Journal of the Neurological Sciences, 108 (1992) 7-17 © 1992 Elsevier Science Publishers B.V. All rights reserved 0022-510X/92/$05.00

7

JNS 03699

Molecular genetics of Leber's hereditary optic neuropathy: study of a six-generation family from Western Australia H e r a w a t i S u d o y o i, S a n g k o t M a r z u k i i, F r a n k M a s t a g l i a 2 a n d W. C a r r o l l 2 I Department of Biochonistry, Monash UniuersiO'. Clayton, Melbourne, Victoria (Australia) and 2 Unirersity Department of Medicine, Queen Eli2abeth 11 Medical Centre, Perth, WesternAustralia (Australia)

(Received 30 April, 1991) (Revised, received I I September, 1991) (Accepted II September, 1991) Key words: Leber's hereditary optic neuropathy; Human mitochondrial DNA; Mitochondrial mutation; Disease-associated mutation

Summary Molecular genetic studies were carried out on a 6-generation family from Western Australia with Lcber's hereditary optic neuropathy. Pedigree analysis confirms the maternal inheritance of the genetic lesion underlying the disorder in this family. The presence of a recently reported disease-associated mutation at nucleotide 11778 of the mtDNA was established in one clinically affected family member by the sequencing of an appropriate 1.6 kb PCR-amplified fragment of the mtDNA; this mutation leads to an Arg340 ~ His amino acid replacement in the ND4 subunit of respiratory complex I. The 11778 G to A base substitution is

associated with the loss of an SfaN! restriction site. Examination of the representative members for this site revealed that while only mtDNA carrying this substitution could be detected in the leukocytes of 4 family members of the sixth generation, the mutated mtDNA was found to co-exist with the normal mtDNA population (heteroplasmy) in a clinically unaffected member from the fifth generation. This observation suggests that the nt 11778 mutation observed in this LHON family is relatively new; the observation of both heteroplasmy and apparent homoplasmy of the mtDNA in different family members might reflect the normal progression in the establishment of a mitochondrially inherited mutation.

Introduction Leber's hereditary optic neuropathy (LHON) is an inherited degenerative disorder characterized by visual failure resulting from a bilateral optic atrophy (Carroll and Mastaglia 1979; Livingstone et al. 1980), with multiple organ involvement sometimes observed in a sporadic manner in certain families (Novotny et al. 1986). The biochemical basis of this disorder has not been satisfactorily defined, although there has been a suggestion that the levels of liver mitochondrial thiosulphate-sulphur transferase, the major enzyme involved in the conversion of cyanide to thiocyartate, is depressed in liver biopsy obtained from two affected

Correspondence to: S. Marzuki, Department of Biochemistry, Monash University, Clayton, Vict., Australia 3168.

males of a family (Cagianut et ai. 1981), and more recently the reduction in the activity of the NADHcoenzyme Q reductase in fibroblast cell lines derived from patients (Parker et al. 1989). Genetically, this disorder showed a non-mendelian pattern of inheritance, and the observation in several families that the disease is transmitted along the maternal line (Erickson et al. 1972; Carroll and Mastaglia 1979; Nikoskelainen 1984a, b; Nikoskelainen et al. 1987) has led to the suggestion that LHON might be due to a mutation in the mitochondrial DNA (mtDNA), which has been shown to be maternally inherited in mammals (Giles et al. 1980; Brown et al. 1980). The mitochondrial genome codes for a small number of hydrophobic proteins of the inner mitochondrial membrane, essential for the development of functional mitochondrial respiratory chain (see Tzagoloff and Myers 1986, for review). These include 7 subunits of the NADH-coenzyme Q reductase (respiratory complex l)

8

(Chomyn et al. 1985), the apocytochrome b of the coenzyme Q-cytochrome c reductase (complex liD, 3 subunits of the cytochrome oxidase and two subunits of the ATP synthase (Anderson et al. 1981). Hence, central to the elucidation of the biochemical basis of LHON has been the search for defects in the mitochondrial respiratory enzyme activities, and for mutations in the mtDNA. The mitochondrial mode of inheritance is strongly supported by the recent identification of a LHON associated G to A transition at nt 11778 of the mtDNA (Wallace et al. 1988). This base substitution converts an evolutionarily conserved arginine residue to a histidine in the ND4 subunit (amino acid residue 340) of the respiratory complex I (NADH-coenzyme Q reductase). It also resulted in the loss of an SfaNI site, providing a convenient means to screen for the mutation. The loss of the SfaN I site was observed in 9 of 11 LHON families initially studied (4 from North America and 5 from Finland; Wallace et al. 1988) and subsequently demonstrated in a Japanese (Yoneda et al. 1989), and 10 out of 19 Finnish families (Vikki et al. 1989). The SfaNI restriction endonuclease study in several family members suggested that the nt 11778 mutation is homoplasmic, in that only the mtDNA carrying this substitution could be detected in the samples analysed. Two of us (F.M. and W.C.) have previously reported a 6-generation family from Western Australia with Leber's hereditary optic neuropathy (Carroll and Mastaglia 1979). We have now re-examined several members of this large family, and conducted a study aimed in particular at correlating the molecular genetics of the disease and its clinical expression. Our analysis confirms the maternal inheritance of LHON in this family, and established the presence of the disease-associated nt 11778 (] to A nucleotide substitution in the mtDNA of several family members. Of significance was the finding that while only mtDNA carrying this substitution could be detected in the leukocytes of 4 family members of the sixth generation examined, the mutated mtDNA was found to co-exist with the normal mtDNA population (heteroplasmy) in a clinically unaffected member from the fifth generation. This observation suggests that the nt 11778 mutation observed in this LHON family is relatively new; the observation of both heteroplasmy and apparent homoplasmy of the mtDNA in different family members might reflect the normal progression in the establishment of a mitochondrially inherited mutation. This would involve an initial heteroplasmic phase following the mutational event and the subsequent enrichment of either the mutated or the normal type mtDNA in the subsequent generations, as the result of the random nature of mtDNA segregation during oogenesis and embryonic development.

Patients and methods

Patients The family was derived from the union of a Chinese male and an Irish female, and comprised of 99 members in 6-generations. At the time of the study, there were 72 living members, 59 of whom were available for clinical examination, 14 of these being clinically affected and the remaining 45 being asymptomatic.

Isolation of mononuclearfraction Peripheral blood mononuclear cells were isolated from patients and donors after informed consent had been obtained. Fifty ml of blood was collected in acid citrate dextrose/heparinised tube. Red blood cells were sedimented by the addition of half volume of 5% Dextran T500 (Pharmacia) in 0.9% NaCI and an incubation for 30 min at room temperature. The clear upper phase was transferred to a Sorvall tube and the white blood cells were sedimented by centrifugation at 5,000 rpm, for 10 rain in a Sorvall SS34 rotor at 4°C. Pooled cells were resuspended in 17 mM Tris-HCl buffer pH 7.2 containing 14 mM NH4CI, and incubated at 37°C for 5 rain to lyse the remaining contaminating red blood cells. Mononuclear cells were then recollected by centrifugation at 5,000 rpm and resuspended in known volume of phosphate-buffered saline (PBS) pH 7.4 containing 2.5 mM KCI, 10 mM KH2PO 4, 10 mM NaeHPO4.12H20 and 120 mM NaC! to measure the packed cell volume. The cells were further washed once in PBS.

Isolation of mitochondria In some cases, leukocyte mitochondria were isolated according to Bogenhagen and Clayton (1974) and Tapper et al. (1983).

Isolation of mtDNA The mitochondrial DNA was isolated as described Bogenhagen and Clayton (1974) and Tapper et al. (1983). To the mitochondrial suspension in STE buffer, 25% SDS was added to a final concentration of 11.25% SDS and the suspension was incubated for 3-5 rain at 37°C. Following the incubation, 2.5 ml of 7 M CsCI in 10 mM Tris-HCl pH 7.6 and 1 mM EDTA were added, and the suspension was held on ice for 10 min. The suspension was then cleared by centrifugation at 13,000 rpm for 10 rain in a Sorvall SS34 rotor. Ethidium bromide was added to the supernatant to a final concentration of 500 /zg/ml and the refractive index was adjusted to 1.390. CsCl gradient was then established by centrifugation for 40 h at 34,000 rpm in a Beckman SW 50.1 rotor at 20°C. Closed circular mtDNA (lower band in the EthBr-CsCl gradien0 can be visualized under long-wave UV light and collected. The EthBr was removed from the DNA solution by the

9 addition of CsCl-saturated isopropanol and centrifugation for 10 min in a bench-centrifuge. The upper layer was re-extracted several times until all EthBr was removed. The mtDNA was then precipitated by the addition of 2.5 Vols. of distilled water, 0.1 "Col. of 3M NaCI and 2 Vols. of cold-absolute ethanol to the sample, and chilling at -70°C for 1 h.

Restriction endonuclease analysis MtDNA was digested overnight with SfaNI (Biolabs, U.K.). The digestion mixture was then analysed by electrophoresis in 2% agarose gel, followed by Southern blot to detect mtDNA fragments (Southern 1975). Two oligonucleotides of 24 nucleotides long, corresponding to nt 11942-11918 and nt 11580-11603 of the heavy and the light strands of the mtDNA respectively (see Table 1 for sequence), were employed as detection probes for the relevant mtDNA fragments in the analysis of the SfaN! RFLP for nt 11778. These oligonucleotides were radioactively labelled using the phosphate transferred function of T4 polynucleotide kinase as described by Sambrook et al. (1989).

Polymerase chain reaction (PCR) amplification of mtDNA segment The amplification of a selected segment of the mtDNA was carried out by the method of Saiki et ai. (1986). The primers used for the PCR amplification are shown in Table 1, and corresponded to the nucleotide 11580 to 11603 and 13200 to 13177 of the light and the heavy strands of the mtDNA respectively. The mtDNA fragment amplified by PCR was purified from the oligonucleotide primers using a Gene-Clean kit (Bio 101, Inc, La Jolla, CA, U.S.A.).

Cloning of the PCR-amplified DNA The method used for the cloning of the PCR amplified mtDNA fragment into pUC vector was as de-

scribed in the pUC cloning kit from Boehringer Mannheim GmBH (F.R.G.). pUC19 vector DNA (1 /~g) was linearized using 2 Units of HindIII restriction endonuclease, by an overnight incubation at 37°C. The linearized DNA was resuspended in 205 /,l of TE buffer pH 8.0 and extracted with phenol-chloroform and with chloroform. LiC! (25/,l) was then added to the DNA suspension, followed by the addition of 750 #! of cold-ethanol. After incubation at - 7 0 ° C for 15 min, the mixture was centrifuged for 10 rain. The precipitated DNA was washed once with 70% ethanol, dried under vacuum and dissolved in 10 v.l TE buffer (approx. concentration 0.1 v.g//zl). The PCR-amplified mtDNA fragment to be inserted (2 tzg) was also digested with 2 Units of HindIIl restriction endonuclease overnight at 37°C, to produce compatible cohesive ends. The resulting fragments were treated as the digested pUC DNA above, and dissolved in 10 ml of TE buffer (approx. concentration 0.2 /zg/p.l). The ligation mixture consisted of 1 /zl (100 ng) linearized pUC19 DNA, 0.2 /zg in 1 /~1 of mtDNA fragment, 0.4 U in 2/zl of T4 DNA ligase and 3/zl of 10 x ligation buffer in a total volume of 30/~l. Incubation was carried out at 15°C overnight. Competent E. coli cells (300 #1) were transformed using the heat shock method described by Sambrook et al. (1989).

DNA Sequence analysis Plasmid DNA was prepared using a modification of the alkaline lysis method described by Sambrook et al. (1989) and Birnboim and Doly (1979). The nucleotide sequence of the cloned mtDNA fragment was determined by a modification of the dideoxynucleotide chain termination method, using the T7 Sequencing Kit (Pharmacia-LKB, Upsalla, Sweden). Either the pUC19 universal sequencing primer, or a specific internal sequencing primer located at nu-

TABLE 1 SYNTHETIC OLIGONUCLEOTIDES EMPLOYED IN THE PRESENT STUDY Oligonucleotide

Length

Sequence

Location

Application

ND4 L

24

CCATCTGCCTACGACAAACAGACC

11580-11603

PCR amplification of mtDNA segment for sequencing, Southern hybridization probe for SfaNI RFLP

ND5 H

24

TGCGAACAGAGTGGTGATAGCGCC

13200-13177

PCR amplification of mtDNA segment for sequencing

ND4 H

24

GTAGGAGAGTGATATITGATCAGG

11942-1 ! 918

Southern hybridization probe for SfaNI RFLP; Internal sequencing primer for the identification of nt 11778 G to A mut.ation

10 cleotides 11942 to 11918 of the heavy strand of the human mitochondrial genome (Table 1) was employed for this purpose. The sequencing reaction mixture (2-3 /~1) were loaded onto 6% acrylamide/8 M urea gels as described by Sambrook et al. (1989), and electrophoresed at 1.5 kV at 50°C until the dye reached the bottom of the gel. A Sequi-Gen Nucleic Acid sequencing Cell (Bio-Rad, Richmond, CA, U.S.A.) was used for this purpose. After dismantling, the gel was fixed in a solution containing 10% (v/v) acetic acid and 10% (v/v) methanol for 15 min to remove the hygroscopic urea and dried onto a 3-mm Whatman paper for 30 min at 80°C. The dried gel was directly autoradiographed with Fuji-RX film for 2 days.

Results

Maternal inheritance of Leber's hereditary optic nearopathy - Western Australian family The LHON family which is the subject of the present investigation has previously been studied (Carroll and Mastaglia 1979). This Western Australian family is unique in that it represents the largest family with LHON which has been studied to date; a total of 45 members of the 6-generation family participated in the previous study. We have re-examined the Western Australian family in 1985 as a 6-year follow-up, to investigate the progression of the clinical expression of the disease within the family. The up-dated version of the family tree is shown in Fig. 1. A maternal inheritance is confirmed, as indicated by the previous family study, in that the disease is only passed by the female members of the family. As in other LHON families, however, the clinical expression of the disease within the family is spo-

radic. Of the 30 affected individuals, 23 were males, representing 60.5% of males descended from female lineages and at risk of developing the disease. Of these, 4 were the offspring of affected females and 19 of unaffected females. Further analysis of the pedigree showed that there were 20 obligate female carriers who were either themselves clinically affected or whose offspring had the disease. On the other hand, no affected male was found to have transmitted the disease to his offspring. Visual Evoked Potential (VEP) examination was carried out in the previous study to investigate its usefulness as a predictor of the potential of the unaffected family members of the family to develop the clinical signs of LHON. Several members of the family showed abnormal VEP (Carroll and Mastaglia 1979). Of these, subjects V-18, V-22, V-23 and VI-19 were of particular interest (Fig. 1). These family members are descendants of the male lineages of the family, and the abnormal VEP might indicate a paternal modifying factor in the expression of the disease. None of these subjects, however, showed the clinical or sub-clinical signs of LHON in the up-date study, and repeat examination could not confirm the abnormal VEP.

Definition of the molecular defect To determine whether the 11778 G to A base substitution observed in the North American and the European LHON families also occurs in our Western Australian family, the nucleotide sequence of this region of the mtDNA from one affected member of the family was determined (VI-17). The strategy employed involved the PCR amplification of a 1.6 kb segment of the patient's mtDNA, extending from nucleotides 11580 to 13200 (see Table 1 for the PCR primers employed). The amplified fragment was cloned into the pUC19

a

Fig. 1. Maternal inheritance of LHON in the Western Australian family. Six-generation pedigree of a Western Australian familywith LHON, showingaffectedand asymptomaticmembersafter clinical and neuroophthalmologicalexaminations in 1977and 1985.Note that cases IV-13and VI-13 became symptomaticallyaffectedbetween the two examinations, having previouslyshown only asymptomaticabnormalities. • D = male, oO = female, • • = affected, X = deceased, [] O = asymptomatic;atypicalor mildlyabnormal VEP.

11 cloning vector for sequencing. The sequencing data (Fig. 2) clearly demonstrated the 11778 G to A substitution in the mtDNA of this family member.

tfeteroplasmy of the mtDNA in LHON - restriction endonuclease analysis of the mtDNA with SfaN! The 11778 G to A base substitution is associated with the loss of an SfaN! restriction site, and thus providing a relatively simple diagnostic means to detect the base substitution in other members of the Western Australian family. Based on the published human mtDNA sequence (Anderson et al, 1981), 23 fragments are predicted to be produced by the SfaN! digestion, some of which are of very similar sizes, including those associated with the loss of the site at nt 11778. Two strategies have been, therefore, devised to simplify the routine detection of this mutation. The first of these strategies involved the PCR amplification of a segment of the mtDNA which included nt 11778, extending from nt 11580 to nt 11942, with the use of two synthetic oligonudeotides, corresponding to nt 11580-11603 and

G

A

T

C

nt 11942-11918 of the human mtDNA; the amplified mtDNA segment was then digested with SfaN I restriction endonuclease to analyse for the presence of the restriction site at nt 11778. The second strategy, illustrated in Fig. 3, involved a direct digestion of total mononuelear cell DNA with SfaN I, followed by the detection of the relevant restriction, fragments by Southern blotting employing the two synthetic oligonucleotides as hybridization probes. Two fragments of 915 and 679 bp should be detected in normal controls, with the SfaNl site at nt 11778 intact as illustrated in Fig. 3. The loss of this site in LHON would result in the detection of a single fragment of 1594 bp. The last strategy was employed to examine the mtDNA of representative members of the Western Australian family, which included V-9, V-16, V-17 and VI-5 who showed no clinical or sub-clinical signs of LHON, and 111-13, IV-12, V-I1, VI-17 and Vl-18 who were clinically affected. Of particular significance was the observation that while the mtDNA from the at'-

G

A

T

C,

A

0

°7

elm,~

G A

0

A

Fig. 2. Nucleotide 11778 G to A substitution in the mtDNA of the Western Australian family. A segment of the mtDNA from family member VI-17, extending from nt 11580 to 13200, was amplified by PCR, cloned into pUC19 vector and sequenced as described in "Patients and methods". The base substitution at nt 11778 in the ND4 gene, which converts a G of the Cambridge sequence (Anderson et al~ 1981) to an A in the LHON mtDNA, is indicated. Also indicated is a normal morph at nt 11720: an A in both the control and the LHON mtDNA samples, a G in the Cambridge sequence (Anderson et al. 1981).

12 N

L

.Q

< 1594

ILl N

Q. ~

Q. .D

~ .Q

It)

O)

(D

A

i

¢) 9 1 5 =,6 7 9 ~.

V1-18 ND4L

ND4

ND5

115a0_.. t

~194~ t

10863

Z

t

11778

12457

Fig. 3. Strategy for the restriction endonuclease analysis of the mtDNA for the nt 11778 G to A substitution, DNA samples from the LHON patient VI-17 (L) and a normal control (N) were digested with SfaNI restriction endonuclease. The digestion products were separated by electrophoresis on a 2% agarose gel, and the relevant fragments visualized with the use of two a-'P-labelled synthetic oligonuclcotides (corresponding to nt 11580-11603 and nt 1194211918 of the light and the heavy strands of human mtDNA, respectively) as hybridization probes, These hybridization probes simplify the specific detection of the SfaNI restriction site at nt 11778 (bottom panel). The top panel shows the SfaNI restriction patterns of the normal control (915 bp and 679 bp) and the LHON patient VI-17 (1594 bp). One of the oligonucleotide probes (nl 11942-11918) did not hybridize as efficiently as the other under the experimental conditions, resulting in the uneven intensity of the bands representing the 915 bp and the 679 bp restriction fragments in the autoradiogram.

fected member VI -17 was almost completely resistant to the SfaNl digestion at nt 11778, the mtDNA from V-9 showed partial digestion at this site (Fig. 4). This observation suggested the presence of two populations TABLE 2

V-9

,J I 0

I 20

I 40

~J~. I 60

V-16 I 80

I 100

DISTANCE (crn) Fig. 4. Restriction endonuclease analysis of the mtDNA from clinically affected and unaffected members of the family, DNA samples, isolated from the mononuclear cells of 3 members of the Western Australian LHON family, were digested with SJ'aN! restriction endonuclease, and subjected to electrophoresis on a 2% agarose gel DNA fragments were transferred onto nylon filters (Hybond N, Amersham), and probed with 32P-labelled oligonueleotides as in Fig. 3. The autoradiograms obtained were scanned by using an LKB 2202 Laser Densitometer. Shown are the scans of the affected family member VI-18 showing a single peak of the 1594 bp fragment, the unaffected family member V-9 showing 3 peaks corresponding to the 1594 bp, 915 bp and 679 bp fragments, and the unaffected family member V-16 showing the presence of the 915 bp and 679 bp fragments only.

RFLP AT nt 11778 IN THE mtDNA OF MEMBERS OF THE WESTERN AUSTRALIAN FAMILY Family member

Clinical manifestation

Lineage

lil.13 IV-12 V-9 V-16 V-17 VI-5 V1-11 Vl-17 VI-18

Affected Affected Not affected Not affected Not affected Not affected Affected Affected Affected

Maternal Maternal Maternal Paternal Paternal Maternal Maternal Maternal Maternal

SfaNI site at nt 11778 + and + + -

of mtDNA in this family member, one with the nt 11778 G to A substitution and one of the normal type. The analysis of a clinically unaffected member of the family from the sixth generation (VI-5), however, showed only the mutated mtDNA species (Table 2), similar to 3 affected members of the same generation. Furthermore, two affected members of the earlier generations (IV-12 and Ill-13) also showed the mtDNA species carrying the 11778 G to A substitution only (Table 2). Consistent with the maternal inheritance of the mtDNA, family members V-16 and V-17 showed

13 the normal type of mtDNA with regard to the SfaN ! site at nt 11778.

Discussion

A G to A transition at nt ! 1778 of the mtDNA, first detected by DNA sequencing in a 3-generation black family from Georgia, U.S.A. (Wallace et al. 1988, 1989), has been shown to be present in the Western Australian LHON family members examined in this study. The finding adds to the growing evidence in support of the suggestion that this genetic lesion is a causal mutation in LHON. The suggestion of a causal relationship between the nt 11778 G to A base substitution and LHON has been based on 3 lines of evidence. First, studies of independent LHON families have revealed a significant correlation between this base substitution and the manifestation of the disease. Besides in the original Georgian family, the G to A transition has also been suggested by the loss of an SfaN! site at nt 11778 in 8 additional LHON families initially studied (3 from North America and 5 from Finland; Wallace et al. 1988), in a Japanese family (Yoneda et al, 1989), and in 10 Finnish families (Vikki et al. 1989). Second, the nt 11778 G to A substitution affects a highly conserved residue 340 of the ND4 subunit of the respiratory complex I (NADH-coenzyme Q reductase). An arginine, which is maintained in this position in such evolutionarily diverse organisms ranging from fungi to human (Wallace et al. 1988), is converted to a histidine as the consequence of the nt 11778 mutation. The third and most convincing line of evidence for a causal relationship between the nt i 1778 G to A mutation and LHON came from the study of restriction fragment length polymorphisms in the mtDNA of 3 independent U-ION families: one American black and two white European families (Singh et al. 1989). A phylogenetic tree for mtDNA polymorphism and sequence variants from 3 probands of these families and 4 controls suggested that the mutation at nt 11778 is associated with two mtDNA backgrounds - an American black mtDNA and a European mtDNA. It was concluded, therefore, that the mutation at nt 11778 must have arisen twice independently. In order to determine the phylogenetic relationship between the nt 11778 mutation observed in the Western Australian family and those reported for the American black and the two white European families, a study of restriction fragment length polymorphism has been carried out on two members of the Western Australian family (L. Moehario and S. Marzuki, unpublished observation). A set of 6 restriction endonucleases was used which included Avall, BamHl, Haell, HinclI, HpaI, and Mspl which is an isoschizomer of

Hpall; this set of restriction endonucleases is the standard set used by Wallace's laboratory in the study of human mtDNA RFLP (see Johnson et al. 1983; Wallace et al. 1985) and selected to allow a comparison to the previous study (Singh ct al. 1989). in all cases, however, the morphs observed were those of the most commonly found in the normal caucasian population (L. Moehario and S. Marzuki, unpublished observation), thus the mtDNA of the Western Australian LHON family appears to be of type 1-2 (Johnson et al. 1983; Wallace et al. 1985), the most common mtDNA type found. Since the two European LHON families previously studied also exhibited mtDNA type 1-2, it is not possible to conclude from this result whether the nt 11778 G to A mutation in the Western Australian family has arisen independently of the mutations in the European families. While the accumulated body of evidence has now left little doubt of a causal relationship between the nt 11778 G to A base substitution and LHON, many important questions with regard to the pathogenesis of this inherited disease remain to be answered. First, the available evidence indicates that the nt 11778 base substitution is not the only mutation which could lead to LHON. Thus, studies of the SfaN I polymorphism at nt 11778 revealed the loss of this site in only 9 of 11 LHON families initially studied in Wallace's laboratory (3 from North America and 5 from Finland; Wallace et at 1988) and in 10 only out of 19 Finnish families (Vikki et al. 1989). A genetic heterogeneity in the molecular lesions underlying LHON is thus suggested (Vikki et al. 1989; Howell and McCullough, 1990). The pathogenetic relationship between the Arg340 to His amino acid replacement in the ND4 subunit of the respiratory complex I and the clinical expression of LHON is also far from being clear. The mutation appears to be present in a wide range of tissues of individuals with U-ION which have been examined to date, including white blood cells, platelets and skeletal muscle. The clinical expression of the disease, however, is in most cases restricted to the optic nerve although in certain patients cardiac conduction abnormalities predominate. The ND4 subunit is one of the 7 subunits of the respiratory complex 1 (NADH-coenzyme Q reductase) which are synthesized within the organelle, and it is reasonable to expect that the amino acid substitution would affect this enzyme activity, if the nt 11778 A to G base substitution played a role in the pathogenesis of the disease. It is not practically possible, however, to determine the levels of the respiratory complex I activity in the affected tissue in this case, because of the limitation in obtaining suitable biopsy or autopsy materials. By the time the disease is clinically,manifested as blindness, most of the cells in the affected tissue would have been replaced by connective tissue, presumably

14 due to the cell death associated with the underlying but undefined biochemical defect(s). A recent study has suggested the reduction in the NADH-coenzyme Q reductase activity in the fibroblast cell lines derived from patients with LHON (Parker et al. 1989), but the mtDNA lesion in these patients was not defined. In contrast, no decrease in the mitochondrial respiratory activity was detected in the fibroblast cell lines derived from patients VI-17 and Vl-18 of the Western Aus-

tralian family investigated in the current study (data not shown), in keeping with the tissue-specific clinical expression of the disease. The observation that the clinical manifestation of the disease is not usually apparent before adolescence indicates that the mutation probably only leads to a mild reduction in the respiratory complex I activity, and that the residual activity is sufficient to maintain normal functions in the initial stage of life. An age-re-

NUCLEUS H

M

L

H

M

L

mutational alteration

W

V

Normal

Defective MITOCHONDRIA

Fig. 5. Tissue-specific expression of mtDNA mutation: nuclearly coded protein subunits of the respiratory enzyme complex as a phenotypic modifier. The potential role of the nuclearly coded subunits of the mitochondrial respiratory enzyme complexes in determining the tissue-specific expression of a mitochondrial mutation is diagramatically shown. The simplified model shows the interaction of two protein subunits in an assembled enzyme complex: one mitachondrially synthesized (black) and one nuclearly coded and imported from the cytoplasm (shaded). According to this model, the nuclearly coded subunit exists in different tissue-specific isoforms (e.g. H, M and L), but there is only one form of the mitochondrially coded subunit. The mutational alteration to the mitochondrially coded subunit shown in the right panel is subtle, and still allows a normal assembly of the enzyme complex in H and L but not M, thus resulting in a tissue-specific expression of the mitochondrial mutation.

15 lated decline in the levels of the respiratory enzyme activity (Trounce et al. 1989) might then occur, and a clinical manifestation becomes apparent when the activity falls below a threshold level required to support normal cellular functions. The decline in the mitochondrial respiratory activity would eventually lead to cell death, accelerating further decline in the tissue capacity for oxidative energy metabolism. Several interacting factors are most likely to be involved in determining the relatively tissue-specific phenotypic expression of the nt 11778 mutation. While the specific tissue demand for oxidative metabolism is obviously a major factor, it is not sufficient to explain the tissue specificity. Thus, while the two organs mostly affected in LHON, the optic nerve and the cardiac conduction system, are indeed dependent to a large extent on oxidative metabolism for their production of ATP, other organs which are also dependent primarily on oxidative energy metabolism, such as the brain and the skeletal muscle, are not normally affected in LHON. Furthermore, pathological changes associated with the neuroretinal degeneration observed in LHON are not seen in other mitochondrial respiratory diseases where specific deficiency of the mitochondrial respiratory complex I or the cytochrome oxidase complex has been demonstrated. One of the most likely tissue-specific modifying factors of the expression of a mitochondrial mutation is probably the nuclearly coded subunits of the respiratory enzyme complex. The respiratory complex I is assembled from more than 26 protein subunits (Ragan et al. 1982), only 7 of which are coded for by the mtDNA and synthesized within the organelle (Chomyn et al. 1985); the remaining subunits are synthesized in and imported from the extra-mitochondrial cytoplasm. It has became apparent in recent years that many of the nuclearly coded subunits of the mammalian respiratory enzyme complexes, in particular those of the cytochrome oxidase complex (Kuhn-Nentovig and Kadenbach 1985), exist as tissue-specific isoforms. The expression of a mitochondrial mutation such as the nt 11778 transition in LHON could be modified, for example, by the interaction of the altered mitochondrially synthesized subunit with the nuclearly coded subunits. According to this model of the mechanism of tissue specificity, as diagramatically depicted in Fig. 5, a defective enzyme complex occurs only as the result of the assembly of the altered mitochondrially synthesized subunit with certain tissue-specific subunits; the assembly with the isoforms in other organs produces a relatively normal complex. The presence of developmentspecific isoform(s) of the nuclearly coded subunits might also provide an additional explanation for the late onset of the clinical manifestation. Of particular significance with regard to our understanding of the genetic transmission of human mtDNA

mutations is the observation in the present study of two populations of the mtDNA in a clinically unaffected family member V-9. A population of mtDNA carrying the nt 11778 mutation was found to co-exist with a normal population of mtDNA in this patient. Only mtDNA carrying the substitution could be detected, on the other hand, in the leukocytes of 4 members of the sixth generation of the family examined. This observation is in contrast to the results of restriction endonuclease analyses with SfaNI in the North American (Wallace et al. 1988a), Japanese (Yoneda et al. 1989) and Finnish (Vikki et al. 1989), LHON families previously reported, which suggested that the nt 11778 mutation is homoplasmic, but consistent with a recent report (Vikki et al. 1990). The observation of mtDNA heteroplasmy in a member of the Western Australian family suggests that the nt 11778 mutation in this LHON family is relatively new, consistent with the idea that it has probably arisen independently from the mutations in the other reported LHON families. Further, the observation of both heteroplasmy and apparent homoplasmy of the mtDNA in different members of the family could provide an insight into the normal progression in the establishment of a mitochondrially inherited mutation. An initial heteroplasmic phase is most likely to exist following a mutational event, before the enrichment of either types of the mtDNA occurs in the subsequent generations as the result of the random nature of mtDNA segregation during cell division and meiosis. The observation of the heteroplasmy of the mtDNA in the 6-generation Western Australian family is particularly interesting in the light of the report of Hauswirth and Laipis (1985) of the bottle-neck effect of oogenesis and early embryogenesis, manifested in a relatively rapid return to mtDNA homoplasmy of heteroplasmic lineages of Holstein cows. According to this study, if heteroplasmy existed in a pedigree, a shift to the normal-type or the mutant mtDNA homoplasmy would be observed in some maternal lines. The randomness of mtDNA segregation associated with such a shift is reflected in the present study by the observation that two members from earlier generations, but of a different branch of the family from V-9, in particular 111-13 of the third generation, showed an apparent homoplasmy for the mutated mtDNA. Further study involving the majority of the surviving members of the Western Australian family has been initiated to obtain detailed information on the segregation of the mutated and the normal mtDNA species in this family, which provide the most extensive model for the study of the vertical transmission of human mtDNA to date. Heteroplasmy of the mtDNA has been suggested to be one of the possible molecular bases of the tissuespecific and the sporadic clinical expression of mitochondrial respiratory chain disorders, in particular in

16 the MERRF encephalomyopathy and the CPEO syndrome. The mtDNA heteroplasmy observed in the Western Australian family, however, cannot provide a satisfactory explanation for the sporadic nature of the clinical expression in this LHON family; no correlation was apparent between the mtDNA heteroplasmy and the clinical expression of the disease in different members of the Western Australian family. Thus, other factors must be involved in determining whether the nt 11778 G to A mutation is phenotypicaUy expressed. Such factors might include, for example, polymorphic variants of the nuclearly coded subunits of the respiratory complex I. in different individuals. In conclusion, besides providing a significant support to the suggestion that the nt 11778 G to A base substitution is a causal mutation in LHON, the study described in this communication has highlighted the potential importance of nudear-mitochondrial interactions in the phenotypic expression of mitochondrial mutations. Recent developments in molecular, cell and membrane biology have provided a new array of powerful procedures to allow a major inquiry into the question of the role of nuelear-mitochondrial interactions in the expression of mitochondrial mutations in mammals. The establishment of fibroblast or myoblast cell lines from patients, for example, would open the way for an in-depth study of the inheritance and the phenotypic consequences of mtDNA heteroplasmy. The availability of such cell lines would allow a wide range of physiological and further genetic manipulations to be carried out. It might be possible to induce the synthesis of different sets of isoforms for the nuclearly synthesized subunits of the respiratory enzyme complex in such cell lines, by employing various differentiation inducers, to allow direct examinations of their effects on the phenotypic expression of mitochondrial mutations. The recent success in the development of mtDNA-less mammalian cell lines, by the elimination of the mtDNA with ethidium bromide (King and Attardi 1989), has also provided a powerful alternative procedure to alter the nuclear background of a mitochondriai genome; the mitochondrial genome of interest can be readily introduced to a mtDNA-less cell line by fusion with enueleated cells derived from patients, or by mieroinjection. Information derived from such studies is not only of medical and clinical relevance, but is also of fundamental significance to our basic understanding of human cell biology.

Acknowledgments This study was supported by Grant 8900083 from the National Health and Medical Research Council of Australia. We thank Miss Michelle Zorbas for her assistance in the PCR amplification of the mtDNA and Dr. Patcharee Lertrit for her assistance in the cloning of the PCR fragment into the pUC 19 cloning vector.

References Anderson, S., Bankicr, A.T., Barrell, B.C., De Bruijn, M.H.L., Coulson, A.R., Drouin, J., Eperon, I.C., Nierlich, D.P., Roe, B.A., Sanger, F., Schreier, P.H., Smith, A.J.H., Staden, R. and Young, i.G. (1981) Sequenceand organization of the human mitochondrial genome. Nature, 290: 457-465. Birnboim, H.C. and Doly, Jo (1974) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res., 7: 1513-1523. Bogenhagen, D. and Clayton, D,A. (1974) The number of mitochondrial deoxyribonucleicacid genome in m;ouseL and human HeLa cells. J. Biol. Chem., 249: 7991-7995. Brown, W.M. (1980) Polymorphisms in mitoehondrial DNA of human as revealed by restriction endonuclease analysis. Proc. Natl. Acad. Sci. U.S.A., 77: 3605-3609. Cagianut, B., Rhyner, K., Furrer, W. and Schnebli, H.P. (1981) Thiosulphate-sulphur transferase (rhodanese) deficiency in Leber's hereditaw optic atrophy. Lancet, ii: 981-982. Carrol, W.M. and Mastaglia, F.L. (1979) Leber's optic neuropathy. A clinical and visual evoked potential study of affected and asymptomatic members of a six-generation family. Brain, 102: 559-580. Chomyn, A., Marionini, P., Cleeter, M.WJ., Ragan, C.I., MastuniYagi, A., Hatefi, Y., Doolittle, R.F. and Attardi, G. (1985) Six unidentified reading frames of human mitochondrial DNA encode components of the respirator-chain NADH dehydrogenase. Nature, 314: 592-597. Erickson, R.P. (1972) Leber's optic atrophy, a possible example of maternal inheritance. Am. J. Hum. Genet., 24: 348-349. Giles, R.E., Blanc, H., Cann, H.M. and Wallace, D.C. (1980) Maternal inheritance of human mitochondrial DNA. Proc. Natl. Acad. Sci. U.S.A., 77: 6715-6719. Hauswirlh, W.W. and Laipis, P.J, (1985) Transmission genetics of mammalian mitochondria: a molecular model and experimental evidence, in Achievements and Perspectives of Mitochondrial Research, Vol. Ii. Biogenesis, Quagliariello, E., Slaler, E.C., Palmieri, F., Saccone, C. and Kroon, A,M. (Eds.), Elsevier, Amsterdam, pp. 49-59, Howell, N. and McCullough, D. 0990) An example of Leber hereditaw optic neuropathy not involvinga mutation in the mitochondrial ND4 gene. Am. J. Hum. Gem, 47: 629-634. Johnson, M J , Wallace, D,C., Ferris, S.D., Ratazzi, M.C. and Cavalli-Sforza, L.L. (1983) Radiation of human mitochondrial DNA types analyzed by restriction endonuclease cleavage patterns. J, Mol. Evol., 19: 255-271. King, M.P. and Anardi, G. (1989) Human cells lacking mtDNA: repopulation with exogenous mitochondria by complementalion. Science, 246: 500-503. Kuhn-Nentovig, L. and Kadenbach, B. (1985) Isolation and properties of cytochrome c oxidase from rat liver and quantitation of immunological difference between iso~me from various rat tissues with subunit-specific antisera. Eur, J. Biochem., 149: 147158. Livingstone, I.R., Mastaglia, F.L., Howe, J.W. and Aherne, G.E.S. (1980) Leber's optic neuropathy: clinical and visual evoked response studies in asymptomatic and symptomatic members of a 4-generation family. Br. J. Ophthalmol., 64: 751-757. Nikoskelainen, E. (1984a) New aspects of the genetic, etiologic, and clinical puzzle of Leber's disease. Neurology, 34: 1482-1484. Nikoskelainen, E., Paljarvi, L., Lang, H. and Kalimo, H. (1984b) Leber's hereditary optic neuroretinopathy; a mitoehondrial disease.'? Acta Neurol. Scand., 98: 172-173. Nikoskelainen, E.K., Savontaus, M.L., Wanne, O.P., Katila, M.J. and Nummelin, K.U. (1987) Leber's hereditary optic neuroretinopathy: a maternally inherited disease. Arch. Ophthalmol., 105: 665-671.

17 Novotny, E.J. Jr, Singh, G., Wallace, D.C., Dorfman, LJ., Louis, A., Sogg, R.I. and Stenman, L. (1986) Leber's disease and dystonia: a mitochondriai disease. Neurology, 36: 1053-1060. Parker, W.D. Jr, Oley, C.A. and Parks, J.K. (1989) A defect in mitochondrial electron-transport activity (NADH.coenzyme Q oxidoreductase) in Lcber's hereditary optic neuropathy. New Engl. J. MOd., 320: 1331-1333. Ragan, C.I., Galante, Y.M. and Hatefi, Y. (1982) Purification of three iron-sulfur proteins from the iron-protein fragment of mitochondr/al NADH dehydrogenase and isolation of two iron-sulfur proteins. Biochemistry, 21: 590-594. Saiki, R.K, Scharf, S,, Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and Arnheim, N. (1985)Enzymatic amplification of fl-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science, 230: 1350-1354. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual, 2nd edn., Cold Spring Harbor Laboratory Press, New York. Singh, G., Lott, M.T. and Wallace, D.C. (1989) A mitochondrial DIqA mutation as a cause of Leber's hereditary optic neuropathy. New Engl. J. Med., 320: 1300-1305. Southern, E.M. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. MoL Biol., 98: 504-517. Tapper, D.P., Van Etten, R.A. and Clayton, D.A. (1983) Isolation of mammalian mitochondrial DNA and RNA and cloning of the mitochondrial genome. Methods Enz~mol., 97: 429-434.

Trounce, !., Byrne, E. and Marzuki, S. (1989) Decline in skeletal muscle mitochondrial respiratory chain function: possible factor in ageing. Lancet, i: 642-645. Tzagoloff, A. and Myers, A.M. (1986) Genetics of mitochondrial biogenesis, Ann. Rev. Biochem., 55: 249-285. Vikki, J, Savontaus, M.L and Nikoskclainen, K. (1989) Genetic heterogeneity in Leber hereditary optic ncuroretinopathy revealed by mitochondrial DNA polymorphism. Am. J. Hum. Gcn., 45: 206-211. Vikki, J., Savontaus, M.L. and Nikoskelainen, E.K. (1990] Segregation of milochondrial gcnomes in a heteroplasmic lineage with Leber hereditary optic neuropathy. Am. J. Hum. Gcn., 47: 95-100. Wallace, D.C., Garrison, K. and Knowler, W.C. (1985) Dramatic founder effects in Amerindian mitochondrial DNAs. Am. J. Phys. Anthropol., 68: 149-1.55. Wallace, D.C., Singh, G., Lott, M.T., Hodge, J.A., Scht~rr, T.G., Lczza, A.M., Elsas 11, LJ. and Nikoskelaincn, E.K. (1988). Mitochondrial DNA mutation associated with Leber's hereditary optic neuropathy. Science, 242: 1427-1430. Wallace, D.C. 0989) Mitochondrial DNA mutations and neuromuscular disease. Trends Gen., 5" 9-13. Yoneda, M., Tsuji, S., Yamauchi, T., inuzuka, T., Miyatak¢, T., Horai, S. and Ozawa, T. (1989) Mitochondrial DNA mutation in family with Leber's hereditary optic neuropathy. Lancet, i: 10761077.