1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54
YFSIM3081_proof ■ 21 August 2014 ■ 1/6
Fish & Shellfish Immunology xxx (2014) 1e6
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short communication
Molecular cloning, characterization and expression analysis of trypsin-like serine protease from triangle-shell pearl mussel (Hyriopsis cumingii) Q2
Hongquan Wang a, 1, Jian Liang a, 1, Yurong Zhao a, Qiaolin Liu a, Yaoguo Li a, Zili Yi b, Kaijian Chen a, Tiaoyi Xiao a, * a b
College of Animal Science and Technology, Hunan Agricultural University, Changsha, 410128, China College of Bioscience and Biotechnology, Hunan Agricultural University, Changsha, 410128, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 14 April 2014 Received in revised form 14 July 2014 Accepted 25 July 2014 Available online xxx
Trypsin-like serine protease (TLS) is ubiquitous in animals and plays a number of diverse roles, including dietary protein digestion, hemolymph coagulation, antimicrobial activity and immune responses, among others. This study reports the isolation of a 1048 bp full-length cDNA sequence of TLS from triangle-shell pearl mussel (Hyriopsis cumingii), including a 12 bp 5' UTR (untranslated region), a 172 bp 3' UTR, and an open reading frame (ORF) of 864 bp by rapid amplification of cDNA ends (RACE). Bioinformatic analysis shows that the gene belongs to the trypsin-like serine protease superfamily, and contains a 15 residues N-terminal signal peptide and a conserved C-terminal domain. In comparison to other serine proteases, the catalytic triad were identified as His-98, Asp-149, and Ser-240. Quantitative real-time PCR (qPCR) showed a broad expression of the TLS gene in ten tested tissues. Time-course expression analysis demonstrated that the expression level of the TLS mRNA was significantly up-regulated in eight tested tissues (liver, intestine, gill, heart, axe foot, adductor muscle, kidney and gonad), but down-regulated in mantle and stomach after Aeromonas hydrophila injection. This is one of the results indicate that TLS may be involved in innate defense reactions against A. hydrophila in triangle-shell pearl mussel. © 2014 Published by Elsevier Ltd.
Keywords: Triangle-shell pearl mussel Trypsin-like serine protease Quantitative real-time PCR Time-course expression
1. Introduction The triangle-shell pearl mussel (Hyriopsis cumingii), commonly known as the freshwater bivalve mollusk, belongs to the Unionidae family. It is a unique resource in China, prized for its pearl-making capabilities [1]. Like other invertebrates, the triangle-shell pearl mussel utilizes a series of innate immune responses which are believed to be its sole defense against microbial threats and invasion [2]. Deterioration of local aquaculture environments has led to a greater susceptibility of disease outbreaks among triangle-shell pearl mussel, causing a significant decline of its production. Previous study showed that A. hydrophila caused great damage to the aquatic animals [3] and it was the main pathogen which caused triangle-shell pearl mussel to be dead [4]. Serine proteases are involved in several functions including digestion, activation of the complement system, cell differentiation
* Corresponding author. Tel.: þ86 731 84618183; fax: þ86 731 84610280. E-mail address: [email protected] (T. Xiao). 1 These two authors contributed equally to this study.
and hemostasis, and this has been demonstrated in several microorganisms, plants, and animals [5]. TLS was a member of the chymotrypsin/trypsin family of serine proteases and was almost totally confined to animals [6]. TLS shared a common mechanism of catalysis that rely upon the coordinate action of three catalytic residues: His (H), Asp (D), Ser (S), which selectively hydrolyze peptide bonds C-terminal to basic amino acid residue [7,8]. TLS mostly function extracellularly in roles that include dietary protein digestion, hemolymph coagulation, antimicrobial peptide synthesis, and the activation of a rapidly immune pathway in response to pathogen detection [9e13]. TLS was found to be one of the most important proteases, contributing approximately 6% of soluble protein in the digestive gland [14]. Studies showed that prophenoloxidase (proPO) can be activated in vitro by exogenous trypsin in shrimp [15] and trypsin was involved in the regulation of innate immunity in the small intestine by acting an antimicrobial peptide prodefensin convertase [16]. Several TLS genes had been previously identified. Four trypsinlike serine protease genes were obtained from the hepatopancreas of the Chinese shrimp, with all showing upregulation during
http://dx.doi.org/10.1016/j.fsi.2014.07.032 1050-4648/© 2014 Published by Elsevier Ltd.
Please cite this article in press as: Wang H, et al., Molecular cloning, characterization and expression analysis of trypsin-like serine protease from triangle-shell pearl mussel (Hyriopsis cumingii), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.07.032
55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3081_proof ■ 21 August 2014 ■ 2/6
2
H. Wang et al. / Fish & Shellfish Immunology xxx (2014) 1e6
Fig. 1. The full-length cDNA sequence and deduced amino acid sequence of Trypsin-like Serine Protease. The signal peptide is labeled by the dashed underline. The serine protease Tryp_SPc domain is labeled by the single underline. The mRNA polyadenylation signal is labeled by the solid line box. The catalytic triad amino acids are labeled with rectangles on Q3 the left side.
host infection with the white spot syndrome virus (WSSV). An additional protease, Fctry3, showed increased expression levels after a bacterial challenge [17]. From a 1216 bp full-length cDNA sequence of TLS that was cloned from Apostichopus japonicus using the RACE technique, TLS was shown to be regulated during different stages of regeneration, suggesting that TLS was important in the regeneration process of A. japonicus [18]. In this study, a trypsin-like serine protease gene from H. cumingii was cloned. The tissue-specific expression and temporal expression profiles of the gene after stimulation with A. hydrophila were analyzed by qPCR. The results of this study determine the involvement of TLS in the innate immunity of triangle-shell mussel.
2. Materials and methods 2.1. Animal and immune challenge Triangle-shell mussels were obtained from a commercial farm in Changde, Hunan Province, China. The average weight was 280.73 ± 55.18 g and the average length was 13.57 ± 1.28 cm. The mussels were acclimatized for one week before the experiment at 24e28 C. A. hydrophila was received as a gift from the Institute of Hydrobiology at the Chinese Academy of Sciences. Healthy mussels were challenged by injection of 0.5 mL 109 cfu/ ml A. hydrophila. Unchallenged mussels were used as control. Tissue samples including liver, stomach, intestine, gill, heart, mantle, axe foot, adductor muscle, kidney, and gonad from three control mussels and three experimental mussels were collected at 0 h, 3 h, 6 h, 12 h, 24 h, and 48 h after injection, frozen in liquid nitrogen immediately for use.
2.2. RNA extraction and cDNA synthesis Total RNA contents from a variety of tissues (liver, stomach, intestine, gill, heart, mantle, axe foot, adductor muscle, kidney, gonad) were extracted according to the manufacturer's protocol of the RNAprep pure Tissue Kit (Tiangen biotech, China). The mRNAs of different tissues were reversely transcribed to cDNAs using the SMARTer™ RACE (Rapid amplification of cDNA ends) cDNA Amplification Kit (Clontech, USA).
2.3. Cloning and sequencing of trypsin-like serine proteases cDNA Primers for TLS gene were designed according to the expressed sequence tag (EST, GenBank accession number: EX828678) which was obtained by constructing a subtractive hybridization cDNA library [19]. 50 -RACE-Ready cDNA was synthesized using the SMART II™ A Oligonucleotide(AAGCAGTGG TATCAACGCAGAGTACGCGGG) and 50 -RACE CDS Primer A (AAGCAGTGGTATCAACGCAGAGTAC(T)30V N), then 50 -RACE was performed using the gene specific primer pairs UPM/TLS-GSPR-out (TCGCCCTGGCAAGCGTCTA.TTCC) and UPM/TLS-GSPR-in (AGCCTTCAAAGCCACAGCCGTAT) in nested PCRs. 30 -RACE-Ready cDNA was synthesized using the 30 -RACE CDS Primer A (AAGCAGTGGTATCAACGCAGAGTAC(T)30V N), then 30 -RACE was performed using the gene specific primer pairs UPM/TLS-GSPF-out (ACGGACGGAATGTTATGCGGTGGA) and UPM/ TLS-GSPF-in (ACGGCTGTGGCTTTGAAGGCTAT) in nested PCRs. PCR for 50 end of TLS was performed with the following program: 94 C for 5 min, followed by 5 cycles of 94 C for 30 s, 60 C for 30 s and 72 C for 45 s, then 30 cycles of 94 C for 30 s, 60 C for 30 s and 72 C for 45 s. After the final cycle, samples were incubated at 72 C for 10 min. PCR enrichment of 30 end of TLS was performed
Please cite this article in press as: Wang H, et al., Molecular cloning, characterization and expression analysis of trypsin-like serine protease from triangle-shell pearl mussel (Hyriopsis cumingii), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.07.032
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3081_proof ■ 21 August 2014 ■ 3/6
H. Wang et al. / Fish & Shellfish Immunology xxx (2014) 1e6 Table 1 TLS sequences of different species used for similarity and phylogenetic analysis. Species
Gene definition
Accession number
Identity
Hyriopsis cumingii
Trypsin-like serine protease Trypsin Trypsin-3 Trypsin-like serine protease Trypsin-like serine protease Trypsinogen Trypsin 1a Trypsin Trypsin3 trypsinogen II Trypsin 29F Trypsin 10 Trypsin
AEB70966
e
AAL67442 EKC18480 AFB81537
35.47% 37.13% 36.27%
AEO93271
30.77%
ADO08222 ADB66711 BAL62982 CAA75311 AAA98517 NP_523518 AAH87759 ACE80257
32.25% 34.80% 31.51% 34.81% 34.47% 32.31% 33.79% 32.53%
Paralithodes camtschaticus Crassostrea gigas Tenebrio molitor Apostichopus japonicus Branchiostoma belcheri Panulirus argus Ctenopharyngodon idella Litopenaeus vannamei Rattus norvegicus Drosophila melanogaster Xenopus (Silurana) tropicalis Marsupenaeus japonicus
according to the following program: 94 C for 5 min, followed by 35 cycles of 94 C for 30 s, 59 C for 30 s and 72 C for 45 s with a final extension step of 72 C for 10 min. The products of PCR were purified and cloned into the pUCm-T vector followed by sequencing. Cluster analysis was performed to overlap the 50 and 30 end with the EST sequence in order to obtain the full-length cDNA of the triangle-shell pearl mussel TLS gene. 2.4. Sequence analysis Similarity analysis was performed with NCBI BLASTX (http:// www.ncbi.nlm.nih.gov) [20]. Gene translation and prediction of the deduced protein structure were conducted with ExPASy tools (http://www.au.expasy.org/). Signal sequence and motif prediction were carried out using SMART (http://smart.embl-heidelberg.de/) [21,22]. Alignments were performed with ClustalW and GENDOC. MEGA 4.0 was used to generate the phylogenetic organization [23]. The clip domain and active sites were predicted via homolog sequence alignment.
3
control group mussels (the unchallenged mussels). First strand cDNA strands of each tissue were individually synthesized with the Revertaid™ First Strand cDNA Synthesis Kit (Toyobo, Japan). Afterwards, quantitative real-time PCR was performed using SYBR Green Realtime PCR Master Mix-Plus (Takara, Japan) according to manufacturer's instructions on an ABI 7300 Real-Time Detection System (Applied Biosystems, USA). The PCR reaction mixture (20 ml) consisted of 10.0 ml of 2 SYBR Premix Ex Taq™ Green, 0.4 ml of 50 Reference DyeI, 2.0 ml cDNA and 0.4 ml of each primer, and 6.8 ml ddH2O. A pair of specific primers (F: GAGCAAGTCAGTGGACCGTAGT; R: AAGTTGTTTTAGCGAGGCAGAC) were used to amplify a PCR product of 213 bp. The house-keeping gene b-actin was amplified as an internal control with a gene specific primer pair b-actin (F: TCCCCTCAACCCTAAAGCCAACA, R: CGGAAGCGTACAGCGACAACACA) with a PCR fragment size of 113 bp. qRT-PCR was programmed at 95 C for 30 s, followed by 40 cycles at 95 C for 5 s, and 60 C for 31 s. Finally, dissociation analysis of PCR products was performed at the end of each PCR reaction to confirm that only one product was amplified and detected. A series of the mixed first-strand cDNAs from all selected tissues diluted by 10fold were used to construct two standard curves [24]. Determination of the expression level of TLS used the comparative Ct method. In this method, the discrepancy between the Ct values of Trypsinlike Serine Protease and b-actin was calculated to normalize the variation in the amount of cDNA in each reaction. The expression level of TLS was then calculated by 2(△△Ct) [25]. All samples were repeated using three templates. The obtained data was subjected to statistical analysis followed by an unpaired sample t-test. A significant difference was accepted at P < 0.05. 2.6. Time-course expression of trypsin-like serine proteases Total RNA was isolated from the bacteria-challenged mussels at 3 h, 6 h, 12 h, 24 h, and 48 h post-inoculation. The qPCR reaction and Statistical analysis were the same as those described above. 3. Results and discussion 3.1. cDNA cloning and sequence characterization of the TLS
2.5. Analysis of the TLS expression in tissues from the control group mussels Total RNA was isolated from a variety of tissues (liver, intestine, gill, heart, axe foot, adductor muscle, kidney and gonad) of the
The full length TLS cDNA contains 1048 nucleotides, including a polyadenylation sequence, a 12 bp 50 untranslated region (UTR), a 864 bp open reading frame (ORF), and a 172 bp 30 untranslated region (GenBank accession no: HQ684736). The nucleotide sequence
Fig. 2. The phylogenetic organization of amino acid sequences of serine protease. A distance-based phylogenetic tree was computed using MEGA4.0. In the minimum evolution algorithm, a bootstrap value based on 100 replicates was used to construct the tree. TLS of H. cumingii was indicated with “C”.
Please cite this article in press as: Wang H, et al., Molecular cloning, characterization and expression analysis of trypsin-like serine protease from triangle-shell pearl mussel (Hyriopsis cumingii), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.07.032
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3081_proof ■ 21 August 2014 ■ 4/6
4
H. Wang et al. / Fish & Shellfish Immunology xxx (2014) 1e6
Fig. 3. Relative expression of the TLS gene in different tissues. Values were shown as mean ± S.E (N ¼ 3). In the same row, values with the same letter superscripts mean no significant difference (P > 0.05), while with different small letter superscripts mean significant difference (P < 0.05). The same as below.
at the 30 end of the non-coding region was also found to contain one“AATAAA”mRNA polyadenylation signal motif and one“ATTTA” unstable mRNA motif (Fig. 1). SMART analysis revealed that the deduced amino acid sequence contained one signal peptide located at residues 1e15 and a Tryp_SPc domain located at residues 52e283. ScanProsite analysis indicated that Trypsin-like Serine Protease contained the catalytic triad (H98, D149, S240), a highly conserved active site of TLS. BLAST homology search against the GenBank database led to the discovery of a Tryp_SPc domain. The results obtained from above showed that the trypsin-like Serine Protease gene belongs to the serine protease family because serine proteases were characterized by the catalytic triad containing H, D, and S residues in the active site. The TLS could form four Disulfide Bonds (Cys79-Cys99, Cys181-Cys246, Cys212Cys227, Cys236-Cys264), resulting in a more compact structure. The TLS contained a canonical histidine active site signature motif
Fig. 4. Time-course expression profiles of TLS in mantle (A), adductor muscle (B), axe foot (C), heart (D) and gonad (E), intestine (F), gill (G), liver (H), kidney (I), and stomach (J) after challenge with A. hydrophila measured by qPCR. Values were shown as mean ± S.E (N ¼ 3).
Please cite this article in press as: Wang H, et al., Molecular cloning, characterization and expression analysis of trypsin-like serine protease from triangle-shell pearl mussel (Hyriopsis cumingii), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.07.032
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3081_proof ■ 21 August 2014 ■ 5/6
H. Wang et al. / Fish & Shellfish Immunology xxx (2014) 1e6
(V94TAAHC99) and a canonical serine active site signature motif (D234ACQGDSGGPLV245). 3.2. Homology and phylogenetics analysis of trypsin-like serine protease The results of two sequence alignments by DNAMAN showed that the TLS of H. cumingii shared less similarity and homology with other species (Table 1). The most closest was found to be Trypsin-3 from Crassostrea gigas (37.13%) and Trypsin-like serine protease from Tenebrio molitor (36.27%). Mega 4.0 software was used to construct the phylogenetic tree for TLS. A phylogenetic analysis based on the amino acid sequences of TLS and other members of the serine protease family showed that the TLS of H. cumingii formed an exclusive clade which meaned that H. cumingii had a distant relationship with the other species(Fig. 2). Drosophila melanogaster and T. molitor were clustered into a clade, and the remained species clustered into a clade. This suggests that the direction of TLS evolution is consistent with that of the evolution of species. 3.3. Tissue distribution and expression profiles of TLS in the mussels Analysis of TLS transcripts present in the total RNAs extracted from the mussel mantle, adductor muscle, axe foot, heart, gonad, intestine, gill, liver, kidney, and stomach of the control group mussel revealed that the TLS gene was broadly expressed in all tissues selected, according to qPCR. The results showed that the TLS gene was most highly expressed in mantle and stomach (P < 0.05), while the expression levels in other tissues (intestine, gill, heart, mantle, axe foot, liver, kidney and gonad) were relatively equal, if not diminished (Fig. 3). It might imply that it was consistent with the main function of TLS gene which was involved in immune response and digestion. 3.4. Time-course expression profiles of the TLS gene after challenge by A. hydrophila The expression patterns of TLS under conditions of A. hydrophila challenge were observed using qRT-PCR methods in order to investigate the roles of the TLS gene from H. cumingii in antibacterial innate immunity. In the time course of gene expression in adduct muscle, TLS expression levels increased to the highest level by 3 h after A. hydrophila challenge and then gradually decreased to the lowest level from 3 to 24 h. Notably, its expression level reached a second peak at 48 h (Fig. 4B). Expression level of the TLS mRNA in kidney peaked at 3 h, dropped to a lower level at 12 h, then increased to its highest level at 24 h nearly 67521 times higher than the control group after 48 h stimulation (Fig. 4I). TLS mRNA was significantly up-regulated at 48 h after bacterial injection in most tissues and especially in kidney, it indicate that TLS might be involved in innate defense reactions against A. hydrophila in triangle-shell pearl mussel. However in the mantle and stomach, TLS mRNA expression was significantly down-regulated, whether it might imply that TLS was involved in host defense against A. hydrophila through the special negative regulation mechanism, still need further research. The recent years have witnessed tremendous progress in identification of aquatic animals genes involved in innate response to bacteria and virus infection, such as interferons (IFNs) [26], PKR [27]. In summary, trypsin-like serine protease gene was cloned from triangle-shell pearl mussel, allowing for the identification of their expression profiles in triangle-shell pearl mussel infected with A. hydrophila. The results indicated that trypsin-like serine proteases might be involved in the innate immune system of H.
5
cumingii. As such, further studies are recommended to explain the mechanism of trypsin-like serine proteases involved in innate defense reactions.
Acknowledgments This study was supported by the National Natural Science Foundation of China award to Tiaoyi Xiao (No.31040083). The authors wish to thank Dr. Xiao Ma from the College of Animal Science and Technology, Hunan Agricultural University for data processing and linguistic modification.
References [1] Ren Q, Qi YL, Hui KM, Zhang Z, Zhang CY, Wang W. Four invertebrate-type lysozyme genes from triangle-shell pearl mussel (Hyriopsis cumingii). Fish Shellfish Immunol 2012;33(4):909e15. [2] Zasloff M. Innate immunity, antimicrobial peptides, and protection of the oral cavity. Lancet 2002;360(9340):1116e7. [3] Zhang B, Zeng LB, Luo XS, et al. Isolation and identification of pathogen from Enteric Septicemia of Black Carp (Mylopharyngodon piceus). J Huazhong Agric Univ 2010;29(5):607e12 [in Chinese]. [4] Liu XY, Jin H, Zhu SW, et al. The disease and the way to prevent the disease of the triangle-shell pearl mussel. Inland Fish 1997;4:6e7 [in Chinese]. [5] Braud S, Bon C, Wisner A. Snake venom proteins acting on hemostasis. Biochimie 2000;82(9e10):851e9. [6] Rawlings ND, Barrett AJ. Evolutionary families of peptidases. J Biochem 1993;290(Pt 1):205e18. [7] Volz J, Osta MA, Kafatos FC, Muller HM. The roles of two clip domain serine proteases in innate immune responses of the malaria vector Anopheles gambiae. J Biol Chem 2005;280(48):40161e8. [8] Chen C, Darrow AL, Qi JS, D'Andrea MR, Andrade-Gordon P. A novel serine protease predominately expressed in macrophages. J Biochem 2003;374(Pt 1): 97e107. [9] Dana AN, Hong YS, Kern MK, Hillenmeyer ME, Harker BW, Lobo NF, et al. Gene expression patterns associated with blood-feeding in the malaria mosquito Anopheles gambiae. BMC Genomics 2005;6:5e9. [10] Iwanaga S, Kawabata S, Muta T. New types of clotting factors and defense molecules found in horseshoe crab hemolymph: their structures and functions. J Biochem 1998;123(1):1e15. [11] Hoffmann JA, Kafatos FC, Janeway Jr CA, Ezekowitz RAB. Phylogenetic perspectives in innate immunity. Science 1999;284(5418):1313e8. [12] Levashina EA, Langley E, Green C, Gubb D, Ashburner M, Hoffmann JA, et al. Constitutive activation of toll-mediated antifungal defense in serpin-deficient Drosophila. Science 1999;285(5435):1917e9. [13] Gorman MJ, Paskewitz SM, Gorman MJ, Paskewitz SM. Serine proteases as mediators of mosquito immune responses. Insect Biochem Mol Biol 2001;31: 257e62. [14] Klein B, Le-Moullac G, Sellos D, Van-Wormhoudt A. Molecular cloning and sequencing of trypsin cDNAs from Penaeus vannamei (Crustacea, Decapoda): use in assessing gene expression during the moult cycle. Int J Biochem Cell Biol 1996;28(5):551e63. [15] Roux MM, Pain A, Klimpel KR, Dhar AK. The lipopolysaccharide and beta-1,3glucan binding protein gene is upregulated in white spot virus-infected shrimp (Penaeus stylirostris). J Virol 2002;76(14):7140e9. [16] Ghosh D, Porter E, Shen BO, Lee SK, Wilk D, Drazba J, et al. Paneth cell trypsin is the processing enzyme for human defensin-5. Nat Immunol 2002;3(6): 583e90. [17] Shi XZ, Ren Q, Zhao XF, Wang JX. Expression of four trypsin-like serine proteases from the Chinese shrimp, Fenneropenaeus chinensis, as regulated by pathogenic infection. Comp Biochem Physiol B Biochem Mol Biol 2009;153(1): 54e60. [18] Yuan Z, Dahms HU, Han LL, Li QY, Zhang QZ, Wu RJ, et al. Cloning and characterization of a trypsin-like serine protease gene, a novel regenerationrelated gene from Apostichopus japonicus. Gene 2012;502(1):46e52. [19] Xiao TY, Ge XK, Xu BH, Su JM, Zhang HY. Construction and analysis of subtracted cDNA library by suppression subtractive hybridization from Hyriopsis cumingii digestive gland. J Fish China 2009;33:856e964 [in Chinese]. [20] Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997;25(17):3389e402. [21] Schultz J, Milpetz F, Bork P, Ponting CP. SMART, a simple modular architecture research tool: identification of signaling domains. Proc Natl Acad Sci U S A 1998;95(11):5857e64. [22] Letunic I, Copley RR, Pils B, Pinkert S, Schultz J, Bork P. SMART 5: domains in the context of genomes and networks. Nucleic Acids Res 2006;34(Database issue):D257e60. [23] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24(8):1596e9.
Please cite this article in press as: Wang H, et al., Molecular cloning, characterization and expression analysis of trypsin-like serine protease from triangle-shell pearl mussel (Hyriopsis cumingii), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.07.032
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5
YFSIM3081_proof ■ 21 August 2014 ■ 6/6
6
H. Wang et al. / Fish & Shellfish Immunology xxx (2014) 1e6
[24] Chang MX, Nie P, Wei LL. Short and long peptidoglycan recognition proteins (PGRPs) in zebrafish, with findings of multiple PGRP homologs in teleost fish. Mol Immunol 2007;44(11):3005e23. [25] Yuan JS, Reed A, Chen F, Stewart CJ. Statistical analysis of real-time PCR data. BMC Bioinformatics 2006;7(1):85.
[26] Zhang YB, Gui JF. Molecular regulation of interferon antiviral response in fish. Dev Comp Immunol 2012;38:193e202. [27] Zhu R, Zhang YB, Zhang QY, et al. Functional domains and the antiviral effect of the double-stranded RNA-dependent protein kinase PKR from Paralichthys olivaceus. J Virol 2008;82:6889e901. Q1
Please cite this article in press as: Wang H, et al., Molecular cloning, characterization and expression analysis of trypsin-like serine protease from triangle-shell pearl mussel (Hyriopsis cumingii), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.07.032
6 7 8 9 10
YFSIM3081_proof ■ 21 August 2014 ■ 1/6
Fish & Shellfish Immunology xxx (2014) 1e6
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short communication
Molecular cloning, characterization and expression analysis of trypsin-like serine protease from triangle-shell pearl mussel (Hyriopsis cumingii) Q2
Hongquan Wang a, 1, Jian Liang a, 1, Yurong Zhao a, Qiaolin Liu a, Yaoguo Li a, Zili Yi b, Kaijian Chen a, Tiaoyi Xiao a, * a b
College of Animal Science and Technology, Hunan Agricultural University, Changsha, 410128, China College of Bioscience and Biotechnology, Hunan Agricultural University, Changsha, 410128, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 14 April 2014 Received in revised form 14 July 2014 Accepted 25 July 2014 Available online xxx
Trypsin-like serine protease (TLS) is ubiquitous in animals and plays a number of diverse roles, including dietary protein digestion, hemolymph coagulation, antimicrobial activity and immune responses, among others. This study reports the isolation of a 1048 bp full-length cDNA sequence of TLS from triangle-shell pearl mussel (Hyriopsis cumingii), including a 12 bp 5' UTR (untranslated region), a 172 bp 3' UTR, and an open reading frame (ORF) of 864 bp by rapid amplification of cDNA ends (RACE). Bioinformatic analysis shows that the gene belongs to the trypsin-like serine protease superfamily, and contains a 15 residues N-terminal signal peptide and a conserved C-terminal domain. In comparison to other serine proteases, the catalytic triad were identified as His-98, Asp-149, and Ser-240. Quantitative real-time PCR (qPCR) showed a broad expression of the TLS gene in ten tested tissues. Time-course expression analysis demonstrated that the expression level of the TLS mRNA was significantly up-regulated in eight tested tissues (liver, intestine, gill, heart, axe foot, adductor muscle, kidney and gonad), but down-regulated in mantle and stomach after Aeromonas hydrophila injection. This is one of the results indicate that TLS may be involved in innate defense reactions against A. hydrophila in triangle-shell pearl mussel. © 2014 Published by Elsevier Ltd.
Keywords: Triangle-shell pearl mussel Trypsin-like serine protease Quantitative real-time PCR Time-course expression
1. Introduction The triangle-shell pearl mussel (Hyriopsis cumingii), commonly known as the freshwater bivalve mollusk, belongs to the Unionidae family. It is a unique resource in China, prized for its pearl-making capabilities [1]. Like other invertebrates, the triangle-shell pearl mussel utilizes a series of innate immune responses which are believed to be its sole defense against microbial threats and invasion [2]. Deterioration of local aquaculture environments has led to a greater susceptibility of disease outbreaks among triangle-shell pearl mussel, causing a significant decline of its production. Previous study showed that A. hydrophila caused great damage to the aquatic animals [3] and it was the main pathogen which caused triangle-shell pearl mussel to be dead [4]. Serine proteases are involved in several functions including digestion, activation of the complement system, cell differentiation
* Corresponding author. Tel.: þ86 731 84618183; fax: þ86 731 84610280. E-mail address: [email protected] (T. Xiao). 1 These two authors contributed equally to this study.
and hemostasis, and this has been demonstrated in several microorganisms, plants, and animals [5]. TLS was a member of the chymotrypsin/trypsin family of serine proteases and was almost totally confined to animals [6]. TLS shared a common mechanism of catalysis that rely upon the coordinate action of three catalytic residues: His (H), Asp (D), Ser (S), which selectively hydrolyze peptide bonds C-terminal to basic amino acid residue [7,8]. TLS mostly function extracellularly in roles that include dietary protein digestion, hemolymph coagulation, antimicrobial peptide synthesis, and the activation of a rapidly immune pathway in response to pathogen detection [9e13]. TLS was found to be one of the most important proteases, contributing approximately 6% of soluble protein in the digestive gland [14]. Studies showed that prophenoloxidase (proPO) can be activated in vitro by exogenous trypsin in shrimp [15] and trypsin was involved in the regulation of innate immunity in the small intestine by acting an antimicrobial peptide prodefensin convertase [16]. Several TLS genes had been previously identified. Four trypsinlike serine protease genes were obtained from the hepatopancreas of the Chinese shrimp, with all showing upregulation during
http://dx.doi.org/10.1016/j.fsi.2014.07.032 1050-4648/© 2014 Published by Elsevier Ltd.
Please cite this article in press as: Wang H, et al., Molecular cloning, characterization and expression analysis of trypsin-like serine protease from triangle-shell pearl mussel (Hyriopsis cumingii), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.07.032
55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3081_proof ■ 21 August 2014 ■ 2/6
2
H. Wang et al. / Fish & Shellfish Immunology xxx (2014) 1e6
Fig. 1. The full-length cDNA sequence and deduced amino acid sequence of Trypsin-like Serine Protease. The signal peptide is labeled by the dashed underline. The serine protease Tryp_SPc domain is labeled by the single underline. The mRNA polyadenylation signal is labeled by the solid line box. The catalytic triad amino acids are labeled with rectangles on Q3 the left side.
host infection with the white spot syndrome virus (WSSV). An additional protease, Fctry3, showed increased expression levels after a bacterial challenge [17]. From a 1216 bp full-length cDNA sequence of TLS that was cloned from Apostichopus japonicus using the RACE technique, TLS was shown to be regulated during different stages of regeneration, suggesting that TLS was important in the regeneration process of A. japonicus [18]. In this study, a trypsin-like serine protease gene from H. cumingii was cloned. The tissue-specific expression and temporal expression profiles of the gene after stimulation with A. hydrophila were analyzed by qPCR. The results of this study determine the involvement of TLS in the innate immunity of triangle-shell mussel.
2. Materials and methods 2.1. Animal and immune challenge Triangle-shell mussels were obtained from a commercial farm in Changde, Hunan Province, China. The average weight was 280.73 ± 55.18 g and the average length was 13.57 ± 1.28 cm. The mussels were acclimatized for one week before the experiment at 24e28 C. A. hydrophila was received as a gift from the Institute of Hydrobiology at the Chinese Academy of Sciences. Healthy mussels were challenged by injection of 0.5 mL 109 cfu/ ml A. hydrophila. Unchallenged mussels were used as control. Tissue samples including liver, stomach, intestine, gill, heart, mantle, axe foot, adductor muscle, kidney, and gonad from three control mussels and three experimental mussels were collected at 0 h, 3 h, 6 h, 12 h, 24 h, and 48 h after injection, frozen in liquid nitrogen immediately for use.
2.2. RNA extraction and cDNA synthesis Total RNA contents from a variety of tissues (liver, stomach, intestine, gill, heart, mantle, axe foot, adductor muscle, kidney, gonad) were extracted according to the manufacturer's protocol of the RNAprep pure Tissue Kit (Tiangen biotech, China). The mRNAs of different tissues were reversely transcribed to cDNAs using the SMARTer™ RACE (Rapid amplification of cDNA ends) cDNA Amplification Kit (Clontech, USA).
2.3. Cloning and sequencing of trypsin-like serine proteases cDNA Primers for TLS gene were designed according to the expressed sequence tag (EST, GenBank accession number: EX828678) which was obtained by constructing a subtractive hybridization cDNA library [19]. 50 -RACE-Ready cDNA was synthesized using the SMART II™ A Oligonucleotide(AAGCAGTGG TATCAACGCAGAGTACGCGGG) and 50 -RACE CDS Primer A (AAGCAGTGGTATCAACGCAGAGTAC(T)30V N), then 50 -RACE was performed using the gene specific primer pairs UPM/TLS-GSPR-out (TCGCCCTGGCAAGCGTCTA.TTCC) and UPM/TLS-GSPR-in (AGCCTTCAAAGCCACAGCCGTAT) in nested PCRs. 30 -RACE-Ready cDNA was synthesized using the 30 -RACE CDS Primer A (AAGCAGTGGTATCAACGCAGAGTAC(T)30V N), then 30 -RACE was performed using the gene specific primer pairs UPM/TLS-GSPF-out (ACGGACGGAATGTTATGCGGTGGA) and UPM/ TLS-GSPF-in (ACGGCTGTGGCTTTGAAGGCTAT) in nested PCRs. PCR for 50 end of TLS was performed with the following program: 94 C for 5 min, followed by 5 cycles of 94 C for 30 s, 60 C for 30 s and 72 C for 45 s, then 30 cycles of 94 C for 30 s, 60 C for 30 s and 72 C for 45 s. After the final cycle, samples were incubated at 72 C for 10 min. PCR enrichment of 30 end of TLS was performed
Please cite this article in press as: Wang H, et al., Molecular cloning, characterization and expression analysis of trypsin-like serine protease from triangle-shell pearl mussel (Hyriopsis cumingii), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.07.032
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3081_proof ■ 21 August 2014 ■ 3/6
H. Wang et al. / Fish & Shellfish Immunology xxx (2014) 1e6 Table 1 TLS sequences of different species used for similarity and phylogenetic analysis. Species
Gene definition
Accession number
Identity
Hyriopsis cumingii
Trypsin-like serine protease Trypsin Trypsin-3 Trypsin-like serine protease Trypsin-like serine protease Trypsinogen Trypsin 1a Trypsin Trypsin3 trypsinogen II Trypsin 29F Trypsin 10 Trypsin
AEB70966
e
AAL67442 EKC18480 AFB81537
35.47% 37.13% 36.27%
AEO93271
30.77%
ADO08222 ADB66711 BAL62982 CAA75311 AAA98517 NP_523518 AAH87759 ACE80257
32.25% 34.80% 31.51% 34.81% 34.47% 32.31% 33.79% 32.53%
Paralithodes camtschaticus Crassostrea gigas Tenebrio molitor Apostichopus japonicus Branchiostoma belcheri Panulirus argus Ctenopharyngodon idella Litopenaeus vannamei Rattus norvegicus Drosophila melanogaster Xenopus (Silurana) tropicalis Marsupenaeus japonicus
according to the following program: 94 C for 5 min, followed by 35 cycles of 94 C for 30 s, 59 C for 30 s and 72 C for 45 s with a final extension step of 72 C for 10 min. The products of PCR were purified and cloned into the pUCm-T vector followed by sequencing. Cluster analysis was performed to overlap the 50 and 30 end with the EST sequence in order to obtain the full-length cDNA of the triangle-shell pearl mussel TLS gene. 2.4. Sequence analysis Similarity analysis was performed with NCBI BLASTX (http:// www.ncbi.nlm.nih.gov) [20]. Gene translation and prediction of the deduced protein structure were conducted with ExPASy tools (http://www.au.expasy.org/). Signal sequence and motif prediction were carried out using SMART (http://smart.embl-heidelberg.de/) [21,22]. Alignments were performed with ClustalW and GENDOC. MEGA 4.0 was used to generate the phylogenetic organization [23]. The clip domain and active sites were predicted via homolog sequence alignment.
3
control group mussels (the unchallenged mussels). First strand cDNA strands of each tissue were individually synthesized with the Revertaid™ First Strand cDNA Synthesis Kit (Toyobo, Japan). Afterwards, quantitative real-time PCR was performed using SYBR Green Realtime PCR Master Mix-Plus (Takara, Japan) according to manufacturer's instructions on an ABI 7300 Real-Time Detection System (Applied Biosystems, USA). The PCR reaction mixture (20 ml) consisted of 10.0 ml of 2 SYBR Premix Ex Taq™ Green, 0.4 ml of 50 Reference DyeI, 2.0 ml cDNA and 0.4 ml of each primer, and 6.8 ml ddH2O. A pair of specific primers (F: GAGCAAGTCAGTGGACCGTAGT; R: AAGTTGTTTTAGCGAGGCAGAC) were used to amplify a PCR product of 213 bp. The house-keeping gene b-actin was amplified as an internal control with a gene specific primer pair b-actin (F: TCCCCTCAACCCTAAAGCCAACA, R: CGGAAGCGTACAGCGACAACACA) with a PCR fragment size of 113 bp. qRT-PCR was programmed at 95 C for 30 s, followed by 40 cycles at 95 C for 5 s, and 60 C for 31 s. Finally, dissociation analysis of PCR products was performed at the end of each PCR reaction to confirm that only one product was amplified and detected. A series of the mixed first-strand cDNAs from all selected tissues diluted by 10fold were used to construct two standard curves [24]. Determination of the expression level of TLS used the comparative Ct method. In this method, the discrepancy between the Ct values of Trypsinlike Serine Protease and b-actin was calculated to normalize the variation in the amount of cDNA in each reaction. The expression level of TLS was then calculated by 2(△△Ct) [25]. All samples were repeated using three templates. The obtained data was subjected to statistical analysis followed by an unpaired sample t-test. A significant difference was accepted at P < 0.05. 2.6. Time-course expression of trypsin-like serine proteases Total RNA was isolated from the bacteria-challenged mussels at 3 h, 6 h, 12 h, 24 h, and 48 h post-inoculation. The qPCR reaction and Statistical analysis were the same as those described above. 3. Results and discussion 3.1. cDNA cloning and sequence characterization of the TLS
2.5. Analysis of the TLS expression in tissues from the control group mussels Total RNA was isolated from a variety of tissues (liver, intestine, gill, heart, axe foot, adductor muscle, kidney and gonad) of the
The full length TLS cDNA contains 1048 nucleotides, including a polyadenylation sequence, a 12 bp 50 untranslated region (UTR), a 864 bp open reading frame (ORF), and a 172 bp 30 untranslated region (GenBank accession no: HQ684736). The nucleotide sequence
Fig. 2. The phylogenetic organization of amino acid sequences of serine protease. A distance-based phylogenetic tree was computed using MEGA4.0. In the minimum evolution algorithm, a bootstrap value based on 100 replicates was used to construct the tree. TLS of H. cumingii was indicated with “C”.
Please cite this article in press as: Wang H, et al., Molecular cloning, characterization and expression analysis of trypsin-like serine protease from triangle-shell pearl mussel (Hyriopsis cumingii), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.07.032
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3081_proof ■ 21 August 2014 ■ 4/6
4
H. Wang et al. / Fish & Shellfish Immunology xxx (2014) 1e6
Fig. 3. Relative expression of the TLS gene in different tissues. Values were shown as mean ± S.E (N ¼ 3). In the same row, values with the same letter superscripts mean no significant difference (P > 0.05), while with different small letter superscripts mean significant difference (P < 0.05). The same as below.
at the 30 end of the non-coding region was also found to contain one“AATAAA”mRNA polyadenylation signal motif and one“ATTTA” unstable mRNA motif (Fig. 1). SMART analysis revealed that the deduced amino acid sequence contained one signal peptide located at residues 1e15 and a Tryp_SPc domain located at residues 52e283. ScanProsite analysis indicated that Trypsin-like Serine Protease contained the catalytic triad (H98, D149, S240), a highly conserved active site of TLS. BLAST homology search against the GenBank database led to the discovery of a Tryp_SPc domain. The results obtained from above showed that the trypsin-like Serine Protease gene belongs to the serine protease family because serine proteases were characterized by the catalytic triad containing H, D, and S residues in the active site. The TLS could form four Disulfide Bonds (Cys79-Cys99, Cys181-Cys246, Cys212Cys227, Cys236-Cys264), resulting in a more compact structure. The TLS contained a canonical histidine active site signature motif
Fig. 4. Time-course expression profiles of TLS in mantle (A), adductor muscle (B), axe foot (C), heart (D) and gonad (E), intestine (F), gill (G), liver (H), kidney (I), and stomach (J) after challenge with A. hydrophila measured by qPCR. Values were shown as mean ± S.E (N ¼ 3).
Please cite this article in press as: Wang H, et al., Molecular cloning, characterization and expression analysis of trypsin-like serine protease from triangle-shell pearl mussel (Hyriopsis cumingii), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.07.032
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YFSIM3081_proof ■ 21 August 2014 ■ 5/6
H. Wang et al. / Fish & Shellfish Immunology xxx (2014) 1e6
(V94TAAHC99) and a canonical serine active site signature motif (D234ACQGDSGGPLV245). 3.2. Homology and phylogenetics analysis of trypsin-like serine protease The results of two sequence alignments by DNAMAN showed that the TLS of H. cumingii shared less similarity and homology with other species (Table 1). The most closest was found to be Trypsin-3 from Crassostrea gigas (37.13%) and Trypsin-like serine protease from Tenebrio molitor (36.27%). Mega 4.0 software was used to construct the phylogenetic tree for TLS. A phylogenetic analysis based on the amino acid sequences of TLS and other members of the serine protease family showed that the TLS of H. cumingii formed an exclusive clade which meaned that H. cumingii had a distant relationship with the other species(Fig. 2). Drosophila melanogaster and T. molitor were clustered into a clade, and the remained species clustered into a clade. This suggests that the direction of TLS evolution is consistent with that of the evolution of species. 3.3. Tissue distribution and expression profiles of TLS in the mussels Analysis of TLS transcripts present in the total RNAs extracted from the mussel mantle, adductor muscle, axe foot, heart, gonad, intestine, gill, liver, kidney, and stomach of the control group mussel revealed that the TLS gene was broadly expressed in all tissues selected, according to qPCR. The results showed that the TLS gene was most highly expressed in mantle and stomach (P < 0.05), while the expression levels in other tissues (intestine, gill, heart, mantle, axe foot, liver, kidney and gonad) were relatively equal, if not diminished (Fig. 3). It might imply that it was consistent with the main function of TLS gene which was involved in immune response and digestion. 3.4. Time-course expression profiles of the TLS gene after challenge by A. hydrophila The expression patterns of TLS under conditions of A. hydrophila challenge were observed using qRT-PCR methods in order to investigate the roles of the TLS gene from H. cumingii in antibacterial innate immunity. In the time course of gene expression in adduct muscle, TLS expression levels increased to the highest level by 3 h after A. hydrophila challenge and then gradually decreased to the lowest level from 3 to 24 h. Notably, its expression level reached a second peak at 48 h (Fig. 4B). Expression level of the TLS mRNA in kidney peaked at 3 h, dropped to a lower level at 12 h, then increased to its highest level at 24 h nearly 67521 times higher than the control group after 48 h stimulation (Fig. 4I). TLS mRNA was significantly up-regulated at 48 h after bacterial injection in most tissues and especially in kidney, it indicate that TLS might be involved in innate defense reactions against A. hydrophila in triangle-shell pearl mussel. However in the mantle and stomach, TLS mRNA expression was significantly down-regulated, whether it might imply that TLS was involved in host defense against A. hydrophila through the special negative regulation mechanism, still need further research. The recent years have witnessed tremendous progress in identification of aquatic animals genes involved in innate response to bacteria and virus infection, such as interferons (IFNs) [26], PKR [27]. In summary, trypsin-like serine protease gene was cloned from triangle-shell pearl mussel, allowing for the identification of their expression profiles in triangle-shell pearl mussel infected with A. hydrophila. The results indicated that trypsin-like serine proteases might be involved in the innate immune system of H.
5
cumingii. As such, further studies are recommended to explain the mechanism of trypsin-like serine proteases involved in innate defense reactions.
Acknowledgments This study was supported by the National Natural Science Foundation of China award to Tiaoyi Xiao (No.31040083). The authors wish to thank Dr. Xiao Ma from the College of Animal Science and Technology, Hunan Agricultural University for data processing and linguistic modification.
References [1] Ren Q, Qi YL, Hui KM, Zhang Z, Zhang CY, Wang W. Four invertebrate-type lysozyme genes from triangle-shell pearl mussel (Hyriopsis cumingii). Fish Shellfish Immunol 2012;33(4):909e15. [2] Zasloff M. Innate immunity, antimicrobial peptides, and protection of the oral cavity. Lancet 2002;360(9340):1116e7. [3] Zhang B, Zeng LB, Luo XS, et al. Isolation and identification of pathogen from Enteric Septicemia of Black Carp (Mylopharyngodon piceus). J Huazhong Agric Univ 2010;29(5):607e12 [in Chinese]. [4] Liu XY, Jin H, Zhu SW, et al. The disease and the way to prevent the disease of the triangle-shell pearl mussel. Inland Fish 1997;4:6e7 [in Chinese]. [5] Braud S, Bon C, Wisner A. Snake venom proteins acting on hemostasis. Biochimie 2000;82(9e10):851e9. [6] Rawlings ND, Barrett AJ. Evolutionary families of peptidases. J Biochem 1993;290(Pt 1):205e18. [7] Volz J, Osta MA, Kafatos FC, Muller HM. The roles of two clip domain serine proteases in innate immune responses of the malaria vector Anopheles gambiae. J Biol Chem 2005;280(48):40161e8. [8] Chen C, Darrow AL, Qi JS, D'Andrea MR, Andrade-Gordon P. A novel serine protease predominately expressed in macrophages. J Biochem 2003;374(Pt 1): 97e107. [9] Dana AN, Hong YS, Kern MK, Hillenmeyer ME, Harker BW, Lobo NF, et al. Gene expression patterns associated with blood-feeding in the malaria mosquito Anopheles gambiae. BMC Genomics 2005;6:5e9. [10] Iwanaga S, Kawabata S, Muta T. New types of clotting factors and defense molecules found in horseshoe crab hemolymph: their structures and functions. J Biochem 1998;123(1):1e15. [11] Hoffmann JA, Kafatos FC, Janeway Jr CA, Ezekowitz RAB. Phylogenetic perspectives in innate immunity. Science 1999;284(5418):1313e8. [12] Levashina EA, Langley E, Green C, Gubb D, Ashburner M, Hoffmann JA, et al. Constitutive activation of toll-mediated antifungal defense in serpin-deficient Drosophila. Science 1999;285(5435):1917e9. [13] Gorman MJ, Paskewitz SM, Gorman MJ, Paskewitz SM. Serine proteases as mediators of mosquito immune responses. Insect Biochem Mol Biol 2001;31: 257e62. [14] Klein B, Le-Moullac G, Sellos D, Van-Wormhoudt A. Molecular cloning and sequencing of trypsin cDNAs from Penaeus vannamei (Crustacea, Decapoda): use in assessing gene expression during the moult cycle. Int J Biochem Cell Biol 1996;28(5):551e63. [15] Roux MM, Pain A, Klimpel KR, Dhar AK. The lipopolysaccharide and beta-1,3glucan binding protein gene is upregulated in white spot virus-infected shrimp (Penaeus stylirostris). J Virol 2002;76(14):7140e9. [16] Ghosh D, Porter E, Shen BO, Lee SK, Wilk D, Drazba J, et al. Paneth cell trypsin is the processing enzyme for human defensin-5. Nat Immunol 2002;3(6): 583e90. [17] Shi XZ, Ren Q, Zhao XF, Wang JX. Expression of four trypsin-like serine proteases from the Chinese shrimp, Fenneropenaeus chinensis, as regulated by pathogenic infection. Comp Biochem Physiol B Biochem Mol Biol 2009;153(1): 54e60. [18] Yuan Z, Dahms HU, Han LL, Li QY, Zhang QZ, Wu RJ, et al. Cloning and characterization of a trypsin-like serine protease gene, a novel regenerationrelated gene from Apostichopus japonicus. Gene 2012;502(1):46e52. [19] Xiao TY, Ge XK, Xu BH, Su JM, Zhang HY. Construction and analysis of subtracted cDNA library by suppression subtractive hybridization from Hyriopsis cumingii digestive gland. J Fish China 2009;33:856e964 [in Chinese]. [20] Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997;25(17):3389e402. [21] Schultz J, Milpetz F, Bork P, Ponting CP. SMART, a simple modular architecture research tool: identification of signaling domains. Proc Natl Acad Sci U S A 1998;95(11):5857e64. [22] Letunic I, Copley RR, Pils B, Pinkert S, Schultz J, Bork P. SMART 5: domains in the context of genomes and networks. Nucleic Acids Res 2006;34(Database issue):D257e60. [23] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24(8):1596e9.
Please cite this article in press as: Wang H, et al., Molecular cloning, characterization and expression analysis of trypsin-like serine protease from triangle-shell pearl mussel (Hyriopsis cumingii), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.07.032
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5
YFSIM3081_proof ■ 21 August 2014 ■ 6/6
6
H. Wang et al. / Fish & Shellfish Immunology xxx (2014) 1e6
[24] Chang MX, Nie P, Wei LL. Short and long peptidoglycan recognition proteins (PGRPs) in zebrafish, with findings of multiple PGRP homologs in teleost fish. Mol Immunol 2007;44(11):3005e23. [25] Yuan JS, Reed A, Chen F, Stewart CJ. Statistical analysis of real-time PCR data. BMC Bioinformatics 2006;7(1):85.
[26] Zhang YB, Gui JF. Molecular regulation of interferon antiviral response in fish. Dev Comp Immunol 2012;38:193e202. [27] Zhu R, Zhang YB, Zhang QY, et al. Functional domains and the antiviral effect of the double-stranded RNA-dependent protein kinase PKR from Paralichthys olivaceus. J Virol 2008;82:6889e901. Q1
Please cite this article in press as: Wang H, et al., Molecular cloning, characterization and expression analysis of trypsin-like serine protease from triangle-shell pearl mussel (Hyriopsis cumingii), Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.07.032
6 7 8 9 10
