Dev Genes Evol DOI 10.1007/s00427-015-0489-0

ORIGINAL ARTICLE

Molecular cloning, expression, and evolution analysis of type II CHI gene from peanut (Arachis hypogaea L.) Yu Liu & Shuzhen Zhao & Jiangshan Wang & Chuanzhi Zhao & Hongshan Guan & Lei Hou & Changsheng Li & Han Xia & Xingjun Wang

Received: 17 August 2014 / Accepted: 13 January 2015 # Springer-Verlag Berlin Heidelberg 2015

Abstract Chalcone isomerase (CHI) plays critical roles in plant secondary metabolism, which is important for the interaction between plants and the environment. CHI genes are widely studied in various higher plants. However, little information about CHI genes is available in peanut. Based on conservation of CHI gene family, we cloned the peanut type II CHI gene (AhCHI II) cDNA and genome sequence. The amino acid sequence of peanut CHI II was highly homologous to type II CHI from other plant species. qRT-PCR results showed that peanut CHI II is mainly expressed in roots; however, peanut CHI I is mainly expressed in tissues with high content of anthocyanin. Gene duplication and gene cluster analysis indicated that CHI II was derived from CHI I 65 million years ago approximately. Our gene structure analysis results are not in agreement with the previous hypothesis that CHI II was derived from CHI I by the insertion of an intron into the first exon. Moreover, no positive selection pressure was found in CHIs, while, 32.1 % of sites were under neutral selection, which may lead to mutation accumulation and fixation during great changes of environment. Communicated by Sureshkumar Balasubramanian Yu Liu and Shuzhen Zhao contributed equally to this work. Y. Liu : S. Zhao : J. Wang : C. Zhao : L. Hou : C. Li : H. Xia : X. Wang (*) Bio-Tech Research Center, Shandong Academy of Agricultural Sciences, Shandong Provincial Key Laboratory of Crop Genetic Improvement, Ecology and Physiology, Jinan 250100, People’s Republic of China e-mail: [email protected] H. Guan : X. Wang College of Life Sciences, Shandong University, Jinan 250100, People’s Republic of China Y. Liu : X. Wang College of Life Sciences, Shandong Normal University, Jinan 250014, People’s Republic of China

Keywords Arachis hypogaea L . Molecular cloning . Expression . Evolution . Chalcone isomerase

Introduction Chalcone isomerase (CHI) is the key enzyme of the phenylalanine metabolism pathway, which produces several kinds of flavonoids. For example, anthocyanin, an important pigment widely distributed in different plant tissues, especially in flowers and fruits, is one kind of flavonoid. Flavonoids are widely present in plants and play important roles in different biological processes, such as UV protection, plant color formation (Koes et al. 2005), pathogen resistance (Brenda 2002), pollen development, plant hormones transportation (Bogs et al. 2006), and the interactions between legume roots and rhizobium. Arabidopsis mutant containing higher flavonoids than wild-type plants could survive under high UV radiation (Ormrod et al. 1995). Insufficient level of flavonoids has been shown to inhibit pollen tube formation in maize and petunia, and exogenous application of flavonol to the pistil could reactivate the growth of pollen tubes (Mo et al. 1992). The relative molecular mass of chalcone isomerase is from 24 to 29 kDa. The core structure of the enzyme is composed of one large β-sheet containing six β-sheet, seven α-helices, and three short β-strands on the opposite face of the large β-sheet (Jez et al. 2000). CHI peptide chains show high homology (49–82 %) in many plant species (Jez et al. 2000); the homology of the same type of CHIs was more than 70 %, and the homology of different types of CHI was less than 50 % (Shimada et al. 2003). Two major types of CHI genes, type I and type II, have been identified from plants. Type I CHI catalyzes 6-hydroxy-chalcone into

Dev Genes Evol

(2S)-5- hydroxy-flavonoid. Type I CHI has been found in most of plant species, such as barley, rice, petunia, alfalfa, and peanuts (Druka et al. 2003; van Tunen et al. 1988; McKhann and Hirsch 1994; Zhang et al. 2012), while Type II CHI is mainly found in leguminous plants. Type II CHI exhibits the function of Type I CHI, and it also can use 6-deoxidation-chalcone as substrate to synthesize 5-deoxy-flavonoid (Dixon et al. 1988). Jez et al. (2000) suggested that Thr 190 and Met 191 in α6 may affect substrate preference in type II CHI. In non-legume plants that has no type II CHI, a Ser and an Ile replace Thr 190 and Met 191, respectively. This is the significant difference between Type I and Type II CHIs. Moreover, difference in amino acid sequence between two types of CHIs mainly existed in the α3, β3c, and β3d regions; while, the conserved residues distributed in the β3a, β3b, α4, and α6 regions. These conserved residues form the substrate recognition structure on the protein surface (Jez et al. 2000). CHI plays a significant role in pigment synthesis and flower, fruit, and seed color formation. A mutation occurred in the promoter region of petunias CHI resulted in decreased expression of CHI and generated yellow- or greencolored pollen (Bednar and Hadcock 1988). Overexpression of petunias CHI in tomato led to the significant increase of flavonoids in fruit (Muir et al. 2001). Inactive CHI in Zea mays produced bronze seeds (Dooner et al. 1991). Reducing the expression of CHI in China aster (Forkmann and Dangelmayr 1980), Dianthus caryophyllus (Kuhn et al. 1978), and Cyclamen persicum (Takamura et al. 1995) resulted in yellow flowers. The regional distribution of flavonoid pigments is closely connected with distribution of insects, pollinators of many plants. Therefore, the CHI activity may indirectly influence plant reproductive process (Harborne and Williams 2001). Flavonoids play a crucial role in the interaction between plant and microorganism (Stafford 1997). The nodules in roots of legume plants are helpful for nitrogen fixation. Flavonoids play important roles in the interaction among root, soil, and microorganisms (Peters et al. 1986). For example, flavonoids act as nod-gene inducer in initiating steps of nodulation, and flavonoids accumulate in epidermal cells of roots at different developmental stages (Dixon and Paiva 1995). In addition, flavonoids could also act as inducible antimicrobial phytoalexins (Stafford 1997). Previous studies indicated that 95 % isoflavones are identified from legume plants, and 60 % flavonoids in legumes are 5-deoxidization flavanones (Hegnauer and Gpayer-Barkmeijer 1993). Type II CHI is a key enzyme in 5-deoxidization flavanone synthesis. In the current study, the full-length cDNA of Type II CHI was cloned from peanut, the expression and evolution analysis was performed. The results provide valuable information to understand the regulation and evolution of the type II CHI.

Materials and methods Plant materials All plants were grown in the experimental farm of Shandong Academy of Agricultural Sciences. Tissues of peanut root, stem, leaf, flower, and seed (with seed coat) were from cultivated peanut varieties Luha14 (LH14), Zhonghua9 (ZH9) and a variety with purple stem and leaf (GX029). Flower, stem, root, and leaf were collected at the flowering and pedicelforming stage while seed were collected at the pod setting phase. All tissues were frozen in liquid nitrogen immediately after being collected from the plants, and stored at −80 °C freezer for RNA extraction. LH14 and GX029 were from our laboratory, and ZH9 was from the Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences. AhCHI II sequence analysis One type II CHI has been identified from the peanut transcriptome database (BioProject: PRJNA181974) (Xia et al. 2013). This gene shows high similarity to Glycine max type II CHI (BT089242). Sequence information analysis was carried out using DNASTAR software (DNASTAR, Inc.) and NCBI ORF finder program. Primers used for PCR cloning was designed by PrimerPremier 5.0 program (Table 1). Total RNA isolation CTAB extraction solution (100 mM Tris, 2.0 M NaC1, 25 mM EDTA, pH 8.0, 2 % CTAB, 2 % β-mercantoethanol) was used to extract total RNA from 0.2 g frozen peanut tissues (root,

Table 1

Sequences of primers used in this research

Primer

Usage

Sequence

ChiII-F ChiII-R ChiI-GSP1 ChiI-GSP2

Gene clone

GTACCCAATTTGCCCTCTGA TTAGAACTCAATGGAGGGATTG CTCCTGCTCCGCCAAGGAAGAA GGACAAGGAGGAGGGTAGGA CCAT GGTGTGACCACTGGCGGGAATT GCGAGGGATGCTGCCTTCACCAT GGTAAGACCCCGAGCGAGTT AGACTTTCTGGGAGTATTGTTG ACC CAAGGATGACACAATACCAGAA CATAG GGAAACAGGAATCTCCCCAATC GTCATCGTCATCCTCTTCTC CATTCCTGTTCCATTGTCAC

ChiII-GSP1 ChiII-GSP2 QrtI-F QrtI-R

Flank sequence clone

qRT-PCR

QrtII-F QrtII-R AhActinF AhActinR

Reference gene

Dev Genes Evol

stem, leaf, seed coat, and flower) from three peanut varieties (ZH9, LH14, and GX029). The samples were incubated at 65 °C for 5 min. Equal volume of chloroform- and watersaturated phenol was added and mixed thoroughly. After centrifugation, the supernatant was collected and equal volume chloroform was added and mixed by vortex. After centrifugation, the aqueous phase, containing the RNA, was transferred to a clean tube and was precipitated with one third volume of 8 M LiCl, stored for 8 h at −20 °C and centrifuged at 12, 000 rpm for 20 min at 4 °C. RNA was washed with 75 % ethanol, air dried, and resuspended with DEPC H2O. cDNA was synthesized using 200 ng of total RNA by Fermentas RevertAid Frist Stand cDNA Synthesis Kit. DNA extraction and amplification of CHI II genomic sequence DNA extraction was performed by CTAB method (Porebski et al. 1997). Briefly, 0.5 g leaves were ground in liquid nitrogen and then 600 μl 60 °C CTAB extraction buffer (100 mM tris, 1.4 M NaC1, 20 mM EDTA, pH 8.0, 2 % CTAB, 0.8 % β-mercantoethanol) was added and mixed thoroughly. The sample was incubated in a 60 °C water bath for 30 min. Then, 600 μl of 100 % isoamyl alcohol was added and mixed, kept at room temperature for 10 min. After centrifugation, liquid supernatant was collected, and an equal volume of chloroform was added and mixed. After centrifugation at full speed, the top aqueous solution was transferred to a new tube. DNA was precipitated by mixing with an equal volume of 100 % isopropanol and incubating at −20 °C for 10 min. After centrifugation, the DNA pellet was washed with cold 95 % ethanol and dissolved in 50 μl ddH2O. The primers were designed according to the full-length cDNA sequence (Table 1, ChiII-F and ChiII-R). The conserved sequence of peanut CHI II was amplified using 0.1 μg LH14 genomic DNA as template following TAKARA PrimeSTAR Manual (TAKARA, Inc.). The following PCR program was used: 98 °C for 3 min, followed by 35 cycles of 98 °C for 10 s, 55 °C for 5 s, and 72 °C for 30 s. PCR products were separated by 1 % agarose gel, extracted by Gel Extraction Kit (OMEGA, Inc.) and then ligated with blunt vector (TransGen, Inc,) for sequencing. According to the sequencing result of the coding region of CHI II, flanking sequences were obtained by DNA-walking following the instruction of the Universal Genome Walker Kit (CLONTECH, Inc.). Two rounds of semi-nested PCR amplification were performed using four pairs of primers (Table 1, ChiI-GSP1, ChiI-GSP1, ChiII-GSP1, ChiII-GSP2). The obtained PCR products were separated by 1.2 % agarose gel, and then purified by Omega Gel Extraction Kit (OMEGA, Inc.). The purified PCR product was ligated with the pMD18-T vector (Takara, Inc.), transformed into the competent E. coli cells (DH5-α) and sequenced. The sequencing

results were analyzed by LaserGene SeqMan software (DNAstar, Inc.) and BLAST programs. PLACE software was used to analysis cis-elements in CHI I and CHI II promoters. Gene expression analysis using real-time quantitative PCR Real-time quantitative PCR (qRT-PCR) was performed using the cDNA prepared above as template, with the primers for expression analysis of CHIs, which were designed with PerlPrimer v1.11 software (Table 1, QrtI-F and QrtI-R; QrtII-F and QrtII-R). For qRT-PCR, Fast Start Universal SYBR Green Master (ROX) kit was used. PCR reactions (20 μl) were performed in 96-wells Step One Plus RealTime PCR systems (Applied Biosystems, Inc.). PCR reactions were run in triplicate using the following conditions: 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min, and the melt curve was determined by 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s. The expression levels of mRNA were normalized with AhActin control. The relative expression level was calculated using the 2-ΔΔCt method (Livak and Schmittgen 2001). Analysis of gene duplication and chromosomal locations of CHIs The corresponding regions of G. max, Medicago sativa, Phaseolus vulgaris, Populus tremula, and Eucalyptus genomes were downloaded from Phytozome database. BLAST was used to detect CHI location using soybean CHI II (BT089242) sequence as query. Phytozome online tools were used for gene synteny analysis. Wild peanut (Arachis duranensis) genome data was downloaded from the Peanut Genome Project. CHI location and synteny analysis was acquired by using NCBI local Blast software. Mauve software (Darling et al. 2010) was used for homology analysis between CHI clusters of these plants. About 400 kp sequences containing CHI cluster were used as input data. Multiple sequence alignment and phylogenetic analysis NCBI and Phytozome database were used for phylogenetic analysis, and EMBOSS Transeq software was used for protein-coding prediction. The nucleotide sequence of 19 CHIs from 12 plant species was used to construct a phylogenetic tree. MrBayes software was used for detecting positive selection. The DNASTAR MegAlign software was used for corresponding codon-based nucleotide alignment. DAMBE software was used to convert sequence alignment results into PLAM data. Selection pressure of CHI was calculated by PAML software package with a maximum likelihood, each input sequence contained 729 bp. The program CODEML, from PMAL software package, was applied to calculate the

Dev Genes Evol

dN/dS ratio (or ω), the ratio of nonsynonymous-synonymous distances. Generally, ω=1, >1 and P>0.1) suggested that the M8 test result is not accurate, so there appears to be no positive selection applied to CHI during evolution. We found that the CHI I and CHI II frequently appeared in clusters. Recently, the genome sequence of the wild peanut species A. duranensis became available (http://peanutbase. org/files/genomes). Local BLAST analysis showed that CHI cluster was located on scaffold_AIPA6. The structure of this

Dev Genes Evol Fig. 4 The location of ROOTMOTIFTAPOX (denoted by star) in the upstream regulatory region of AhCHI family genes

region in wild peanut was similar to kidney bean (P. vulgaris) as shown in Fig. 1. CHI clusters have been studied in Lotus japonicas (Shimada et al. 2003). It can be argued that CHI II was derived from CHI I during evolution because of tandem duplication, and form a gene cluster. However, we also found that CHIs in several species were located at discrete genetic loci or on different chromosomes. These results showed that both tandem and segmental duplication plays important roles in evolution of CHI family. The analysis of three chromosome

segments, including CHIs from three plant species, suggested that these chromosome segments may derive from one ancestor. All chromosome segments (about 400 kb) used for this analysis contained the complete structure of CHI clusters. One segment from Eucalyptus grandis (Eg) and one segment from Populus trichocarpa (Pt) displayed great similarity to G. max (Gm) (Fig. 6). The boxes indicate conserved sequence between two specimens, matching rate was showed by waves in the boxes. It shows rearrangement and inversion

Fig. 5 The expression analysis of AhCHI using qRT-PCR normalized to Actin

Dev Genes Evol Table 2

Likelihood ratio test results of CHI genes using PAML software package (Website: http://abacus.gene.ucl.ac.uk/software/paml.html)

Model

lnL

Parameter

−8109.20 ω=0.23374 −7931.40 p0=0.36452 p1=0.32941 p2=0.30607 ω0=0.04940 ω1=0.21149 ω2=0.65681 M1a (neutral) −7969.40 p0=0.67922 p1=0.32078 ω0=0.13786 ω1=1.00000 M2a (selection) −7969.40 p0=0.67922 p1=0.22720 p2=0.09359 ω0=0.13786 ω1=1.00000 ω2=1.00000 M7 (beta) −7932.70 p=0.66458 q=1.64308 M8 (beta and ω) −7930.80 p0=0.91631 p=0.80239 q=2.60319 p1=0.08369 ω=1.00000

M0 (one rate) M3 (discrete)

Positive selection site

2ΔL

None None

355.00 P0.995

3.8

0.5>P>0.1

67I (0.642) 110P (0.883) 242H (0.556)

InL means log-likelihood, calculated by the codeml program of PAML. Likelihood ratio test (LRT) is calculated by 2ΔL using CHI2 program of PAML, 2ΔL=2×abs (A-B), A=lnL of complex model (M3, M2a, and M8), B=lnL of simple model (M0, M1a, and M7). The smaller the value of P indicates the more accurate result of the complex model (require less than 0.05). The LRT can be used for M3, M2a, and M8 model usability test

events have been ever happening after species divergence. Several large fragments, more than 50 kb, between Eg, Pt, and Gm are conserved, demonstrating that these chromosome segments are orthologous. It provided further evidence for the generation of CHI cluster. Cluster of CHI was discovered in Gm (2 CHI II and 1 CHI I), while only single CHI can be found in Eg (probably the ancient CHI) and Pt (CHI I). It suggested that CHI II could be generated from CHI I during evolution. In most cases, CHI II was colocalized with other CHIs in a chromosomal region, except that a single CHI II was located on chr10 of Gm. In the study of large scale genome of G. max, this may be due to large scale gene loss, including part of CHI clusters, during evolution from chr10 and chr20.

Fig. 6 Comparison of DNA region containing CHIs from Eucalyptus grandis, Populus trichocarpa, and Glycine max using MAUVE software. The boxes linked by oblique lines represent conserved DNA sequences. Matching rate is showed by waves in the boxes. Two pairs of large fragments, more than 50,000 bp, were conserved between Eucalyptus grandis, Populus trichocarpa, and Glycine max

Discussion In the present study, a novel peanut CHI II was cloned and analyzed. The sequence similarity was about 51 % between peanut CHI II and CHI I. The sequence similarity exceeded 70 % between peanut CHI II and CHI II from other legume plants. Promoters of peanut CHI I and CHI II were cloned, and analysis of the cis-elements of these two promoters indicated that CHI II may be mainly expressed in root, which was confirmed by qRT-PCR results. Changes in the coding region between two types of CHI family genes could lead to functional diversity (Ralston et al. 2005). In peanut, we found Ser192 in CHI I was replaced by Thr192 in CHI II, and this may affect substrate preference.

Dev Genes Evol

Shimada et al. (2003) suggested that in Lotus, type II CHI (Fig. 3a LjCHI3) was derived from type I CHI (Fig. 3a LjCHI2) after an intron insertion in the first exon of CHI I. However, we found evidences against this hypothesis. One CHI II containing two introns and three exons (Fig. 2, MtCHI2: Mt115820), also pointed by the arrow in Fig. 3a) was discovered in M. sativa. Eight type I CHIs from nonleguminous plants have four exons (Fig. 3a), the total length of the first exon and second exon in these type I CHIs was equal to the length of the first exon of type I CHIs that has only three exons in leguminous plants. The CHI-like gene in Selaginella moellendorffii, cannot assure which type of CHI it is due to the lack of biochemical experiment, has four exons (Fig. 3a, SmCHI). The first exon/intron junction sequence of this gene is “AGgt…agGT” (Fig. 3b), suggesting an intron insertion by tandem duplication after speciation (Rogers 1989). The second exon/intron junction shows similar exon sequence to AhCHI I and AhCHI II (Fig. 3b). S. moellendorffii is a member of an ancient vascular plant lineage that first appeared in the fossil record some 400 million years ago, earlier than leguminous plants. There is possibility that three exon CHIs in leguminous plant were generated by intron loss. However, this event may have no connection to the origin of CHI II. To estimate an absolute date for CHI duplications, the synonymous substitution (Ks) value was calculated by PAML, assuming clock-like rates of synonymous substitution (Ks) is 1.5×10−8 substitutions per synonymous site per year for dicots (Koch et al. 2000). Four Leguminosae plants, M. sativa, G. max, Pharsalus vulgaris, and Arachis hypogaca, were used for the calculation. CHI duplication episodes in all these plants were estimated to have occurred between 43.3 and 84.3 million years ago (Table 3). However, those values were not accurate because they were calculated by only a single dataset. Large fraction homology analysis showed that chromosomes containing CHI cluster from several Leguminosae and nonLeguminosae plants may be derived from one ancestor. In order to increase the estimation accuracy, we calculated the average value of duplication date between these plants, and the results showed that the estimated date of CHI II derived from CHI I is 65 million years ago (Table 3). The formation of Table 3 Estimation of the date for CHI family genes duplication events in Leguminosae Species

Ks

Estimate age (Myra)

Glycine max Phaseolus vulgaris Arachis hypogaea M. truncatula Average

1.30–1.47 2.28 2.53 1.71–2.32 1.935

43.3–49 76 84.3 57–77.3 64.5

a

1 Myr = 1,000,000 years

gene family through gene duplication is of great significance to plant evolution. Multiple copies of genes could provide more adaptation opportunities to the plant during evolution. In a gene family, multiple copies of a gene could evolve various types of structures or functions. Gene duplication is a common phenomenon in flowering plants which became the dominant species on earth in a relatively short time. Reproductive strategies of flowering plants have more opportunities to generate new genes, more mutations, and more survival opportunities during climate change in prehistoric age, especially in the period of great extinction of species during the upper Cretaceous and PETM period in the Paleocene, which occurred approximately 65–100 million years ago and 55 million years ago, respectively. These two events in history resulted in soil and ocean acidification, which could be the consequence of higher amounts of carbon dioxide in the atmosphere (Thomas et al. 2002). The decreased pH could affect the activity of nitrogen-fixing microorganisms in the ocean (Beman et al. 2011) or soil. Lack of nitrogen in the soil for plants and suitable environment for nitrogen-fixing bacteria could be the cause of symbiotic nitrogen-fixing bacteria to invade plant roots. We suspect that the emergence of CHI II, a key enzyme in the isoflavone synthesis pathway, is important for the interaction between nodulation and nodule bacteria. It could be interesting to determine whether the peanut cultivars that contain a higher content of isoflavones exhibit high capacity of nitrogen fixation or more nodulation in the root system. Acknowledgments This work is supported by the Shandong Province Germplasm Innovation and Utilization Project and grants from Shandong Province (BS2013SW006, 2012ZHZXIA0418, 201103023), the ministry of science and technology of China (2013AA102602; 2011BAD35B04), Young Talents Training Program of Shandong Academy of Agricultural Sciences, the Initial Special Research for 973 Program of China (2012CB126313), and Shandong Province Taishan Scholar Foundation (tshw20100416).

References Bednar RA, Hadcock JR (1988) Purification and characterization of chalcone isomerase from soybeans. J Biol Chem 263(20):9582– 9588 Beman JM, Chow CE, King AL, Feng Y, Fuhrman JA, Andersson A, Hutchins DA (2011) Global declines in oceanic nitrification rates as a consequence of ocean acidification. Proc Natl Acad Sci 108(1): 208–213 Benfey PN, Ren L, Chua NH (1989) The CaMV 35S enhancer contains at least two domains which can confer different developmental and tissue-specific expression patterns. EMBO J 8(8):2195 Bogs J, Ebadi A, McDavid D, Robinson SP (2006) Identification of the flavonoid hydroxylases from grapevine and their regulation during fruit development. Plant Physiol 140(1):279–91 Brenda WS (2002) Biosynthesis of flavonoids and effects of stress. Curt Opin Plant Biol 5(3):218–23

Dev Genes Evol Darling AE, Mau B, Perna NT (2010) Progressive mauve: multiple genome alignment with gene gain, loss and rearrangement. PLoS ONE 5(6):e11147 Dixon RA, Paiva NL (1995) Stress-induced phenylpropanoid metabolism. Plant Cell 7(7):1085–1097 Dixon RA, Blyden ER, Robbins MP, van Tunen AJ, Mol JN (1988) Comparative biochemistry of chalcone isomerases. Phytochemistry 27:2801–2808 Dooner HK, Robbins TP, Jorgensen RA (1991) Genetic and developmental control of anthocyanin biosynthesis. Annu Rev Genet 25(1):173–99 Druka A, Kudrna D, Rostoks N, Brueggeman R, von Wettstein D, Kleinhofs A (2003) Chalcone isomerase gene from rice (Oryza sativa) and barley (Hordeum vulgare): physical, genetic and mutation mapping. Gene 302(1):171–8 Elmayan T, Tepfer M (1995) Evaluation in tobacco of the organ specificity and strength of therolD promoter, domain A of the 35S promoter and the 35S2 promoter. Transgenic Res 4(6):388–396 Forkmann G, Dangelmayr IB (1980) Genetic control of chalcone isomerase activity in flowers of Dianthus caryophyllus. Biochem Genet 18(5):519–27 Harborne JB, Williams CA (2001) Anthocyanins and other flavonoids. Nat Prod Rep 18:310–333 Hegnauer R, Gpayer-Barkmeijer RJ (1993) Relevance of seed polysaccharides and flavonoids for the classification of the leguminosae: a chemotaxonomic approach. Phytochemistry 34(1):3–16 Jez JM, Bowman ME, Dixon RA, Noel JP (2000) Structure and mechanism of the evolutionarily unique plant enzyme chalcone isomerase. Nat Struct Biol 7(9):786–91 Koch MA, Haubold B, Mitchell-Olds T (2000) Comparative evolutionary analysis of chalcone synthase and alcohol dehydrogenase loci in Arabidopsis, Arabis, and related Genera (Brassicaceae). Mol Biol Evol 17(10):1483–98 Koes R, Verweij W, Quattrocchio F (2005) Flavonoids: a colorful model for the regulation and evolution of biochemical pathways. Trends Plant Sci 10(5):236–42 Kuhn B, Forkmann G, Seyffert W (1978) Genetic control of chalconeflavanone isomerase activity in Callistephus chinensis. Planta 138(3):199–203 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCt method. Methods 25:402–408 McKhann HI, Hirsch AM (1994) Isolation of chalcone synthase and chalcone isomerase cDNAs from alfalfa (Medicago sativa L.): highest transcript levels occur in young roots and root tips. Plant Mol Biol 24(5):767–77 Mo Y, Nagel C, Taylor LP (1992) Biochemical complementation of chalcone synthase mutants defines a role for flavonols in functional pollen. Proc Natl Acad Sci U S A 89(15):7213–7

Muir SR, Collins GJ, Robinson S, Hughes S, Bovy A, Ric De Vos CH, van Tunen AJ, Martine EV (2001) Overexpression of petunia chalcone isomerase in tomato results in fruit containing increased levels of flavonols. Nat Biotechnol 19(5):470–4 Ormrod DP, Landry LG, Conklin PL (1995) Short-term UV-B radiation and ozone exposure effects on aromatic secondary metabolite accumulation and shoot growth of flavonoid-deficient Arabidopsis mutants. Physiol Plant 93(4):602–10 Peters NK, Frost JW, Long SR (1986) A plant flavone, luteolin, induces expression of Rhizobium meliloti nodulation genes. Science 233(4767):977–80 Porebski S, Bailey LG, Baum BR (1997) Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Mol Biol Report 15(1):8–15 Ralston L, Subramanian S, Matsuno M, Yu O (2005) Partial reconstruction of flavonoid and isoflavonoid biosynthesis in yeast using soybean type I and type II chalcone isomerases. Plant Physiol 137(4): 1375–88 Rogers JH (1989) How were introns inserted into nuclear genes? Trends Genet: TIG 5(7):213–216 Shimada N, Aoki T, Sato S, Nakamura Y, Tabata S, Ayabe S (2003) A cluster of genes encodes the two types of chalcone isomerase involved in the biosynthesis of general flavonoids and legume-specific 5-Deoxy(iso)flavonoids in Lotus japonicus. Plant Physiol 131(3): 941–51 Stafford HA (1997) Roles of flavonoids in symbiotic and defense functions in legume roots. Bot Rev 63(1):27–39 Takamura T, Tomihama T, Miyajima I (1995) Inheritance of yellowflowered characteristic and yellow pigments in diploid cyclamen (Cyclamen persicum Mill.) cultivars. Sci Hortic 64(1):55–63 Thomas DJ, Zachos JC, Bralower TJ, Thomas E, Bohaty S (2002) Warming the fuel for the fire: evidence for the thermal dissociation of methane hydrate during the Paleocene-Eocene thermal maximum. Geology 30(12):1067–1070 van Tunen AJ, Koes RE, Spelt CE, van der Krol AR, Stuitje AR, Mol JN (1988) Cloning of the two chalcone flavanone isomerase genes from Petunia hybrida: coordinate, light-regulated and differential expression of flavonoid genes. EMBO J 7(5):1257–1263 Xia H, Zhao CZ, Hou L, Li AQ, Zhao SZ, Bi YP, An J, Zhao YX, Wan SB, Wang XJ (2013) Transcriptome profiling of peanut gynophores revealed global reprogramming of gene expression during early pod development in darkness. BMC Genomics 14(1):517 Yang Z (2007) PAML 4: phylogenetic analysis by maximum likelihood. Mol Biol Evol 24(8):1586–91 Zhang Y, Xia H, Yuan M, Zhao CZ, Li AQ, Wang XJ (2012) Cloning and expression analysis of peanut (Arachis hypogaea L.) CHI gene. Electron J Biotechnol. doi:10.2225/vol15-issue1-fulltext-6