Gene 555 (2015) 95–100
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Molecular cloning, characterization, and expression of sheep FGF5 gene Lihua Zhang 1, Sangang He 1, Mingjun Liu, Guosong Liu, Zheng Yuan, Chenxi Liu, Xumei Zhang, Ning Zhang, Wenrong Li ⁎ Key Laboratory of Genetics Breeding and Reproduction of Grass feeding Livestock, MOA, P.R. China The Key Laboratory of Animal Biotechnology of Xinjiang, Xinjiang Academy of Animal Science, Xinjiang, Urumqi, China
a r t i c l e
i n f o
Article history: Received 5 April 2014 Received in revised form 12 July 2014 Accepted 21 October 2014 Available online 23 October 2014 Keywords: Fibroblast growth factor 5 gene (FGF5) FGF5S Hair follicle growth Genetic variants Chinese Merino sheep
a b s t r a c t The fibroblast growth factor 5 gene (FGF5) is a member of the FGF gene family, and represents a candidate gene for hair length because of its role in the regulation of the hair follicle growth cycle. In our current study, we cloned, sequenced, and characterized the full-length FGF5 cDNA of Chinese Merino sheep. We obtained the complete genomic sequence of the FGF5 gene from sheep blood samples, and compared it to other FGF5 sequences in GenBank. We found that the FGF5 gene spanned 21,743 bp of genomic DNA, and consisted of 3 exons and 2 introns, both of which differed from those of a previously annotated FGF5 genomic sequence from sheep. We also identified a previously undescribed FGF5 mRNA splicing variant, FGF5S, and the western blot analysis showed that the molecular weights of the FGF5 (34 kDa) and FGF5s (17 kDa) proteins were consistent with the estimates based on the genomic and cDNA sequence data. We examined the expression of both FGF5 mRNAs in various tissues of sheep, and found that the expression of the FGF5S mRNA was restricted to the brain, spleen, and skin tissue. The single-nucleotide polymorphism analysis of the genomic sequence revealed 72 genetic variants of the FGF5 gene. Our findings provide insight into the functions of the FGF5 gene in Chinese Merino. © 2014 Elsevier B.V. All rights reserved.
1. Introduction The fibroblast growth factor 5 gene (FGF5) is a member of the FGF gene family, which includes at least 23 members with various biological functions (Katoh, 2002; Mason, 2003; Katoh and Katoh, 2005). FGF5 was first identified in human tumors (Zhan et al., 1988). The FGF5 mRNA is expressed in embryos, the central nervous system (Dono, 2003), and skeletal muscle (Clase et al., 2000). FGF5 is also expressed in the hair follicle, and the deletion of FGF5 causes abnormal hair length in mice due to prolonged anagen VI in the hair growth cycle (Hebert et al., 1994). Previous studies of two FGF5 isoforms isolated from rat, mouse, and human brain tissue showed that the full-length mRNA of the FGF5 isoform contained 3 exons, whereas the FGF5S isoform is an mRNA splicing variant in which exon 2 has been excised (Hattori et al., 1996; Ozawa et al., 1998). FGF5 is expressed in macrophage-like cells in rat skin, and FGF5S is expressed in the hair follicle (Suzuki et al., 1998). Both the FGF5 and FGF5S proteins function primarily through binding to FGF receptors 1 and 2. FGF5 actively inhibits cell proliferation and the synthesis of hair Abbreviations: FGF5, fibroblast growth factor 5 gene; SNP, single-nucleotide polymorphism; RACE, rapid amplification of the cDNA ends; HA, hemagglutinin epitope; DMEM, Dulbecco's modified Eagle's medium; CDS, complete coding sequence; aa, amino acid; ORF, open reading frame; UTR, untranslated region. ⁎ Corresponding author. E-mail address: [email protected] (W. Li). 1 These authors contributed equally to this work.
http://dx.doi.org/10.1016/j.gene.2014.10.036 0378-1119/© 2014 Elsevier B.V. All rights reserved.
fibers during the anagen stage of the hair follicle growth cycle. FGF5S competitively binds the FGF receptor, antagonizing the inhibitory effects of FGF5 (Ozawa et al., 1998; Suzuki et al., 2000; Ota et al., 2002). Studies in cats and dogs have indicated that FGF5 mutants were associated with altered hair length (Housley and Venta, 2006; Kehler et al., 2007; Cadieu et al., 2009; Dierks et al., 2013). These studies suggested that FGF5 plays an important role in regulating hair length in mammals. The FGF5 gene represents a candidate gene for hair length in mice, cats, and dogs, and wool length is the most economically valuable trait in Merino sheep. However, the role of FGF5 in wool length in sheep is largely unclear. Although the coding region of the FGF5 gene of sheep has been cloned (Liu et al., 2011), the sheep genomic sequence (V3.1) may not contain the complete genomic sequence of FGF5 due to gaps in coverage, and the Illumina sheep 50 k single-nucleotide polymorphism (SNP) chip lacks density in the coverage of FGF5. The objectives of our study were to clone the complete FGF5 cDNA of Chinese Merino sheep, determine the complete genomic sequence of FGF5, and identify FGF5 genetic variants. Our findings provide a foundation for understanding the role of FGF5 in the wool follicle. 2. Materials and methods 2.1. Experimental animals and sample collection Our animal experiments were conducted in compliance with the directives of the Animal Ethics Committee of the Xinjiang Academy of
96
L. Zhang et al. / Gene 555 (2015) 95–100
2.3. Expression of recombinant FGF5 and FGF5S
Table 1 PCR amplification and sequencing primers used in this study. Primer name Primer sequence
Product length
Tm (°C)
P1-F P1-R P2-F P2-R P3-A P3-B P4-A P4-B P5-F
465
56
336
56
472
Touch-down
P5-R P6-R P7-F P7-R β-Actin-F β-Actin-R
TTCCCCGAGGCTATGTCCAC ATCCATTGACTTTGCCATCCG CAGATGACTGCAAGTTCAGG CAAAGCGAAACTTGAGTCTGT GAAGCGGCTTGGAGCAGAGCAG AGCACCGTGTCTTCCTCTTCTTC CAAGCAATCGGAGCAGCCAGAAC GAAGTCCTAACACGGTGAAATAC ATAGCGGCCGCGGAAGCATGAG CTTGTCCTT GGCCTCGAGTTAAGCGTAGTCTGGGACGTC GTATGGGTAACCAAAGCGAAACTTGAGT GGCCTCGAGTCAAGCGTAGTCTGGGACGTC GTATGGGTATCTGTAAATTTGGCTTAAC CTTGGAGCAGAGCAGCTTCCAGTGGAGC CGCTCCCTGAACTTGCAGTCATCTGTAAAT TTG CACGGCATCGTCACCAACTG CAGGGGTGTTGAAGGTCTCGAAC
765 813/709 60 378
276/172 60
124
60
Animal Science. The Chinese Merino sheep (Ovis aries) used in our experiments were obtained from the Xinjiang Academy of Animal Science sheep breeding center (Xinjiang, China). Tissue samples were collected from the brain, heart, liver, spleen, lung, kidney, muscle, and skin of three adult female sheep, and frozen immediately in liquid nitrogen for RNA extraction. Blood samples were collected from 30 sheep for genomic DNA extraction. 2.2. Molecular cloning of the FGF5 cDNA Total RNA was extracted from the tissue samples using the Trizol reagent (Invitrogen, Carlsbad, CA, USA), and dissolved in RNase-free water. The integrity of the RNA was assessed by electrophoresis on a 1% agarose gel, before storage at − 80 °C. The gene sequences of the homologs of the FGF5 gene were downloaded from the NCBI database (http://www.ncbi.nlm.nih.gov/). The sequences of all of the primers used in our study are listed in Table 1. The various primers were designed based on the conserved region of the FGF5 coding sequence in sheep (NM_001246263.1), cattle (NM_001078011), humans (NM_004464), and mice (NM_010203). First strand cDNA synthesis was performed using 1 μg of total RNA and reverse transcriptase (Takara-Bio, Shiga, Japan), according to the manufacturer's protocol, and the cDNA was stored at − 20 °C. The partial sequences of the 5′ and 3′ ends of the sheep FGF5 cDNA were amplified by PCR using the P1 F/P1 R and P2 F/P2 R primers, respectively (Table 1), and the purified amplicons were sequenced. The complete 5′ and 3′ ends of the FGF5 coding sequence were generated by rapid amplification of the cDNA ends (RACE) using the SMART RACE cDNA Amplification Kit (Clontech, Mountain View, CA, USA), according to the manufacturer's instructions. The sequences of the RACE primers (Table 1) were based on the previously obtained partial sequences of the 5′ and 3′ ends. Touchdown and nested PCRs were performed, and the amplicons were ligated into the PMD-18T plasmid (Takara-Bio) for DNA sequencing. The 5′ and 3′ ends of the FGF5 cDNA were used to design the P5-F and P5-R primers (Table 1) for the PCR amplification of the complete coding sequence of FGF5. The P5-F primer contained a NotI site, and the P5-R primer contained XhoI site and the nucleotide sequence for the hemagglutinin epitope (HA) tag. The 5′ and 3′ ends of the FGF5 cDNA were ligated with the remainder of the FGF5 coding sequence to obtain the full-length FGF5 cDNA.
The target fragments were amplified by PCR using the P5-F/P5-R and P5-F/P6-R primers, respectively. The nucleotide sequence for the HA tag was incorporated into the reverse primer. The PCR products were purified using the TianGen PCR purification kit (Beijing, China). The PCR products were digested using NotI and XhoI, and subcloned into the pLEX-mcs plasmid (Thermo Scientific, Waltham, MA, USA) to produce the plex-FGF5 and plex-FGF5S expression plasmids, respectively. The FGF5 and FGF5S coding regions in the recombinant plasmids were verified by DNA sequencing. TLA-HEK293T cells were purchased from the American Type Culture Collection (Manassas, VA, USA), and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 100 IU/mL penicillin, 100 μg/mL streptomycin (Sigma-Aldrich, St. Louis, MO, USA), and 10% fetal bovine serum at 37 °C in humidified air containing 5% CO2. The plasmids were purified using the Plasmid Midi kit (Qiagen, Hilden, Germany), according to the manufacturer's protocol. The 293 T cells were seeded in six-well plates in DMEM one day prior to transfection. When the 293 T cells reached 70% to 80% confluence, they were transfected for 48 h using 2 μg of plasmid and 6 μL of the Lipofectamine 2000 reagent (Invitrogen). The cells were harvested, and total protein was extracted for western blotting. The protein extracts were subjected to SDS-PAGE on a 12% PA gel, and the protein bands were electrophoretically transferred to a nitrocellulose membrane (Bio-Rad, Hercules, CA, USA). The nitrocellulose membrane was probed using an anti-HA antibody (1:1000, TianGen) and a secondary antibody (1:10,000), as described previously (Liu et al., 2012). Primary antibody reactivity was visualized using the Odyssey Infrared Imaging System (Li-Cor, Lincoln, NE, USA), according to the manufacturer's instructions. 2.4. Determination of FGF5 genomic sequence and genetic variants Genomic DNA was isolated from frozen blood samples using the QIAamp DNA Blood Mini Kit (Qiagen), according to the manufacturer's instructions. The concentration and integrity of the DNA were measured using an Eppendorf Biophotometer (Eppendorf), and the concentration was adjusted to 50 ng/μL before storage at −20 °C. DNA from 30 individuals was pooled into three groups (n = 10 for each group) and sequenced to identify SNPs. Thirty-seven primer pairs were designed based on the previously reported sheep FGF5 genomic sequence
Fig. 1. The amplified product of the Merino sheep FGF5 gene. Lane M, DL150 marker; lanes 1–4 represent 813 bp and 709 bp amplification fragments produced using primers P5F/ P5R with DNA extracted from the skin of Merino sheep.
L. Zhang et al. / Gene 555 (2015) 95–100
97
Fig. 2. The nucleotide and deduced amino acid sequences of the FGF5 and FGF5S genes. The stop codons (TGA/TAA) are indicated with an asterisk (*).
(GenBank accession no. NC_019463: 94573602.94605575, Supplement Table 1) and our cloned FGF5 cDNA sequence, and were used to PCR amplify the genomic DNA sequences of Merino sheep. Thermal cycling was performed 5 min at 94 °C for 5 min, followed by 35 cycles of 94 °C for 30 s, annealment at a primer-specific temperature for 30 s, 72 °C for 1 to 2.5 min, with a final extension at 72 °C for 7 min. The PCR products were purified using the TianGen PCR purification kit, and sequenced by a commercial service provider (Sangon Biotech, Shanghai, China). The FGF5 sequences were aligned using SeqMan program (DNAStar, Madison, WI, USA). The genetic variants were identified based on differences in their sequences. The SNPs identified in the exon, UTR and partial intron were confirmed in all of the individuals with a second round of DNA sequencing. 2.5. Bioinformatics analysis The cDNA and genomic DNA sequences were compared using the DNAman software (Lynnon, Quebec, Canada) to predict the FGF5 protein sequence. Similarities to amino acid sequences in GenBank were
analyzed using the BLAST2.1 computational tool (http://www.ncbi. nlm.nih.gov/blast). The open reading frame (ORF) and peptide signal sequence of FGF5 proteins were predicted using the ORF-Finder (http://www.ncbi.nlm.nih.gov/gorf/ gorf.html) and SignaP (http://au. expasy.org/tools) computational tools, respectively. The biophysical characteristics of the predicted FGF5 proteins were estimated using the ProtParam computational tool (http://au.expasy.org/tools), and the domains of the FGF5 proteins were analyzed using the Smart program (http://smart.embl-heidelberg.de/). 2.6. Analysis of tissue-specific expression of FGF5 mRNA Semi-quantitative RT-PCR was performed using a pair of primers spanning the alternative splicing region of the FGF5 mRNA to detect the expression of the two FGF5 isoforms in various tissues of Chinese Merino sheep. Thermal cycling was performed with an initial denaturation at 95 °C for 3 min, followed by 30 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s, with a final extension at 72 °C for 5 min. The β-actin mRNA was also detected as an internal control using the
98
L. Zhang et al. / Gene 555 (2015) 95–100
Fig. 3. The modes of the spliced mRNAs and the genomic structure of the merino sheep FGF5 gene. A: The two splice isoforms of the Merino sheep FGF5 mRNA. B: The genomic structure of the Merino sheep FGF5 gene. The boxes represent the exons and lines denote the introns. The exons are numbered E1–E3 with red, green and blue boxes. The pink box represents the UTR. The boundary nucleotides of the exons and introns are shown with capital and lower case characters. The red “gt” and “ag” indicate that the consensus sequences of introns follow the “GTAG” rule.
β-actin-F and β-actin-R primers (Table 1). The mRNA abundance was estimated based on the amount of PCR product produced, as assessed by agarose gel electrophoresis. 3. Results 3.1. Cloning of full-length FGF5 The RT-PCR amplification of the partial sequences of the 5′ and 3′ ends of the FGF5 cDNA produced 465- and 336-bp fragments, respectively. The 3′- and 5′-RACE PCRs produced 472- and 765-bp fragments, respectively. Using the primers based on the 3′ and 5′ RACE products, the PCR amplification of the full-length coding sequence of the FGF5
mRNA produced two bands, corresponding to 813 bp and 709 bp, respectively (Fig. 1). These fragments were ligated to the 5′ and 3′ RACE products to produce the FGF5 (1779 bp; GenBank: JQ941956) and FGF5S (1675 bp; GenBank: JQ941957) full-length cDNAs. The FGF5 cDNA contained an 813-bp ORF that encoded a 270-aa polypeptide, and the 5′- and 3′-untranslated regions (UTRs) of the FGF5 cDNA were 273 and 663 bp in size, respectively. The FGF5S cDNA contained a 378-bp ORF that encoded a 125-aa polypeptide generated by alternative mRNA splicing that resulted in the loss of a 104-nt segment of the FGF5S transcript, relative to that of the FGF5 transcript (Fig. 2). The 5′- and 3′-UTRs of the FGF5S cDNA were 273 and 994 bp in size. The cDNA of both FGF5 and FGF5S contained 30 bp polyadenylated sequence. The predicted molecular weights of the FGF5 and FGF5S proteins were 29.61 and 13.1 kDa, respectively. The theoretical isoelectric points of the FGF5 and FGF5S proteins were 9.50 and 10.56, respectively. Both of the FGF5 and FGF5S polypeptides contained a 20-aa peptide signal sequence at the N-terminus and an FGF domain between amino-acid positions 87 to 271. Blast results showed that the highest level of protein homology was shared with the FGF5 protein of cattle (98%), followed by that of the horse (86%), human (79%), and mouse (74%).
3.2. Genomic structure of sheep FGF5 gene The genomic sequence of the FGF5 gene of Chinese Merino sheep was approximately 21.74 kb in size (GenBank: KJ647161). The nucleotide sequence alignments showed that the sheep FGF5 gene consisted
Fig. 4. Western blot analysis of recombinant plex-FGF5 and plex-FGF5S proteins expressed in a 293 T cell line. Lane M, molecular weight marker; lane 1, plex-mcs vector; lane 2, plexFGF5-HA; lane 3, plex-FGF5S-HA.
Fig. 5. Expression of two FGF5 mRNA transcripts in various tissues examined with RT-PCR. Total RNA was extracted from the brain, heart, liver, spleen, lung, kidney, muscle, and skin of adult female Merino sheep. β-Actin was used as the control.
L. Zhang et al. / Gene 555 (2015) 95–100
99
skeletal muscle sample. By contrast, the FGF5S mRNA was weakly expressed in the brain, spleen, and skin only (Fig. 5).
Table 2 Polymorphisms of the Merino FGF5 gene. No.
Variation
Region
No.
Variation
Region
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36
C133T C164G G369A(Ala/Thr) G762A T2338C G2351C C2392T T2643A T2948A C3024T T4119C A4269T C4303T T4445G T4924C A4957G T4998C G5034A C5292T C5522T C5539T T8079C A8092G A8181T G8187T A8264G A8320C T8349C C8363A A8749C G9187A T9198C G9366T A9368G A9381G T9414G
5′UTR 5′UTR Exton1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2
37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72
T9579C T9657C A10900G A10927G C11072T T11077C T11123C G11275T G11283T A15059C C15226T C15337T G15458A A15564G C15675A C16351T C16602T G16654A A16720G T16795C A16852G A16861C C17055T G17284T C18059T A18065G G18131A A18161T 20065(GTGTGT/indel) A20675G A20677C T20693A T20742C C21029G(Leu/Val) C21253T C21520T
Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Inrron2 Intron2 Intron2 Intron2 Intron2 Exton3 3′UTR 3′UTR
of three exons and two introns. The lengths of exons 1, 2, and 3 were 361, 104, and 348 bp, respectively, and introns 1 and 2 were 7877 and 12,152 bp, respectively. All of the intron-exon junctions conformed to the “GT-AG” splice rule (Fig. 3). The analysis of the genomic DNA sequence confirmed the donor and acceptor sites that produced the FGF5 and FGF5S mRNAs by alternative splicing (Fig. 3). 3.3. Tissue specific expression of FGF5 and FGF5S The western blotting results showed that the recombinant FGF5 and FGF5S proteins were approximately 34 and 17 kDa, respectively (Fig. 4, lanes 2 and 3), which were consistent with the predicted sizes based on the genomic and cDNA sequence data. The tissue distribution of a protein may reflect its physiological function. Our semi-quantitative RTPCR analysis showed that the FGF5 mRNA was expressed in all of the tissue samples collected, except those from the kidney and lung, with the highest levels of FGF5 mRNA observed in the brain, spleen, and skin (Fig. 5). Lower levels of FGF5 expression were observed in the heart and liver, and the lowest level of FGF5 mRNA was observed in the
3.4. Polymorphisms of the Merino FGF5 gene The sequences of the PCR products amplified using the 37 pairs of primers were aligned, revealing 72 genetic variants within the 21743bp FGF5 genomic sequence in sheep, which included 71 SNPs and one indel (Table 2). Only two SNPs were located in the exon and these were synonymous polymorphisms. Three SNPs were found in the UTR. Sixty-six SNPs and one indel occurred in the two introns. The polymorphism density was 1 SNP per 302 bp of genomic sequence. The average SNP densities in the UTR, exons and introns were 1 SNP per 309 bp, 1 SNP per 406 bp and 1 SNP per 302 bp, respectively. 4. Discussion In our current study, we obtained the full-length genomic DNA sequence of the FGF5 gene of Chinese Merino sheep. The previously annotated sheep FGF5 genomic sequence (V3.1) spanned 31.97 kb of genomic DNA, and contained four exons and three introns. This sequence lacked a start codon and had a 543 bp gap of missing sequence near exon 2 (NC_019463:94573602..94605575, Fig. 6). In contrast, our results showed that the FGF5 genomic sequence of Chinese Merino sheep spanned 21.74 kb of genomic DNA and contained three exons and two large introns. The second and third exons of the Chinese Merino sheep are the same as the third and fourth exons of the previously known FGF5 genomic sequence. The two large introns of Chinese Merino sheep are the same as the second and third introns of the previously known FGF5 genomic sequence. The first exon of the Chinese Merino sheep is 361 bp and begins with a start codon, while the second exon of the previously known FGF5 genomic sequence is only 103 bp and contains a large gap before the second exon. The difference between the annotations was primarily caused by a coverage gap in the previously reported genomic sequence, which included the start code. Most members of the FGF gene family, including the human, mouse, and rat FGF5 genes, contain three exons and two large introns (Ornitz and Itoh, 2001; Goldfarb, 2005; Zhan et al., 1988; Hebert et al., 1994; Hattori et al., 1996). The FGF5 cDNA and predicted amino acid sequence shared a high level of homology with those of other species, especially with regard to the FGF domain, which contains highly conserved residues that interact with the FGF receptor to activate the FGF signaling pathway (Goldfarb, 2005). Previous studies have characterized the alternative splicing of the human, mouse, rat, and dog FGF5 mRNAs (Hattori et al., 1996; Ozawa et al., 1998; Housley and Venta, 2006). The FGF5S splicing variant is generated by the excision of exon 2 from the FGF5 mRNA. In a previous study of the FGF5 gene of sheep, the cDNA of FGF5 was cloned, but the FGF5S mRNA was not identified (Liu et al., 2011). Our current study is the first to identify the FGF5S splicing variant in sheep, which results from the excision of exon 2. We found that the sheep FGF5S mRNA encoded 125-aa protein, and that the size of the recombinant sheep FGF5S protein corresponded to size predictions based on the genomic and cDNA sequence data. The FGF5S splicing variants in humans, mice, rats, and dogs encode 123-, 121-, 121-, and 125-aa proteins,
Fig. 6. The previously genomic structure of the FGF5 gene. This genomic sequence was annotated by the International Sheep Genome Consortium. The boxes represent the exons and lines denote the introns. Exons are numbered E1–E4 with red, green, blue and pink boxes. Slashes denote gaps.
100
L. Zhang et al. / Gene 555 (2015) 95–100
respectively. Thus, our findings are consistent with studies of the alternative splicing of FGF5 in other mammals. The FGF5 mRNA was predominantly expressed in the brain, spleen, and skin of sheep, and the levels of the FGF-5S mRNA in the brain, spleen, and skin were lower than those of the FGF5 mRNA. Previous studies have shown that the FGF5 and FGF5S mRNAs were expressed at high levels in the brain of mice and humans (Ozawa et al., 1998), and that FGF5 was highly expressed in the skin of mice, rats, and sheep (Hebert et al., 1994; Suzuki et al., 1998; Liu et al., 2011). The tissue-specificity of FGF5 expression may reveal its physiological functions. The FGF5 gene has been shown to regulate the anagen stage of the hair follicle growth cycle, and the deletion FGF5 has been shown to increase the length of mouse hair (Hebert et al., 1994). The expression pattern of FGF5 and FGF5S in sheep skin is similar to that previously observed in mice. Although the anagen stage of the hair follicle growth cycle in Merino sheep may be as long as two years (Rogers, 2006), whether the FGF5 protein also regulates hair follicle growth in sheep is unclear. Further studies of the function of the FGF5 proteins in Merino sheep are warranted to determine their role in the growth of the wool follicle. Previous studies in cats have identified four FGF5 genetic variants that are associated with long-hair phenotypes (Kehler et al., 2007; Drogemuller et al., 2007). Studies in dogs have also shown that various mutations in FGF5 are associated with long-hair phenotypes (Housley and Venta, 2006; Cadieu et al., 2009; Dierks et al., 2013), and two SNPs in exon 3 of FGF5 were shown to be associated with wool yield in rabbits (Li et al., 2008). By contrast the wool fiber traits of Inner Mongolian cashmere goats were not affected by mutations in FGF5 (Liu et al., 2009). A genome-wide analysis revealed that strong selective pressure is associated with the FGF5 gene that may influence wool length (Kijas et al., 2012), but variations in the FGF5 genotype have not been shown to be associated with wool length. Our current study represents the first report of polymorphisms in the FGF5 gene in sheep. A total of 72 FGF5 genetic variants were identified. Our future studies of FGF5 in Chinese Merino sheep will investigate possible associations between FGF5 genetic variants and wool length. In conclusion, we cloned and characterized the full-length FGF5 cDNA, and obtained the entire genomic DNA sequence of the FGF5 gene of Chinese Merino sheep. We identified two mRNA splicing variants, FGF5 and FGF5S, and analyzed the expression of the FGF5 and FGF5S proteins in various tissues. We also identified 72 FGF5 genetic variants that might be useful as molecular markers in future studies. Our findings provide important insight into the functions of FGF5 in Chinese Merino sheep. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2014.10.036. Conflict of interest The authors declare that they have no conflict of interest in the publication of these results. Acknowledgments This work was supported in part by grant U1303284 from China National Natural Science foundation and a subcontract of grant 2013AA102506 from China National High Technology Research
Development Program (863 Program). It was also supported by grant 2013ZX08008-001 from China Agriculture Ministry genetically modified organisms project and a special fund for basic scientific research provided by Xinjiang Academy of Animal Science. References Cadieu, E., Neff, M.W., Quignon, P., Walsh, K., Chase, K., Parker, H.G., Vonholdt, B.M., Rhue, A., Boyko, A., Byers, A., Wong, A., Mosher, D.S., Elkahloun, A.G., Spady, T.C., Andre, C., Lark, K.G., Cargill, M., Bustamante, C.D., Wayne, R.K., Ostrander, E.A., 2009. Coat variation in the domestic dog is governed by variants in three genes. Science 326, 150–153. Clase, K.L., Mitchell, P.J., Ward, P.J., Dorman, C.M., Johnson, S.E., Hannon, K., 2000. FGF5 stimulates expansion of connective tissue fibroblasts and inhibits skeletal muscle development in the limb. Dev. Dyn. 219, 368–380. Dierks, C., Momke, S., Philipp, U., Distl, O., 2013. Allelic heterogeneity of FGF5 mutations causes the long-hair phenotype in dogs. Anim. Genet. 44, 425–431. Dono, R., 2003. Fibroblast growth factors as regulators of central nervous system development and function. Am. J. Physiol. Regul. Integr. Comp. Physiol. 284, R867–R881. Drogemuller, C., Rufenacht, S., Wichert, B., Leeb, T., 2007. Mutations within the FGF5 gene are associated with hair length in cats. Anim. Genet. 38, 218–221. Goldfarb, M., 2005. Fibroblast growth factor homologous factors: evolution, structure, and function. Cytokine Growth Factor Rev. 16, 215–220. Hattori, Y., Yamasaki, M., Itoh, N., 1996. The rat FGF-5 mRNA variant generated by alternative splicing encodes a novel truncated form of FGF-5. Biochim. Biophys. Acta 1306, 31–33. Hebert, J.M., Rosenquist, T., Gotz, J., Martin, G.R., 1994. FGF5 as a regulator of the hair growth cycle: evidence from targeted and spontaneous mutations. Cell 78, 1017–1025. Housley, D.J., Venta, P.J., 2006. The long and the short of it: evidence that FGF5 is a major determinant of canine ‘hair’-itability. Anim. Genet. 37, 309–315. Katoh, M., 2002. WNT and FGF gene clusters (review). Int. J. Oncol. 21, 1269–1273. Katoh, Y., Katoh, M., 2005. Comparative genomics on FGF16 orthologs. Int. J. Mol. Med. 16, 959–963. Kehler, J.S., David, V.A., Schaffer, A.A., Bajema, K., Eizirik, E., Ryugo, D.K., Hannah, S.S., O'Brien, S.J., Menotti-Raymond, M., 2007. Four independent mutations in the feline fibroblast growth factor 5 gene determine the long-haired phenotype in domestic cats. J. Hered. 98, 555–566. Kijas, J.W., Lenstra, J.A., Hayes, B., Boitard, S., Porto Neto, L.R., San Cristobal, M., Servin, B., McCulloch, R., Whan, V., Gietzen, K., Paiva, S., Barendse, W., Ciani, E., Raadsma, H., McEwan, J., Dalrymple, B., International Sheep Genomics Consortium, M., 2012. Genome-wide analysis of the world's sheep breeds reveals high levels of historic mixture and strong recent selection. PLoS Biol. 10, e1001258. Li, C.X., Jiang, M.S., Chen, S.Y., Lai, S.J., 2008. Correlation analysis between single nucleotide polymorphism of FGF5 gene and wool yield in rabbits. Yi Chuan 30, 893–899. Liu, H.Y., Yang, G.Q., Zhang, W., Zhu, X.P., Jia, Z.H., 2009. Effects of FGF5 gene on fibre traits on Inner Mongolian cashmere goats. Yi Chuan 31, 175–179. Liu, W.X., Jia, B., Shi, G.Q., Ren, J.G., Liu, K., Ma, R.L., 2011. Cloning, expression analysis and RNA interference of FGF5 gene in sheep. Yi Chuan 33, 982–988. Liu, C., Li, W., Zhang, X., Zhang, N., He, S., Huang, J., Ge, Y., Liu, M., 2012. The critical role of myostatin in differentiation of sheep myoblasts. Biochem. Biophys. Res. Commun. 422, 381–386. Mason, I., 2003. Fibroblast growth factors. Curr. Biol. 13, R346. Ornitz, D.M., Itoh, N., 2001. Fibroblast growth factors. Genome Biol. 2 (REVIEWS3005). Ota, Y., Saitoh, Y., Suzuki, S., Ozawa, K., Kawano, M., Imamura, T., 2002. Fibroblast growth factor 5 inhibits hair growth by blocking dermal papilla cell activation. Biochem. Biophys. Res. Commun. 290, 169–176. Ozawa, K., Suzuki, S., Asada, M., Tomooka, Y., Li, A.J., Yoneda, A., Komi, A., Imamura, T., 1998. An alternatively spliced fibroblast growth factor (FGF)-5 mRNA is abundant in brain and translates into a partial agonist/antagonist for FGF-5 neurotrophic activity. J. Biol. Chem. 273, 29262–29271. Rogers, G.E., 2006. Biology of the wool follicle: an excursion into a unique tissue interaction system waiting to be re-discovered. Exp. Dermatol. 15, 931–949. Suzuki, S., Kato, T., Takimoto, H., Masui, S., Oshima, H., Ozawa, K., Suzuki, S., Imamura, T., 1998. Localization of rat FGF-5 protein in skin macrophage-like cells and FGF-5S protein in hair follicle: possible involvement of two Fgf-5 gene products in hair growth cycle regulation. J. Invest. Dermatol. 111, 963–972. Suzuki, S., Ota, Y., Ozawa, K., Imamura, T., 2000. Dual-mode regulation of hair growth cycle by two Fgf-5 gene products. J. Invest. Dermatol. 114, 456–463. Zhan, X., Bates, B., Hu, X.G., Goldfarb, M., 1988. The human FGF-5 oncogene encodes a novel protein related to fibroblast growth factors. Mol. Cell. Biol. 8, 3487–3495.
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Molecular cloning, characterization, and expression of sheep FGF5 gene Lihua Zhang 1, Sangang He 1, Mingjun Liu, Guosong Liu, Zheng Yuan, Chenxi Liu, Xumei Zhang, Ning Zhang, Wenrong Li ⁎ Key Laboratory of Genetics Breeding and Reproduction of Grass feeding Livestock, MOA, P.R. China The Key Laboratory of Animal Biotechnology of Xinjiang, Xinjiang Academy of Animal Science, Xinjiang, Urumqi, China
a r t i c l e
i n f o
Article history: Received 5 April 2014 Received in revised form 12 July 2014 Accepted 21 October 2014 Available online 23 October 2014 Keywords: Fibroblast growth factor 5 gene (FGF5) FGF5S Hair follicle growth Genetic variants Chinese Merino sheep
a b s t r a c t The fibroblast growth factor 5 gene (FGF5) is a member of the FGF gene family, and represents a candidate gene for hair length because of its role in the regulation of the hair follicle growth cycle. In our current study, we cloned, sequenced, and characterized the full-length FGF5 cDNA of Chinese Merino sheep. We obtained the complete genomic sequence of the FGF5 gene from sheep blood samples, and compared it to other FGF5 sequences in GenBank. We found that the FGF5 gene spanned 21,743 bp of genomic DNA, and consisted of 3 exons and 2 introns, both of which differed from those of a previously annotated FGF5 genomic sequence from sheep. We also identified a previously undescribed FGF5 mRNA splicing variant, FGF5S, and the western blot analysis showed that the molecular weights of the FGF5 (34 kDa) and FGF5s (17 kDa) proteins were consistent with the estimates based on the genomic and cDNA sequence data. We examined the expression of both FGF5 mRNAs in various tissues of sheep, and found that the expression of the FGF5S mRNA was restricted to the brain, spleen, and skin tissue. The single-nucleotide polymorphism analysis of the genomic sequence revealed 72 genetic variants of the FGF5 gene. Our findings provide insight into the functions of the FGF5 gene in Chinese Merino. © 2014 Elsevier B.V. All rights reserved.
1. Introduction The fibroblast growth factor 5 gene (FGF5) is a member of the FGF gene family, which includes at least 23 members with various biological functions (Katoh, 2002; Mason, 2003; Katoh and Katoh, 2005). FGF5 was first identified in human tumors (Zhan et al., 1988). The FGF5 mRNA is expressed in embryos, the central nervous system (Dono, 2003), and skeletal muscle (Clase et al., 2000). FGF5 is also expressed in the hair follicle, and the deletion of FGF5 causes abnormal hair length in mice due to prolonged anagen VI in the hair growth cycle (Hebert et al., 1994). Previous studies of two FGF5 isoforms isolated from rat, mouse, and human brain tissue showed that the full-length mRNA of the FGF5 isoform contained 3 exons, whereas the FGF5S isoform is an mRNA splicing variant in which exon 2 has been excised (Hattori et al., 1996; Ozawa et al., 1998). FGF5 is expressed in macrophage-like cells in rat skin, and FGF5S is expressed in the hair follicle (Suzuki et al., 1998). Both the FGF5 and FGF5S proteins function primarily through binding to FGF receptors 1 and 2. FGF5 actively inhibits cell proliferation and the synthesis of hair Abbreviations: FGF5, fibroblast growth factor 5 gene; SNP, single-nucleotide polymorphism; RACE, rapid amplification of the cDNA ends; HA, hemagglutinin epitope; DMEM, Dulbecco's modified Eagle's medium; CDS, complete coding sequence; aa, amino acid; ORF, open reading frame; UTR, untranslated region. ⁎ Corresponding author. E-mail address: [email protected] (W. Li). 1 These authors contributed equally to this work.
http://dx.doi.org/10.1016/j.gene.2014.10.036 0378-1119/© 2014 Elsevier B.V. All rights reserved.
fibers during the anagen stage of the hair follicle growth cycle. FGF5S competitively binds the FGF receptor, antagonizing the inhibitory effects of FGF5 (Ozawa et al., 1998; Suzuki et al., 2000; Ota et al., 2002). Studies in cats and dogs have indicated that FGF5 mutants were associated with altered hair length (Housley and Venta, 2006; Kehler et al., 2007; Cadieu et al., 2009; Dierks et al., 2013). These studies suggested that FGF5 plays an important role in regulating hair length in mammals. The FGF5 gene represents a candidate gene for hair length in mice, cats, and dogs, and wool length is the most economically valuable trait in Merino sheep. However, the role of FGF5 in wool length in sheep is largely unclear. Although the coding region of the FGF5 gene of sheep has been cloned (Liu et al., 2011), the sheep genomic sequence (V3.1) may not contain the complete genomic sequence of FGF5 due to gaps in coverage, and the Illumina sheep 50 k single-nucleotide polymorphism (SNP) chip lacks density in the coverage of FGF5. The objectives of our study were to clone the complete FGF5 cDNA of Chinese Merino sheep, determine the complete genomic sequence of FGF5, and identify FGF5 genetic variants. Our findings provide a foundation for understanding the role of FGF5 in the wool follicle. 2. Materials and methods 2.1. Experimental animals and sample collection Our animal experiments were conducted in compliance with the directives of the Animal Ethics Committee of the Xinjiang Academy of
96
L. Zhang et al. / Gene 555 (2015) 95–100
2.3. Expression of recombinant FGF5 and FGF5S
Table 1 PCR amplification and sequencing primers used in this study. Primer name Primer sequence
Product length
Tm (°C)
P1-F P1-R P2-F P2-R P3-A P3-B P4-A P4-B P5-F
465
56
336
56
472
Touch-down
P5-R P6-R P7-F P7-R β-Actin-F β-Actin-R
TTCCCCGAGGCTATGTCCAC ATCCATTGACTTTGCCATCCG CAGATGACTGCAAGTTCAGG CAAAGCGAAACTTGAGTCTGT GAAGCGGCTTGGAGCAGAGCAG AGCACCGTGTCTTCCTCTTCTTC CAAGCAATCGGAGCAGCCAGAAC GAAGTCCTAACACGGTGAAATAC ATAGCGGCCGCGGAAGCATGAG CTTGTCCTT GGCCTCGAGTTAAGCGTAGTCTGGGACGTC GTATGGGTAACCAAAGCGAAACTTGAGT GGCCTCGAGTCAAGCGTAGTCTGGGACGTC GTATGGGTATCTGTAAATTTGGCTTAAC CTTGGAGCAGAGCAGCTTCCAGTGGAGC CGCTCCCTGAACTTGCAGTCATCTGTAAAT TTG CACGGCATCGTCACCAACTG CAGGGGTGTTGAAGGTCTCGAAC
765 813/709 60 378
276/172 60
124
60
Animal Science. The Chinese Merino sheep (Ovis aries) used in our experiments were obtained from the Xinjiang Academy of Animal Science sheep breeding center (Xinjiang, China). Tissue samples were collected from the brain, heart, liver, spleen, lung, kidney, muscle, and skin of three adult female sheep, and frozen immediately in liquid nitrogen for RNA extraction. Blood samples were collected from 30 sheep for genomic DNA extraction. 2.2. Molecular cloning of the FGF5 cDNA Total RNA was extracted from the tissue samples using the Trizol reagent (Invitrogen, Carlsbad, CA, USA), and dissolved in RNase-free water. The integrity of the RNA was assessed by electrophoresis on a 1% agarose gel, before storage at − 80 °C. The gene sequences of the homologs of the FGF5 gene were downloaded from the NCBI database (http://www.ncbi.nlm.nih.gov/). The sequences of all of the primers used in our study are listed in Table 1. The various primers were designed based on the conserved region of the FGF5 coding sequence in sheep (NM_001246263.1), cattle (NM_001078011), humans (NM_004464), and mice (NM_010203). First strand cDNA synthesis was performed using 1 μg of total RNA and reverse transcriptase (Takara-Bio, Shiga, Japan), according to the manufacturer's protocol, and the cDNA was stored at − 20 °C. The partial sequences of the 5′ and 3′ ends of the sheep FGF5 cDNA were amplified by PCR using the P1 F/P1 R and P2 F/P2 R primers, respectively (Table 1), and the purified amplicons were sequenced. The complete 5′ and 3′ ends of the FGF5 coding sequence were generated by rapid amplification of the cDNA ends (RACE) using the SMART RACE cDNA Amplification Kit (Clontech, Mountain View, CA, USA), according to the manufacturer's instructions. The sequences of the RACE primers (Table 1) were based on the previously obtained partial sequences of the 5′ and 3′ ends. Touchdown and nested PCRs were performed, and the amplicons were ligated into the PMD-18T plasmid (Takara-Bio) for DNA sequencing. The 5′ and 3′ ends of the FGF5 cDNA were used to design the P5-F and P5-R primers (Table 1) for the PCR amplification of the complete coding sequence of FGF5. The P5-F primer contained a NotI site, and the P5-R primer contained XhoI site and the nucleotide sequence for the hemagglutinin epitope (HA) tag. The 5′ and 3′ ends of the FGF5 cDNA were ligated with the remainder of the FGF5 coding sequence to obtain the full-length FGF5 cDNA.
The target fragments were amplified by PCR using the P5-F/P5-R and P5-F/P6-R primers, respectively. The nucleotide sequence for the HA tag was incorporated into the reverse primer. The PCR products were purified using the TianGen PCR purification kit (Beijing, China). The PCR products were digested using NotI and XhoI, and subcloned into the pLEX-mcs plasmid (Thermo Scientific, Waltham, MA, USA) to produce the plex-FGF5 and plex-FGF5S expression plasmids, respectively. The FGF5 and FGF5S coding regions in the recombinant plasmids were verified by DNA sequencing. TLA-HEK293T cells were purchased from the American Type Culture Collection (Manassas, VA, USA), and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 100 IU/mL penicillin, 100 μg/mL streptomycin (Sigma-Aldrich, St. Louis, MO, USA), and 10% fetal bovine serum at 37 °C in humidified air containing 5% CO2. The plasmids were purified using the Plasmid Midi kit (Qiagen, Hilden, Germany), according to the manufacturer's protocol. The 293 T cells were seeded in six-well plates in DMEM one day prior to transfection. When the 293 T cells reached 70% to 80% confluence, they were transfected for 48 h using 2 μg of plasmid and 6 μL of the Lipofectamine 2000 reagent (Invitrogen). The cells were harvested, and total protein was extracted for western blotting. The protein extracts were subjected to SDS-PAGE on a 12% PA gel, and the protein bands were electrophoretically transferred to a nitrocellulose membrane (Bio-Rad, Hercules, CA, USA). The nitrocellulose membrane was probed using an anti-HA antibody (1:1000, TianGen) and a secondary antibody (1:10,000), as described previously (Liu et al., 2012). Primary antibody reactivity was visualized using the Odyssey Infrared Imaging System (Li-Cor, Lincoln, NE, USA), according to the manufacturer's instructions. 2.4. Determination of FGF5 genomic sequence and genetic variants Genomic DNA was isolated from frozen blood samples using the QIAamp DNA Blood Mini Kit (Qiagen), according to the manufacturer's instructions. The concentration and integrity of the DNA were measured using an Eppendorf Biophotometer (Eppendorf), and the concentration was adjusted to 50 ng/μL before storage at −20 °C. DNA from 30 individuals was pooled into three groups (n = 10 for each group) and sequenced to identify SNPs. Thirty-seven primer pairs were designed based on the previously reported sheep FGF5 genomic sequence
Fig. 1. The amplified product of the Merino sheep FGF5 gene. Lane M, DL150 marker; lanes 1–4 represent 813 bp and 709 bp amplification fragments produced using primers P5F/ P5R with DNA extracted from the skin of Merino sheep.
L. Zhang et al. / Gene 555 (2015) 95–100
97
Fig. 2. The nucleotide and deduced amino acid sequences of the FGF5 and FGF5S genes. The stop codons (TGA/TAA) are indicated with an asterisk (*).
(GenBank accession no. NC_019463: 94573602.94605575, Supplement Table 1) and our cloned FGF5 cDNA sequence, and were used to PCR amplify the genomic DNA sequences of Merino sheep. Thermal cycling was performed 5 min at 94 °C for 5 min, followed by 35 cycles of 94 °C for 30 s, annealment at a primer-specific temperature for 30 s, 72 °C for 1 to 2.5 min, with a final extension at 72 °C for 7 min. The PCR products were purified using the TianGen PCR purification kit, and sequenced by a commercial service provider (Sangon Biotech, Shanghai, China). The FGF5 sequences were aligned using SeqMan program (DNAStar, Madison, WI, USA). The genetic variants were identified based on differences in their sequences. The SNPs identified in the exon, UTR and partial intron were confirmed in all of the individuals with a second round of DNA sequencing. 2.5. Bioinformatics analysis The cDNA and genomic DNA sequences were compared using the DNAman software (Lynnon, Quebec, Canada) to predict the FGF5 protein sequence. Similarities to amino acid sequences in GenBank were
analyzed using the BLAST2.1 computational tool (http://www.ncbi. nlm.nih.gov/blast). The open reading frame (ORF) and peptide signal sequence of FGF5 proteins were predicted using the ORF-Finder (http://www.ncbi.nlm.nih.gov/gorf/ gorf.html) and SignaP (http://au. expasy.org/tools) computational tools, respectively. The biophysical characteristics of the predicted FGF5 proteins were estimated using the ProtParam computational tool (http://au.expasy.org/tools), and the domains of the FGF5 proteins were analyzed using the Smart program (http://smart.embl-heidelberg.de/). 2.6. Analysis of tissue-specific expression of FGF5 mRNA Semi-quantitative RT-PCR was performed using a pair of primers spanning the alternative splicing region of the FGF5 mRNA to detect the expression of the two FGF5 isoforms in various tissues of Chinese Merino sheep. Thermal cycling was performed with an initial denaturation at 95 °C for 3 min, followed by 30 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s, with a final extension at 72 °C for 5 min. The β-actin mRNA was also detected as an internal control using the
98
L. Zhang et al. / Gene 555 (2015) 95–100
Fig. 3. The modes of the spliced mRNAs and the genomic structure of the merino sheep FGF5 gene. A: The two splice isoforms of the Merino sheep FGF5 mRNA. B: The genomic structure of the Merino sheep FGF5 gene. The boxes represent the exons and lines denote the introns. The exons are numbered E1–E3 with red, green and blue boxes. The pink box represents the UTR. The boundary nucleotides of the exons and introns are shown with capital and lower case characters. The red “gt” and “ag” indicate that the consensus sequences of introns follow the “GTAG” rule.
β-actin-F and β-actin-R primers (Table 1). The mRNA abundance was estimated based on the amount of PCR product produced, as assessed by agarose gel electrophoresis. 3. Results 3.1. Cloning of full-length FGF5 The RT-PCR amplification of the partial sequences of the 5′ and 3′ ends of the FGF5 cDNA produced 465- and 336-bp fragments, respectively. The 3′- and 5′-RACE PCRs produced 472- and 765-bp fragments, respectively. Using the primers based on the 3′ and 5′ RACE products, the PCR amplification of the full-length coding sequence of the FGF5
mRNA produced two bands, corresponding to 813 bp and 709 bp, respectively (Fig. 1). These fragments were ligated to the 5′ and 3′ RACE products to produce the FGF5 (1779 bp; GenBank: JQ941956) and FGF5S (1675 bp; GenBank: JQ941957) full-length cDNAs. The FGF5 cDNA contained an 813-bp ORF that encoded a 270-aa polypeptide, and the 5′- and 3′-untranslated regions (UTRs) of the FGF5 cDNA were 273 and 663 bp in size, respectively. The FGF5S cDNA contained a 378-bp ORF that encoded a 125-aa polypeptide generated by alternative mRNA splicing that resulted in the loss of a 104-nt segment of the FGF5S transcript, relative to that of the FGF5 transcript (Fig. 2). The 5′- and 3′-UTRs of the FGF5S cDNA were 273 and 994 bp in size. The cDNA of both FGF5 and FGF5S contained 30 bp polyadenylated sequence. The predicted molecular weights of the FGF5 and FGF5S proteins were 29.61 and 13.1 kDa, respectively. The theoretical isoelectric points of the FGF5 and FGF5S proteins were 9.50 and 10.56, respectively. Both of the FGF5 and FGF5S polypeptides contained a 20-aa peptide signal sequence at the N-terminus and an FGF domain between amino-acid positions 87 to 271. Blast results showed that the highest level of protein homology was shared with the FGF5 protein of cattle (98%), followed by that of the horse (86%), human (79%), and mouse (74%).
3.2. Genomic structure of sheep FGF5 gene The genomic sequence of the FGF5 gene of Chinese Merino sheep was approximately 21.74 kb in size (GenBank: KJ647161). The nucleotide sequence alignments showed that the sheep FGF5 gene consisted
Fig. 4. Western blot analysis of recombinant plex-FGF5 and plex-FGF5S proteins expressed in a 293 T cell line. Lane M, molecular weight marker; lane 1, plex-mcs vector; lane 2, plexFGF5-HA; lane 3, plex-FGF5S-HA.
Fig. 5. Expression of two FGF5 mRNA transcripts in various tissues examined with RT-PCR. Total RNA was extracted from the brain, heart, liver, spleen, lung, kidney, muscle, and skin of adult female Merino sheep. β-Actin was used as the control.
L. Zhang et al. / Gene 555 (2015) 95–100
99
skeletal muscle sample. By contrast, the FGF5S mRNA was weakly expressed in the brain, spleen, and skin only (Fig. 5).
Table 2 Polymorphisms of the Merino FGF5 gene. No.
Variation
Region
No.
Variation
Region
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36
C133T C164G G369A(Ala/Thr) G762A T2338C G2351C C2392T T2643A T2948A C3024T T4119C A4269T C4303T T4445G T4924C A4957G T4998C G5034A C5292T C5522T C5539T T8079C A8092G A8181T G8187T A8264G A8320C T8349C C8363A A8749C G9187A T9198C G9366T A9368G A9381G T9414G
5′UTR 5′UTR Exton1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron1 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2
37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72
T9579C T9657C A10900G A10927G C11072T T11077C T11123C G11275T G11283T A15059C C15226T C15337T G15458A A15564G C15675A C16351T C16602T G16654A A16720G T16795C A16852G A16861C C17055T G17284T C18059T A18065G G18131A A18161T 20065(GTGTGT/indel) A20675G A20677C T20693A T20742C C21029G(Leu/Val) C21253T C21520T
Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Intron2 Inrron2 Intron2 Intron2 Intron2 Intron2 Exton3 3′UTR 3′UTR
of three exons and two introns. The lengths of exons 1, 2, and 3 were 361, 104, and 348 bp, respectively, and introns 1 and 2 were 7877 and 12,152 bp, respectively. All of the intron-exon junctions conformed to the “GT-AG” splice rule (Fig. 3). The analysis of the genomic DNA sequence confirmed the donor and acceptor sites that produced the FGF5 and FGF5S mRNAs by alternative splicing (Fig. 3). 3.3. Tissue specific expression of FGF5 and FGF5S The western blotting results showed that the recombinant FGF5 and FGF5S proteins were approximately 34 and 17 kDa, respectively (Fig. 4, lanes 2 and 3), which were consistent with the predicted sizes based on the genomic and cDNA sequence data. The tissue distribution of a protein may reflect its physiological function. Our semi-quantitative RTPCR analysis showed that the FGF5 mRNA was expressed in all of the tissue samples collected, except those from the kidney and lung, with the highest levels of FGF5 mRNA observed in the brain, spleen, and skin (Fig. 5). Lower levels of FGF5 expression were observed in the heart and liver, and the lowest level of FGF5 mRNA was observed in the
3.4. Polymorphisms of the Merino FGF5 gene The sequences of the PCR products amplified using the 37 pairs of primers were aligned, revealing 72 genetic variants within the 21743bp FGF5 genomic sequence in sheep, which included 71 SNPs and one indel (Table 2). Only two SNPs were located in the exon and these were synonymous polymorphisms. Three SNPs were found in the UTR. Sixty-six SNPs and one indel occurred in the two introns. The polymorphism density was 1 SNP per 302 bp of genomic sequence. The average SNP densities in the UTR, exons and introns were 1 SNP per 309 bp, 1 SNP per 406 bp and 1 SNP per 302 bp, respectively. 4. Discussion In our current study, we obtained the full-length genomic DNA sequence of the FGF5 gene of Chinese Merino sheep. The previously annotated sheep FGF5 genomic sequence (V3.1) spanned 31.97 kb of genomic DNA, and contained four exons and three introns. This sequence lacked a start codon and had a 543 bp gap of missing sequence near exon 2 (NC_019463:94573602..94605575, Fig. 6). In contrast, our results showed that the FGF5 genomic sequence of Chinese Merino sheep spanned 21.74 kb of genomic DNA and contained three exons and two large introns. The second and third exons of the Chinese Merino sheep are the same as the third and fourth exons of the previously known FGF5 genomic sequence. The two large introns of Chinese Merino sheep are the same as the second and third introns of the previously known FGF5 genomic sequence. The first exon of the Chinese Merino sheep is 361 bp and begins with a start codon, while the second exon of the previously known FGF5 genomic sequence is only 103 bp and contains a large gap before the second exon. The difference between the annotations was primarily caused by a coverage gap in the previously reported genomic sequence, which included the start code. Most members of the FGF gene family, including the human, mouse, and rat FGF5 genes, contain three exons and two large introns (Ornitz and Itoh, 2001; Goldfarb, 2005; Zhan et al., 1988; Hebert et al., 1994; Hattori et al., 1996). The FGF5 cDNA and predicted amino acid sequence shared a high level of homology with those of other species, especially with regard to the FGF domain, which contains highly conserved residues that interact with the FGF receptor to activate the FGF signaling pathway (Goldfarb, 2005). Previous studies have characterized the alternative splicing of the human, mouse, rat, and dog FGF5 mRNAs (Hattori et al., 1996; Ozawa et al., 1998; Housley and Venta, 2006). The FGF5S splicing variant is generated by the excision of exon 2 from the FGF5 mRNA. In a previous study of the FGF5 gene of sheep, the cDNA of FGF5 was cloned, but the FGF5S mRNA was not identified (Liu et al., 2011). Our current study is the first to identify the FGF5S splicing variant in sheep, which results from the excision of exon 2. We found that the sheep FGF5S mRNA encoded 125-aa protein, and that the size of the recombinant sheep FGF5S protein corresponded to size predictions based on the genomic and cDNA sequence data. The FGF5S splicing variants in humans, mice, rats, and dogs encode 123-, 121-, 121-, and 125-aa proteins,
Fig. 6. The previously genomic structure of the FGF5 gene. This genomic sequence was annotated by the International Sheep Genome Consortium. The boxes represent the exons and lines denote the introns. Exons are numbered E1–E4 with red, green, blue and pink boxes. Slashes denote gaps.
100
L. Zhang et al. / Gene 555 (2015) 95–100
respectively. Thus, our findings are consistent with studies of the alternative splicing of FGF5 in other mammals. The FGF5 mRNA was predominantly expressed in the brain, spleen, and skin of sheep, and the levels of the FGF-5S mRNA in the brain, spleen, and skin were lower than those of the FGF5 mRNA. Previous studies have shown that the FGF5 and FGF5S mRNAs were expressed at high levels in the brain of mice and humans (Ozawa et al., 1998), and that FGF5 was highly expressed in the skin of mice, rats, and sheep (Hebert et al., 1994; Suzuki et al., 1998; Liu et al., 2011). The tissue-specificity of FGF5 expression may reveal its physiological functions. The FGF5 gene has been shown to regulate the anagen stage of the hair follicle growth cycle, and the deletion FGF5 has been shown to increase the length of mouse hair (Hebert et al., 1994). The expression pattern of FGF5 and FGF5S in sheep skin is similar to that previously observed in mice. Although the anagen stage of the hair follicle growth cycle in Merino sheep may be as long as two years (Rogers, 2006), whether the FGF5 protein also regulates hair follicle growth in sheep is unclear. Further studies of the function of the FGF5 proteins in Merino sheep are warranted to determine their role in the growth of the wool follicle. Previous studies in cats have identified four FGF5 genetic variants that are associated with long-hair phenotypes (Kehler et al., 2007; Drogemuller et al., 2007). Studies in dogs have also shown that various mutations in FGF5 are associated with long-hair phenotypes (Housley and Venta, 2006; Cadieu et al., 2009; Dierks et al., 2013), and two SNPs in exon 3 of FGF5 were shown to be associated with wool yield in rabbits (Li et al., 2008). By contrast the wool fiber traits of Inner Mongolian cashmere goats were not affected by mutations in FGF5 (Liu et al., 2009). A genome-wide analysis revealed that strong selective pressure is associated with the FGF5 gene that may influence wool length (Kijas et al., 2012), but variations in the FGF5 genotype have not been shown to be associated with wool length. Our current study represents the first report of polymorphisms in the FGF5 gene in sheep. A total of 72 FGF5 genetic variants were identified. Our future studies of FGF5 in Chinese Merino sheep will investigate possible associations between FGF5 genetic variants and wool length. In conclusion, we cloned and characterized the full-length FGF5 cDNA, and obtained the entire genomic DNA sequence of the FGF5 gene of Chinese Merino sheep. We identified two mRNA splicing variants, FGF5 and FGF5S, and analyzed the expression of the FGF5 and FGF5S proteins in various tissues. We also identified 72 FGF5 genetic variants that might be useful as molecular markers in future studies. Our findings provide important insight into the functions of FGF5 in Chinese Merino sheep. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2014.10.036. Conflict of interest The authors declare that they have no conflict of interest in the publication of these results. Acknowledgments This work was supported in part by grant U1303284 from China National Natural Science foundation and a subcontract of grant 2013AA102506 from China National High Technology Research
Development Program (863 Program). It was also supported by grant 2013ZX08008-001 from China Agriculture Ministry genetically modified organisms project and a special fund for basic scientific research provided by Xinjiang Academy of Animal Science. References Cadieu, E., Neff, M.W., Quignon, P., Walsh, K., Chase, K., Parker, H.G., Vonholdt, B.M., Rhue, A., Boyko, A., Byers, A., Wong, A., Mosher, D.S., Elkahloun, A.G., Spady, T.C., Andre, C., Lark, K.G., Cargill, M., Bustamante, C.D., Wayne, R.K., Ostrander, E.A., 2009. Coat variation in the domestic dog is governed by variants in three genes. Science 326, 150–153. Clase, K.L., Mitchell, P.J., Ward, P.J., Dorman, C.M., Johnson, S.E., Hannon, K., 2000. FGF5 stimulates expansion of connective tissue fibroblasts and inhibits skeletal muscle development in the limb. Dev. Dyn. 219, 368–380. Dierks, C., Momke, S., Philipp, U., Distl, O., 2013. Allelic heterogeneity of FGF5 mutations causes the long-hair phenotype in dogs. Anim. Genet. 44, 425–431. Dono, R., 2003. Fibroblast growth factors as regulators of central nervous system development and function. Am. J. Physiol. Regul. Integr. Comp. Physiol. 284, R867–R881. Drogemuller, C., Rufenacht, S., Wichert, B., Leeb, T., 2007. Mutations within the FGF5 gene are associated with hair length in cats. Anim. Genet. 38, 218–221. Goldfarb, M., 2005. Fibroblast growth factor homologous factors: evolution, structure, and function. Cytokine Growth Factor Rev. 16, 215–220. Hattori, Y., Yamasaki, M., Itoh, N., 1996. The rat FGF-5 mRNA variant generated by alternative splicing encodes a novel truncated form of FGF-5. Biochim. Biophys. Acta 1306, 31–33. Hebert, J.M., Rosenquist, T., Gotz, J., Martin, G.R., 1994. FGF5 as a regulator of the hair growth cycle: evidence from targeted and spontaneous mutations. Cell 78, 1017–1025. Housley, D.J., Venta, P.J., 2006. The long and the short of it: evidence that FGF5 is a major determinant of canine ‘hair’-itability. Anim. Genet. 37, 309–315. Katoh, M., 2002. WNT and FGF gene clusters (review). Int. J. Oncol. 21, 1269–1273. Katoh, Y., Katoh, M., 2005. Comparative genomics on FGF16 orthologs. Int. J. Mol. Med. 16, 959–963. Kehler, J.S., David, V.A., Schaffer, A.A., Bajema, K., Eizirik, E., Ryugo, D.K., Hannah, S.S., O'Brien, S.J., Menotti-Raymond, M., 2007. Four independent mutations in the feline fibroblast growth factor 5 gene determine the long-haired phenotype in domestic cats. J. Hered. 98, 555–566. Kijas, J.W., Lenstra, J.A., Hayes, B., Boitard, S., Porto Neto, L.R., San Cristobal, M., Servin, B., McCulloch, R., Whan, V., Gietzen, K., Paiva, S., Barendse, W., Ciani, E., Raadsma, H., McEwan, J., Dalrymple, B., International Sheep Genomics Consortium, M., 2012. Genome-wide analysis of the world's sheep breeds reveals high levels of historic mixture and strong recent selection. PLoS Biol. 10, e1001258. Li, C.X., Jiang, M.S., Chen, S.Y., Lai, S.J., 2008. Correlation analysis between single nucleotide polymorphism of FGF5 gene and wool yield in rabbits. Yi Chuan 30, 893–899. Liu, H.Y., Yang, G.Q., Zhang, W., Zhu, X.P., Jia, Z.H., 2009. Effects of FGF5 gene on fibre traits on Inner Mongolian cashmere goats. Yi Chuan 31, 175–179. Liu, W.X., Jia, B., Shi, G.Q., Ren, J.G., Liu, K., Ma, R.L., 2011. Cloning, expression analysis and RNA interference of FGF5 gene in sheep. Yi Chuan 33, 982–988. Liu, C., Li, W., Zhang, X., Zhang, N., He, S., Huang, J., Ge, Y., Liu, M., 2012. The critical role of myostatin in differentiation of sheep myoblasts. Biochem. Biophys. Res. Commun. 422, 381–386. Mason, I., 2003. Fibroblast growth factors. Curr. Biol. 13, R346. Ornitz, D.M., Itoh, N., 2001. Fibroblast growth factors. Genome Biol. 2 (REVIEWS3005). Ota, Y., Saitoh, Y., Suzuki, S., Ozawa, K., Kawano, M., Imamura, T., 2002. Fibroblast growth factor 5 inhibits hair growth by blocking dermal papilla cell activation. Biochem. Biophys. Res. Commun. 290, 169–176. Ozawa, K., Suzuki, S., Asada, M., Tomooka, Y., Li, A.J., Yoneda, A., Komi, A., Imamura, T., 1998. An alternatively spliced fibroblast growth factor (FGF)-5 mRNA is abundant in brain and translates into a partial agonist/antagonist for FGF-5 neurotrophic activity. J. Biol. Chem. 273, 29262–29271. Rogers, G.E., 2006. Biology of the wool follicle: an excursion into a unique tissue interaction system waiting to be re-discovered. Exp. Dermatol. 15, 931–949. Suzuki, S., Kato, T., Takimoto, H., Masui, S., Oshima, H., Ozawa, K., Suzuki, S., Imamura, T., 1998. Localization of rat FGF-5 protein in skin macrophage-like cells and FGF-5S protein in hair follicle: possible involvement of two Fgf-5 gene products in hair growth cycle regulation. J. Invest. Dermatol. 111, 963–972. Suzuki, S., Ota, Y., Ozawa, K., Imamura, T., 2000. Dual-mode regulation of hair growth cycle by two Fgf-5 gene products. J. Invest. Dermatol. 114, 456–463. Zhan, X., Bates, B., Hu, X.G., Goldfarb, M., 1988. The human FGF-5 oncogene encodes a novel protein related to fibroblast growth factors. Mol. Cell. Biol. 8, 3487–3495.
