahl, 1986). The questions we pose are: What are the possible mechanisms of the formation of double-strand breaks under conditions of genomic stress? and, How can DNA double-strand breaks induce genomic rearrangements? Induction of DNA double-strand breaks Let us consider the case of moderate mutagen action. Rare single bases at various sites in both DNA strands would be subjected to modification. The majority of the modified bases would be eliminated by repair enzymes and the resultant single-strand gaps would be filled by DNA-polymerase and ligated (Fig. 1A). Some of the remaining damage would be the source of rare nucleotide substitutions during replication, if they

B

A i W

i IP'

A W

~

EXCISION

e! EXCISION m

~

i W

ONA-POLYMERASE

LIGASE i

~ DNA-POLY° MERASE

~

2nd EXCISION AND REPAIR

LIGASE

V

C

i W

A w

~

1e1 EXCISION

~

hd

Jib

EXCISION m m

MODIFIED NUCLEOTIDE

C.A.OEO NUCLEOTiOE(MUTATION)

Fig. i. Models for the repair of single- and double-strand DNA lesions,(A) error-free repairof single-strandlesion:(B) formation of mutation during repair of closelyspacedlesions of both DNA strands; (C) formation of the double-strand break during simultaneous repair of oppositely located lesions.

are mis-coding lesionE, or induce an error.prone "SOS" response, because of the replication block caused by a non-coding lesion (Walker, 1984). With increasing mutagen action, bases in opposite sites of DNA complementary strands have a greater probability of being modified. If the modified bases were removed in the oppositely located regions at different times, the number of point mutations arising would increase because of errors committed by the repair system using damaged DNA strands as a template (Fig. IB), (Bresler, 1975; Sedgwick, 1976). If the oppositely located lesions were removed at the same time from the two strands and their overlapping regions became gapped, double-strand breaks would be produced (Fig. IC). There have been several reports concerning induction of DNA double-strand breaks during

165

the excision of modified bases. The first pertinent suggestions were those of Harm (1968) and Setlow (1968). Subsequently, Bonura and Smith (1975) have shown that double-strand breaks are induced in E. colt during the repair of UV light damage. It is well known that UV light forms pyrimidine dimers and other photoproducts; most of them are excised from bacterial DNA by the specific enzyme complex Uvr ABC (Grossman and Yeung, 1990). After exposure to UV light, DNA double-strand breaks are induced in wildtype strains but not in the mutant whose repair system is defective (Bonura and Smith, 1975). These results agree with those of Bradley and Taylor (1981) obtained in experiments with normal human cells and cells from a patient with xeroderma pigmentosum (XP) that were deficient in enzymes producing incisions in DNA co,taining pyrimidine dimers. The formation of DNA double-strand breaks was observed in the normal human cells after UV-exposure, with their number increasing with UV-dose, but not in the XP cells. Until recently, however, there was no direct evidence that DNA double-strand breaks can arise by either mechanism. Recently, new methods of site-directed modification of DNA were developed (Salganik et al., 1980; Dianov et al,, 1986; Medvedev et al., 1988; Sinitsina et al., 1989) and mechanisms of induction of double-strand breaks were deduced from experiments utilizing DNA constructs with modified bases in opposite sites on complementary strands (Dianov et al., 1991a). Under the effect of elevated temperature, treatment with sodium bisulphite and certain other mutagenic compounds the DNA cytosine residues are subjected to deamination and converted to uracil residues (Lindahl, 1979; Singer and Kusmierek, 1982). Uracil is an erroneous base in DNA that is removed by uracii-DNA glycosylase (Lindahl, 1982). We constructed a circular plasmid with uracil residues integrated into the opposite sites of complementary DNA strands (Fig. 2A). We suggested that if the uracil residues were removed by uracil-DNA glycosylase, and the resulting apyrimidinic sites in both strands incised and digested by endonuclease, a DNA double-strand break would appear. As a result, the circular plasmid would become linear. In

A

TGGATCCT

IIii111 ACCTAGGA I I I I I ! ~ BamHI

IIIIIII

GATe

CTAG

IIIII!

~ NaHSO3

IIIIIII

oligonucleotide AATCGGTACC

IIIIII

GATU

UTAG l

IIIII1

Llgase

AATCGGTACCGATU UTAGCCATGGCTAA I I I I I

B

12345 C-

o

m

q

L- -.. o " q D Fig. 2. (A) Scheme for the preparation of plasmid with two uracil residues in opposite sites of complementary DNA strands, To construct plasmid with two opposite uracil residues, pUCI8 plasmid DNA was digested with restriction

endonuclease BamHI and modified with sodium bisulfite (Medvedev el al,, 1988) which preferentially deaminates cyto. sine residues in single-straoded DNA (Shapiro et al,, 1974). As a result, the cohesive ends of linearized plasmid DNA were transformed from GATC to GATU. Bisulphite modified DNA cannot be ligated with T4 ligase under standard conditions (Medvedev et al., 1988) since its ends become noncomplementary. Recircularization was carried out by ligation with •~2P.oligonucleotide duplex having cohesive ends complementaw to these of the bisulfite modified site. Ligated plasmid DNA was incubated with E. coil cell-free lysates, purified by phenol extraction and analysed by agarose gel electrophoresis. (B) Agarose gel electrophoresis revealing plasmid DNA double-strand breaks arising after incubation of plasmid constructs with ung ÷ or ung- E. coli cell-free lysates. C-circular. L-linear forms of plasmid DNA. (I) Without incubation with cell-free lysate. (2) Incubation with ung ÷ lysate. (3) Incubation with ung- ]ysate. (4) Linear DNA marker. (5) Circular DNA marker.

166

@~ EeoRi

--.-i.,/~HI nd II I

emHI

Hlndlll ,~ NeHSO3 A

'~'~"'HI

•

~r ~

Modified ~cytoslne

~~

. BamHI + NaHSO 3 nd I ' Ill

C' ' ~ ' ~ 4 , •

B

~

--

EeoRI

Fig. 3. Construction of linear pBR322 DNA with non-sticky ends. Three different plasmid constructions were used in this experiment for transformation of E. coli cells. Plasmid DNA was cut with HindIll (A) or BamHI (C) restriction endonucleases and sticky ends were modified with sodium bisulphite (see legend to Fig, 2); (B) plasmid DNA was cleaved with EcoR! and Hindlll restriction endonucleases, and the resulting fragments were separated by electrophoresis through 1% agarose gel. The large fragment was eluted from the gel and used for transformation.

contrast, in cells devoid of uracil-DNA glvcosyiase activity, uracil residues ca.not be removed from the circular DNA, no DNA double-strand t,reaks would arise, and the plasmid molecule would remain circular. To verify this assumption, the constructed plasmid labeled with .~2p. oligonucleotides was incubated with cell-free lysates of E. coii cells with active uracil-DNA glycosylase (ung+). After incubation with cell extract, plasmid DNA was purified and analysed by agarose gel electrophoresis. The plasmid construct not treated with lysate contained circular DNA and linear DNA (Fig. 2B, lane 1). The linear form of labeled DNA arises as a result of incomplete ligation, and/or by the presence of plasmids with only one of the cohesive ends modified and therefore ligatable. After incubation with the cell lysates, the circular plasmids are completely linearized (Fig. 2B, lane 2). When the same plasmid construct was incubated with ungcell lysate, linearization of the circular form of DNA was negligible (Fig. 3, lane 3). We thus concluded that the double-strand breaks induced in DNA were due to the removal of uracil residues by uracil-DNA glycosylase.

If the double-strand breaks arose as a result of a modification introduced into opposite located DNA regions, there would be reason to assume that such modification would be conducive to deletion formation. In fact, when the plasmid DNA with oppositely placed uracil residues was transformed into E. coli cells possessing uracilDNA glycosylase activity, data was obtained showing that a double-strand break stimulated the appearance of deletions (Dianov et al., 1991a). In these experiments a polylinker sequence flanked with 165 b.p. long direct repeats was inserted within the tet gene of pBR327. This plasmid was used to construct DNA containing one or two uracil residues which replaced cytosine residues in the Kpnl restriction site of the polylinker. Recombination of direct repeats, induced by double-stranded breakage of plasmid DNA, can lead to the deletion of the polylinker and one of the direct repeats and thus restoration of the tet gene which can be detected by the appearance of tetracycline-resistant transformant colonies. Transformation of E. coil cells with these plasmid DNA constructs demonstrated that plasmids containing two closely spaced uracil residues were effective in the induction of deletions. The frequency of deletions is stimulated by a factor of 10 in an ung + E. coil strain in comparison with an ung- strain (Dianov et al., 1991a). The data presented strongly favour the idea that DNA double-strand breaks result from the excision of opposite lesions from the DNA strands. This does not exclude other ways and means by which DNA double-strand breaks can arise, for instance, under the direct action of ionizing radiation or high energy particles on DNA or spontaneously in sequences containing palindrome structures (Glickman and Ripley, 1984). The molecular mechanisms of genomic rearrangements induced by DNA double-strand breaks To study the mechanisms by which doublestrand breaks may give rise to genomic rearrangements, breaks were introduced into circular plasmid to convert them to linear form (Fig. 3). When a DNA double-strand break arises as a result of

167 excision of oppositely located modified nucleotides on the two strands, the broken ends are not necessarily complementary or cohesive. To mimic a D N A double-strand break with noncohesive ends, pBR322 plasmid DNA was subjected to restriction endonuclease digestion at a unique site located within the tet gene; thereafter the linearized plasmid was modified by making the cohesive ends non complementary as shown in Fig. 3 and used for transformation of E. coli cells. The transformation efficiency of E. coli cells with such linearized plasmids with noncohesive ends was dramatically decreased, but gave rise to numerous tetracycline-sensitive mutants of plasmid DNA. The progeny of the linearized plasmids were than analyzed by restriction analysis and sequencing. The results are summarised in Table 1. In contrast, the transformation of E. coli cells with linearized plasmids having intact complementary ends did not result in the appearance of mutant plasmid. In this case, as a consequence of the interaction of the cohesive ends, the plasmid DNA regained its initial size and circular form. Restriction analysis of the mutan~t plasmids demonstrated thal the deletions ranged from several to about 1500 nucleotides in sizel Sequencing of the regions of rejoined broken ends suggested a mechanism for the origin of the deletions. In all the 25 sequenced mutants, deletions were located strictly between imperfect direct repeats flanking the broken ends, The direct repeats spanned

from 11-18 base pairs, and they were usually interspersed with unpaired bases. In all deletion mutants, one of the direct repeats disappeared. This was taken to mean that the complementary sequences of two direct repeats had interacted and had base paired. The direct repeats are partially non-complementary. However, the sequence related to the direct repeat remaining in the deletion mutants is completely complementary, and one of the direct repeats or both serves as a template for the correction of heteroduplexes. Fig. 4 compares the sequences which flank the broken non-cohesive ends of the parental linearized plasmid, and the rejoined sites of the broken ends of one of the deletion mutants and schematically presents the consecutive events thought to occur in the emergence of such deletion mutants. It was assumed that the occurrence of a DNA double-strand break is followed by the exonuclease digestion of one DNA strand at the break sites in 5 ' - 3 ' or 3'-5' directions. This exposes the complementary sequences of the direct repeats (shown as a bold line) flanking the break site and could give them an opportunity to base-pair. At the next step either exonucleases digest the DNA single-strand tails left over after the base-pairing of the direct repeats or a specific endonuclease cleaves the junction sites between the base-paired sequences and the unpaired single-strand tails. The mismatch repair correction enzymes excise the unpaired nueleotides of the interacting direct repeat heteroduplex, and the

Table I MUTANTS ARISING AFTER TRANSFORMATION OF E. coil ABlI57 WITH LINEARIZED PLASMID DNA WITH NON-COHESIVE ENDS Expt.

a b c d

Numberof transformants

Type of mutations Deletion Inr,¢rtion

tested

Total numberof mutants

4 037 1930 1460 5000

5() 3() 31 00

37 24 15 00

DNA used for transformation: ao BamHl cleaved DNA treated with sodium bisuiphite. b, EcoR! and Hindlil cleavedDNA. c. Hindlll cleaved DNA treated with sodium bisulphite. d, Hindlll cleaved DNA (cohesiveends).

(| 6 1 0

Point mutation 13 {)it 15 0t)

168

repair proceeds with the involvement of DNA polymerase and DNA ligase in the filling of the gaps. The schematically represented interaction of the direct repeats is a version of the model of. fered by Broker and Lehman to explain DNA recombination in T4 phages (Broker and Lehman, 1971). The scheme is also akin to that of Lin ¢t al. (1984) accounting for the recombination of tandemly arranged genes showing homology. Equally relevant are the earlier studies of Conley et al. (1986) concerning recombinational recyclization of plasmid DNA and deletion formation. The data presented demonstrate a search for complementary, sequences (when the cohesive ends are missing) in the region of DNA flanking the broken ends. The direct repeats serve as the inner "sticky" ends. As the result of the basepairing of these inner cohesive sequences deletions arise and they are strictly limited by the direct repeats which merge together in the mutant DNA. A

EcoRI , ~

3,-cT~(g~cacol~aa==q~c=E~A~,~1~T.

From a survey of reports concerning the sequencing of spontaneous or mutagen-induced deletions, their association with direct repeats is apparent (Farabaugh et al., 1978; Efstradiadis et al., 1980; Albertini et al., 1982; Hasson et al., 1984; Salganik et al., 1987; Meuth, 1990; Dianov et al., 1991b). Predetermined deletions induced by mutagens, as demonstrated by the data presented here, could arise as a result of the formation of double-strand breaks in the D N A regions between the direct repeats, while spontaneous deletions may arise as a result of "slipped mispairing" (Streisinger et al., 1966" Glickman and Ripley, 1984). Plausibly, the D N A double-strand breaks also do not arise fortuitously. In regions rich in alternating cytosine and guanine residues, oppositely located uracil residues have a higher probability of occurring and their excision would lead to double-strand breaks predetermined by the D N A primary structure. The same reasoning may be extended to D N A regions in which oligopurine and oligopyrimidine clusters alternate; double~--.Hlndlll AA~TAC . . . . TAC

.AAaTTCTTJU~

C-S

B m

iii ii

s' m

C,T~:CT~,T~:a~Ta,~ ¢~ec,c,=~.... - 3'

3'-CTTTCACGG

GGAC

T

GCA

T

T

GK T

CT

G-G'~.

TT

, ,-S'

"',

iiiii

m

H

5'-GAJUtAGTGCCACCTGACGTTGAGGACCCGG

....

-3'

3'-CTTTTC&CGGTGGACTGCAACTCCTGGGCC

....

-S'

I

Fig. 4. Nuclcotide sequenceof one of the deletion mutants and the scheme proposed for the double-strand break initiated deletions predetermined by short direct repeats, (a) nucleotide sequenceof plasmid pBR322 with non-complementary EcoRlHindlll ends (repeated nucleotides shown in boxes);(b) the structure of an intermediate complex; (e) nucleotide sequenceof junction region of one of the deletion mutants (pTTI89). EcoR[ and Hindlll, restriction sites for appropriate endonucleases.(1) Exonucleasehydrolysisof broken DNA. (2) Formation of heteroduplex.(3) Repair of heteroduplex.

169 strand breaks may arise at these sites after U V exposure as a result of the formation of pyrimidine dimers and other photoproducts in opposite sites and of their subsequent excision.

Conclusions Continuous exposure of genomic D N A to various external and internal agents which modify base sequences in turn may lead to mutations. The constancy of the D N A primary structure and hereditary information it encodes is maintained by a set of correction and repair enzymes which eliminate the modified nucleotides and restore the initial nucleotide sequence. However, it is becoming increasingly evident that, with growing intensity of the mutagenic factors, these enzymes start acting in the opposite direction, they become tools of genomic rearrangements. This "reverse mission" of the D N A correction and repair enzymes is probably accomplished due to the formation of DNA double-strand breaks in whose generation and subsequent repair these enzymes are involved. It seems reasonable to suggest that the double-strand breaks of damaged DNA arise mainly as a result of the excision Of oppositely sited lesions in the two strands of the DNA whose probability of occurrence increases with the increase of the intensity of ",L=,*~genic stress". When the prolonged action of str~,=~ful (as a rule, mutagenic) factors (these include life-incompatible radiation background, drastic temperature fluctuations) threatening life, the problem is whether or not individuals had their genomes restructured to cope with novel conditions. It cannot be excluded that the capacities of forming D N A double-strand breaks and thereby inducing rearrangements are inherent in the double helix. If so, these capacities are of no less importance than DNA function as a template for replication and excision repair essential for the maintenance of the primary structure. These processes impart commonality to the involved enzymes. It seems that the same set of en~/mes bring into effect all these processes. The rejoining of the D N A broken ends, when they are noacomplementary, gives rise to deletions and insertions. However, double-strand break repair has an im-

portance of its own because an unrepaired b~e-ak can have lethal consequences. It should be noted that the repair of D N A double-strand breaks and the associated formation of deletions and insertions would mainly proceed by the above described mechanisms in haploid cells with a single set of chromosomes. In diploid cells, D N A double-strand break repair is predominantly effected through homologous recombination of the D N A sister molecules as described by Szostak et al. (1983) without the formation of deletions and insertions. If the D N A double-strand breaks and rearrangements occur in the zygote, they would provide the inheritance and selection of genomic rearrangements requisite for survival in novel environmental conditions.

Acknowledgements We thank Drs. T. Lindahl and R. Wood for helpful comntents on the manuscript.

References Alhertini, A., M. Hofer, M. Calos and J. Miller (1982) On the formation of spontaneous deletions: the importance of short sequence homologies in the generation of large deletions, Cell, 29, 319-321. de Boer, J.G., and LS. Ripley (1984) Demonstration of the production of frame shift and base substitution mutations by quasipalindromic DNA sequences, Prec. Natl. Acad. Sci. (U,S.A.), 81, 5528-5531. Bonura, T., and K.C. Smith (1975) Enzymatic production of deoxyribonucleic acid doui~le-strand breaks after ultraviolet irradiation of Escherichia coli KI2. J. Bacteriol., 121, 511-517. Bradley, M.O., and V.i. Taylor (1981) DNA double-strand breaks induced in normal human cells during the repair of ultraviolet light damage, Prec. Natl. Acad. Sci. (U.S.A.), 78, 3619-3623. Bresler, S.E. (1975) Theory of misrepair mutagenesis, Mutation Res., 29, 467-474. Broker, T., and I.R. Lehman (1971) Branched DNA molecules: intermediates in T4 recombination,. J. Mol. Biol., 60, 131-149. Bryant, P.E. (1984) Enzymatic restriction of mammalian cell DNA using Pvull and BamHl. Evidence for the double strand break origin of chromosomal aberrations. Int. J. Radial. Biol., 46. 57-65. Conley, E.C,, V.A. Saunders, V. Jackson and J.R. Saunders (1986) Mechanisms of intramolecular recyclyzation and deletion formation following transformation of E. coli

170 with linearized plasmid DNA, Nucl. Acids Res., 14, 89198932. Dianov, G.L., E.A. Vasiunina, L.P. Ovchinnikova, O.I. Sinitsina and R,I. Salganik (1986) The molecular basis of origin of complete and mosaic mutants, Mutation Res., 159, 41-46. Dianov, G.L., T.V. Timchenko, O.!. Sinitsina, A.V. Kusminov, O.A. Medvedev and R.I. Salganik (1991a) Repair of uracil residues closely spaced in the opposite strands of plasmid DNA results in double-strand break and deletion formation, Mol. Gen. Genet.. 225, 448-452. Dianov, G.L., A.V. Kuzminov, A.V. Mazin and R.I. Salganik (1991b) Molecular mechanisms of deletion formation in Escherichia coil plasmids, 1. Long direct repeats mediated deletions, Mol. Gen. Genet., 228, 153-159. Efstratiadis. A., J.W. Posacony, T. Maniatis et al. (1980) The structure and evolution of the human /3-globin gene family, Cell, 21,653-668. Farabaugh PJ,, U. Schimeissner, M. Hoffer and J. Miller (1978) Genetic studies of the lac represser, VII. On the molecular nature of spontaneous hotspots in the lacl gene of E. coil, J. Mol. Biol., 126, 847-863. Fridovich, I. (1978)The biology of oxygen radicals, Science, 201,875-880. Friedberg. E.C. (1985) DNA Repair, Freeman. New York. Glatt. H. (1990) Endogenous mutagens derived from amino acids, Mutation Res., 238. 235-243. Gliekman. B.W., and L,S. Ripley (1984)Structural intermediates o¢ deletion mutagenesis: A role for palindromic DNA, Prec. Natl. Acad. Sci. (U.S.A.). 81,512-516. Grossman. L., and A,T. Yeung (1990) The UvrABC endonuclease system of E. coli. A view from Baltimore, Mutation Res.. 236. 213-221. Harm, W. {1968) Effect of dose fraction on ultraviolet survival of Esther/ebb: co/i, Photochem. Photobiol., 7, 73-86, Hasson, J..F., E. Magneu, F. Cusin and M. Yaniv (1984) Simian virus 40 illegitimate recombination occurs near short direct repeats, J. Mol. Bioi,, 177, 53-68. hnlay, J., and S, Linn (1988) DNA damage and oxygen radical toxicity, Science, 240, 1302-1309. Lin. F.L., K, Sperle and N. Sternberg (1984) Homologous recombination in mouse L cells, Cold Spring Harbor Syrup. Ouant. Biol,, 49, 8919-8932. Lindahl, T. (1979) DNA glycosylases, endonucleases for apurinic/apyrimidinic sites and base excision repair, Prog. Nucl, Acid. Res. Mol. Biol., 22,135-192. Lindahl, T. (1982) DNA repair enzymes, Annu. Rev. Biochem., 51, 61-87. Loeb, L.A., and K.C. Cheng (1990) Errors in DNA synthesis: A source of spontaneous mutations, Mutation Res., 238, 297-304. Lutz, W.K. (1990) Endogenous genotoxic agents and processes as a basis of spontaneous carcinogenesis, Mutation Res., 238, 287-295.

McClintock, B. (1984) The significance of responses of the genome to challenge, Science, 226, 792-801. Medvedev, O.A., T.V. Timchenko and G.L. Dianov (1988) A method for inducing C - T transitions into DNA sequences of restriction sites, Biorg. Chem. (U.S.S.R.), 14, 694-696. Meuth, M. (1989) Illegitimate recombination in mammalian cells, in: D.E. Berg and M.M. Howe (Eds.), Mobile DNA, American Society for Microbiology, Washington, DC, pp. 833-860. Obe, G.C., F. Degrassi and R. DeSalivia (1985) Chromosomal aberrations induced by restriction endonucleases, Mutation Res., 150, 359-368. Salganik, R.I., G.L. Dianov, L.P. Ovchinnikova, E.N. Voronina, E.B. Kokoza and A.V. Mazin (1980) Gene-directed mutagenesis in bacteriophage T7 provided by polyal~lating RNAs complementary to selected DNA sites, Prec. Natl. Acad. Sci. (U.S.A.), 77, 2796-2800. Salganik, R.I., T.V. Timchenko and G.L. Dianov (1987) Molecular mechanisms of deletions arising as a result of DNA double-strand breaks, Prec. Natl. Acad. Sci. (U.S.S.R.), 296, 226-230. Sedgwick, S.G. (1976) Misrepair of overlapping daughter strand gaps as a possible mechanism for UV induced mutagenesis in Uvr strains of Eschericttia coil: a general model for induced mutagencsis by misrepair (SOS repair) of closely spaced DNA lesions, Mutation Res., 41,185-200. Setlow, R.B. (1968) The photochemistry, photobiology and repair of polynucleotides, in: J.N. Davidson and W.E. Cohen (Eds.), Progress in Nucleic Acids Research and Molecular Biology, Vol. 8, Academic Press, New York, pp. 257-295. Shapiro, R., V. DiFate and M. Welcher (1974) Deamination of cytosine derivatives by bisulfit¢, Mechanism of the reaction, J, Am. Chem. See., 96, 206-212. Singer B., and J.T. Kusmierek (1982) Chemical mutagenesis, Annu, Rev. Biochem,, 51,655-693. Sinitsina, OJ., G.L. Dianov and R.I. Salganik (1989) Repair excision of opposite lesions induce DNA double-strand breaks, Proc. Natl, Acad. Sci. (U.S.S.R.), 306, 214-217. Stahl, F.W. (1986) Roles of double strand break in generalized recombination, Prog. Nucl. Acids Res. Mol. Biol., 33, 169-194. Streisinger, G., Y. Okada, J. Emerich, J. Newton, A. Tsugita, E, Terzaghy and M. lnouye (1966) Frameshift mutations and the genetic code, Cold Spring Harbor Symp, Quant. Biol., 31, 77-84. Szostak, J.W., T,L. err-Weaver, R.I. Rothstain and F.W. Stahl (1983) The double-strand break repair model for recombination, Cell, 33, 512-516, Walker, G.C (1984) Mutagenesis and inducible responses to deoxyribonucleic acid damage in Escherichia coli, Microbiol, Rev,, 48, 60-93,